Starting /dee2/code/volunteer_pipeline.sh SRR7030819 current disk space = 3050934296576 free memory = 1471632624 SRR7030819 SRAfilesize 1075d12403621c9fa2495afd127dc1e0 SRR7030819.sra SRR7030819.sra file validated SRR7030819 is paired end SRR7030819 is conventional basespace SRR7030819 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030819_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.14075 33.0 33.0 34.0 31.0 34.0 2 32.44375 33.0 33.0 34.0 29.0 34.0 3 32.44225 33.0 33.0 34.0 29.0 34.0 4 31.70125 33.0 32.0 33.0 30.0 34.0 5 32.323 33.0 33.0 33.0 31.0 34.0 6 35.897 38.0 36.0 38.0 33.0 38.0 7 36.958 38.0 37.0 38.0 35.0 38.0 8 37.19275 38.0 38.0 38.0 36.0 38.0 9 37.42375 38.0 38.0 38.0 37.0 38.0 10-14 37.461400000000005 38.0 38.0 38.0 37.0 38.0 15-19 37.449 38.0 38.0 38.0 37.0 38.0 20-24 37.44805 38.0 38.0 38.0 37.0 38.0 25-29 37.423 38.0 38.0 38.0 37.0 38.0 30-34 37.336400000000005 38.0 38.0 38.0 37.0 38.0 35-39 37.3082 38.0 38.0 38.0 37.0 38.0 40-44 37.253550000000004 38.0 38.0 38.0 36.8 38.0 45-49 37.2202 38.0 38.0 38.0 36.4 38.0 50-54 37.22675 38.0 38.0 38.0 36.4 38.0 55-59 37.189299999999996 38.0 38.0 38.0 36.0 38.0 60-64 37.08 38.0 38.0 38.0 36.0 38.0 65-69 37.02524999999999 38.0 38.0 38.0 36.0 38.0 70-74 37.0169 38.0 38.0 38.0 36.0 38.0 75-79 36.879000000000005 38.0 38.0 38.0 35.0 38.0 80-84 36.816100000000006 38.0 38.0 38.0 35.0 38.0 85-89 36.745349999999995 38.0 38.0 38.0 35.0 38.0 90-94 36.653749999999995 38.0 38.0 38.0 34.4 38.0 95-99 36.46385 38.0 38.0 38.0 34.0 38.0 100-104 36.41325 38.0 38.0 38.0 34.0 38.0 105-109 36.1266 38.0 37.4 38.0 33.0 38.0 110-114 36.2553 38.0 37.6 38.0 33.6 38.0 115-119 36.0009 38.0 37.0 38.0 32.6 38.0 120-124 35.8356 38.0 36.6 38.0 31.8 38.0 125-129 35.52015 38.0 36.0 38.0 31.0 38.0 130-134 35.22925 38.0 35.8 38.0 29.2 38.0 135-139 34.9144 38.0 35.2 38.0 28.0 38.0 140-144 34.69945 38.0 35.0 38.0 27.6 38.0 145-149 34.10395 38.0 35.0 38.0 25.0 38.0 150-151 30.915750000000003 36.5 30.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 2.0 16 0.0 17 2.0 18 1.0 19 2.0 20 3.0 21 3.0 22 4.0 23 7.0 24 11.0 25 13.0 26 18.0 27 22.0 28 24.0 29 35.0 30 43.0 31 59.0 32 81.0 33 109.0 34 153.0 35 278.0 36 712.0 37 2417.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.74782837588839 12.266385891023953 8.897078178468018 37.08870755461964 2 22.95 13.900000000000002 34.825 28.325 3 18.075 19.825 27.950000000000003 34.150000000000006 4 22.575 27.775 23.200000000000003 26.450000000000003 5 22.825 32.35 24.125 20.7 6 19.2 36.449999999999996 23.474999999999998 20.875 7 14.875 28.000000000000004 38.65 18.475 8 17.1 26.625 31.125000000000004 25.15 9 17.4 25.0 32.9 24.7 10-14 20.355 29.270000000000003 26.919999999999998 23.455000000000002 15-19 20.1 27.79 27.794999999999998 24.315 20-24 20.630000000000003 28.08 27.950000000000003 23.34 25-29 20.155 28.084999999999997 28.025 23.735 30-34 20.26 29.404999999999998 26.595000000000002 23.74 35-39 19.905 28.04 27.250000000000004 24.805 40-44 20.05 28.65 27.41 23.89 45-49 20.435 28.22 27.22 24.125 50-54 21.02 27.810000000000002 27.279999999999998 23.89 55-59 20.885 28.389999999999997 27.22 23.505000000000003 60-64 21.15 28.389999999999997 26.77 23.69 65-69 20.880000000000003 27.894999999999996 27.544999999999998 23.68 70-74 20.474999999999998 28.360000000000003 27.05 24.115000000000002 75-79 20.765 27.57 27.32 24.345 80-84 20.895 28.09 27.195000000000004 23.82 85-89 20.695 28.360000000000003 26.595000000000002 24.349999999999998 90-94 21.32 27.92 27.400000000000002 23.36 95-99 21.060000000000002 27.694999999999997 27.744999999999997 23.5 100-104 20.8 27.955000000000002 27.284999999999997 23.96 105-109 20.945 27.91 27.105 24.04 110-114 21.125 28.134999999999998 27.42 23.32 115-119 21.205 28.26 26.640000000000004 23.895 120-124 21.21 28.384999999999998 26.805 23.599999999999998 125-129 20.580000000000002 28.57 27.045 23.805 130-134 20.830000000000002 28.144999999999996 27.339999999999996 23.685000000000002 135-139 21.25 27.365000000000002 27.42 23.965 140-144 21.105 27.700000000000003 27.38 23.815 145-149 21.529999999999998 28.34 26.27 23.86 150-151 21.349999999999998 27.8375 27.1125 23.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.5 20 1.5 21 0.5 22 0.5 23 1.5 24 2.5 25 3.0 26 4.0 27 7.5 28 9.5 29 12.0 30 15.0 31 18.5 32 27.0 33 39.0 34 47.5 35 57.5 36 78.0 37 88.5 38 92.5 39 132.5 40 173.0 41 195.0 42 225.0 43 252.0 44 284.5 45 286.5 46 260.5 47 244.0 48 236.5 49 227.0 50 200.5 51 165.0 52 142.0 53 114.5 54 86.0 55 70.5 56 56.0 57 43.0 58 26.5 59 19.0 60 16.0 61 10.5 62 8.5 63 5.0 64 2.0 65 3.5 66 3.0 67 1.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54785229841748 99.075 2 0.42702838482793265 0.8500000000000001 3 0.025119316754584273 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.21250000000000002 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.44999999999999996 0.0 0.0 0.0 0.0 112-113 0.5125 0.0 0.0 0.0 0.0 114-115 0.675 0.0 0.0 0.0 0.0 116-117 0.8 0.0 0.0 0.0 0.0 118-119 0.9625 0.0 0.0 0.0 0.0 120-121 1.1375000000000002 0.0 0.0 0.0 0.0 122-123 1.2875 0.0 0.0 0.0 0.0 124-125 1.45 0.0 0.0 0.0 0.0 126-127 1.5875 0.0 0.0 0.0 0.0 128-129 1.8375 0.0 0.0 0.0 0.0 130-131 1.9874999999999998 0.0 0.0 0.0 0.0 132-133 2.15 0.0 0.0 0.0 0.0 134-135 2.5 0.0 0.0 0.0 0.0 136-137 2.7249999999999996 0.0 0.0 0.0 0.0 138-139 3.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAACAAT 10 0.0068396386 144.9375 145 GTTCCAT 30 0.0013864982 77.3 1 >>END_MODULE SRR7030819 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030819_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.743 33.0 33.0 34.0 32.0 34.0 2 32.89025 33.0 33.0 34.0 32.0 34.0 3 32.925 34.0 33.0 34.0 32.0 34.0 4 32.85875 33.0 33.0 34.0 32.0 34.0 5 32.84125 33.0 33.0 34.0 32.0 34.0 6 37.096 38.0 38.0 38.0 36.0 38.0 7 37.11525 38.0 38.0 38.0 36.0 38.0 8 36.99975 38.0 38.0 38.0 36.0 38.0 9 37.01175 38.0 38.0 38.0 36.0 38.0 10-14 37.04405 38.0 38.0 38.0 36.2 38.0 15-19 36.971250000000005 38.0 38.0 38.0 36.0 38.0 20-24 37.047450000000005 38.0 38.0 38.0 36.2 38.0 25-29 36.9191 38.0 38.0 38.0 36.0 38.0 30-34 37.00155 38.0 38.0 38.0 36.0 38.0 35-39 36.8568 38.0 38.0 38.0 36.0 38.0 40-44 36.858450000000005 38.0 38.0 38.0 36.0 38.0 45-49 36.793949999999995 38.0 38.0 38.0 35.6 38.0 50-54 36.6845 38.0 38.0 38.0 34.8 38.0 55-59 36.65245 38.0 38.0 38.0 35.2 38.0 60-64 36.6044 38.0 38.0 38.0 34.6 38.0 65-69 36.6063 38.0 38.0 38.0 34.6 38.0 70-74 36.46255 38.0 38.0 38.0 34.0 38.0 75-79 36.47975 38.0 38.0 38.0 34.0 38.0 80-84 36.3147 38.0 38.0 38.0 34.0 38.0 85-89 36.210300000000004 38.0 37.6 38.0 33.4 38.0 90-94 36.15195 38.0 37.4 38.0 33.6 38.0 95-99 35.9238 38.0 37.2 38.0 33.0 38.0 100-104 35.65304999999999 38.0 37.0 38.0 31.0 38.0 105-109 35.540350000000004 38.0 37.0 38.0 31.0 38.0 110-114 35.36295 38.0 36.6 38.0 29.6 38.0 115-119 35.1749 38.0 36.0 38.0 28.4 38.0 120-124 35.009299999999996 38.0 36.0 38.0 28.2 38.0 125-129 34.6531 38.0 35.4 38.0 26.8 38.0 130-134 34.32685 38.0 35.0 38.0 25.0 38.0 135-139 34.00475 38.0 35.0 38.0 23.0 38.0 140-144 33.64465 38.0 34.6 38.0 21.8 38.0 145-149 32.701750000000004 38.0 33.8 38.0 15.2 38.0 150-151 28.962125 36.0 24.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 1.0 4 2.0 5 0.0 6 2.0 7 0.0 8 1.0 9 2.0 10 0.0 11 2.0 12 3.0 13 1.0 14 4.0 15 4.0 16 2.0 17 6.0 18 6.0 19 10.0 20 11.0 21 10.0 22 13.0 23 13.0 24 12.0 25 24.0 26 25.0 27 22.0 28 38.0 29 46.0 30 54.0 31 55.0 32 82.0 33 111.0 34 190.0 35 306.0 36 680.0 37 2255.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.184296074018505 21.380345086271568 13.15328832208052 28.28207051762941 2 27.406851712928233 25.55638909727432 29.882470617654416 17.154288572143038 3 19.909954977488745 29.364682341170585 30.69034517258629 20.035017508754375 4 21.885942971485743 33.74187093546773 23.911955977988995 20.460230115057527 5 24.55613903475869 37.2093023255814 21.13028257064266 17.104276069017253 6 20.225 37.5 23.599999999999998 18.675 7 22.075 21.3 37.075 19.55 8 22.925 24.95 27.975 24.15 9 22.875 24.474999999999998 28.999999999999996 23.65 10-14 23.175 29.205 26.05 21.57 15-19 22.85 27.67 27.48 22.0 20-24 22.625 27.845 27.66 21.87 25-29 22.67 28.405 27.794999999999998 21.13 30-34 22.735 28.28 27.66 21.325 35-39 22.689999999999998 28.110000000000003 27.565 21.634999999999998 40-44 22.78 28.205000000000002 27.529999999999998 21.485000000000003 45-49 22.625 28.03 27.97 21.375 50-54 22.695 27.529999999999998 28.189999999999998 21.584999999999997 55-59 23.105 27.775 27.515 21.605 60-64 22.755 26.66 27.894999999999996 22.689999999999998 65-69 23.549999999999997 27.315 27.560000000000002 21.575 70-74 23.005 27.195000000000004 28.000000000000004 21.8 75-79 23.05 28.060000000000002 27.345000000000002 21.545 80-84 23.505000000000003 28.189999999999998 27.205000000000002 21.099999999999998 85-89 23.580000000000002 27.66 27.54 21.22 90-94 23.54 28.015 27.38 21.065 95-99 23.59 27.584999999999997 27.925 20.9 100-104 23.56 26.795 28.27 21.375 105-109 23.93 27.595 27.095000000000002 21.38 110-114 23.805 27.52 27.74 20.935000000000002 115-119 23.93 27.855 27.560000000000002 20.655 120-124 24.240000000000002 27.82 27.465 20.474999999999998 125-129 24.415 27.555000000000003 27.055 20.974999999999998 130-134 24.295 27.865000000000002 27.195000000000004 20.645 135-139 24.959999999999997 27.355 27.555000000000003 20.13 140-144 24.695 28.18 26.705000000000002 20.419999999999998 145-149 24.535 27.965 26.935 20.565 150-151 25.45 28.15 26.6625 19.7375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 0.0 25 0.5 26 3.0 27 5.0 28 3.5 29 7.5 30 10.0 31 11.0 32 21.0 33 34.0 34 52.0 35 61.0 36 62.0 37 82.5 38 125.0 39 163.5 40 193.0 41 213.0 42 254.0 43 281.5 44 282.0 45 281.0 46 259.0 47 250.0 48 241.0 49 212.5 50 188.0 51 157.5 52 127.5 53 101.0 54 75.0 55 66.0 56 51.5 57 34.0 58 27.5 59 22.5 60 12.5 61 7.5 62 5.0 63 2.5 64 2.5 65 3.0 66 2.0 67 0.0 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.05 4 0.05 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.09067946451124 98.075 2 0.8082849204344532 1.6 3 0.07577671129072998 0.22499999999999998 4 0.025258903763576663 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.21250000000000002 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.3375 0.0 0.0 0.0 0.0 110-111 0.42500000000000004 0.0 0.0 0.0 0.0 112-113 0.5125 0.0 0.0 0.0 0.0 114-115 0.675 0.0 0.0 0.0 0.0 116-117 0.8 0.0 0.0 0.0 0.0 118-119 0.9625 0.0 0.0 0.0 0.0 120-121 1.1375000000000002 0.0 0.0 0.0 0.0 122-123 1.2875 0.0 0.0 0.0 0.0 124-125 1.475 0.0 0.0 0.0 0.0 126-127 1.6124999999999998 0.0 0.0 0.0 0.0 128-129 1.8624999999999998 0.0 0.0 0.0 0.0 130-131 2.0125 0.0 0.0 0.0 0.0 132-133 2.175 0.0 0.0 0.0 0.0 134-135 2.5 0.0 0.0 0.0 0.0 136-137 2.75 0.0 0.0 0.0 0.0 138-139 3.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCACTTT 10 0.006830828 145.0 2 TTAACCC 10 0.006830828 145.0 2 >>END_MODULE Read 862262 spots for SRR7030819.sra Written 862262 spots for SRR7030819.sra Read 862262 spots for SRR7030819.sra Written 862262 spots for SRR7030819.sra Read 862262 spots for SRR7030819.sra Written 862262 spots for SRR7030819.sra Read 862262 spots for SRR7030819.sra Written 862262 spots for SRR7030819.sra Read 862262 spots for SRR7030819.sra Written 862262 spots for SRR7030819.sra Read 862262 spots for SRR7030819.sra Written 862262 spots for SRR7030819.sra Read 862262 spots for SRR7030819.sra Written 862262 spots for SRR7030819.sra Read 862262 spots for SRR7030819.sra Written 862262 spots for SRR7030819.sra Read 862270 spots for SRR7030819.sra Written 862270 spots for SRR7030819.sra Read 862262 spots for SRR7030819.sra Written 862262 spots for SRR7030819.sra Read 862262 spots for SRR7030819.sra Written 862262 spots for SRR7030819.sra Read 862262 spots for SRR7030819.sra Written 862262 spots for SRR7030819.sra Read 862262 spots for SRR7030819.sra Written 862262 spots for SRR7030819.sra Read 862262 spots for SRR7030819.sra Written 862262 spots for SRR7030819.sra Read 862262 spots for SRR7030819.sra Written 862262 spots for SRR7030819.sra Read 862262 spots for SRR7030819.sra Written 862262 spots for SRR7030819.sra Read 862262 spots for SRR7030819.sra Written 862262 spots for SRR7030819.sra Read 862262 spots for SRR7030819.sra Written 862262 spots for SRR7030819.sra Read 862262 spots for SRR7030819.sra Written 862262 spots for SRR7030819.sra Read 862262 spots for SRR7030819.sra Written 862262 spots for SRR7030819.sra SRR ids: ['SRR7030819.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_epiowkfi SRR7030819.sra spots: 17245248 blocks: [[1, 862262], [862263, 1724524], [1724525, 2586786], [2586787, 3449048], [3449049, 4311310], [4311311, 5173572], [5173573, 6035834], [6035835, 6898096], [6898097, 7760358], [7760359, 8622620], [8622621, 9484882], [9484883, 10347144], [10347145, 11209406], [11209407, 12071668], [12071669, 12933930], [12933931, 13796192], [13796193, 14658454], [14658455, 15520716], [15520717, 16382978], [16382979, 17245248]] SRR7030819 file size 5822148 SRR7030819 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7030819 SRR7030819_1.fastq SRR7030819_2.fastq Input file: SRR7030819_1.fastq Paired file: SRR7030819_2.fastq trimmed: SRR7030819-trimmed-pair1.fastq, SRR7030819-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 19:57:37 2025 >> started Wed Feb 12 19:57:58 2025 >> done (21.187s) 17245248 read pairs processed; of these: 18328 ( 0.11%) short read pairs filtered out after trimming by size control 17006 ( 0.10%) empty read pairs filtered out after trimming by size control 17209914 (99.80%) read pairs available; of these: 6592623 (38.31%) trimmed read pairs available after processing 10617291 (61.69%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 2 0.00% 21 4 0.00% 22 0 0.00% 23 3 0.00% 24 3 0.00% 25 6 0.00% 26 3 0.00% 27 4 0.00% 28 5 0.00% 29 5 0.00% 30 1 0.00% 31 4 0.00% 32 2 0.00% 33 8 0.00% 34 2 0.00% 35 3 0.00% 36 2 0.00% 37 5 0.00% 38 4 0.00% 39 6 0.00% 40 7 0.00% 41 7 0.00% 42 7 0.00% 43 8 0.00% 44 3 0.00% 45 9 0.00% 46 8 0.00% 47 8 0.00% 48 11 0.00% 49 13 0.00% 50 17 0.00% 51 14 0.00% 52 19 0.00% 53 14 0.00% 54 22 0.00% 55 24 0.00% 56 16 0.00% 57 40 0.00% 58 40 0.00% 59 32 0.00% 60 42 0.00% 61 43 0.00% 62 55 0.00% 63 68 0.00% 64 74 0.00% 65 47 0.00% 66 96 0.00% 67 88 0.00% 68 109 0.00% 69 146 0.00% 70 145 0.00% 71 168 0.00% 72 182 0.00% 73 199 0.00% 74 248 0.00% 75 251 0.00% 76 330 0.00% 77 376 0.00% 78 364 0.00% 79 438 0.00% 80 474 0.00% 81 575 0.00% 82 685 0.00% 83 847 0.00% 84 1790 0.01% 85 2296 0.01% 86 2344 0.01% 87 2581 0.01% 88 2707 0.02% 89 2873 0.02% 90 2832 0.02% 91 3053 0.02% 92 3184 0.02% 93 3561 0.02% 94 3590 0.02% 95 3872 0.02% 96 4046 0.02% 97 4393 0.03% 98 4538 0.03% 99 4926 0.03% 100 5187 0.03% 101 5530 0.03% 102 6088 0.04% 103 6434 0.04% 104 7131 0.04% 105 7551 0.04% 106 7922 0.05% 107 8543 0.05% 108 8844 0.05% 109 9423 0.05% 110 10225 0.06% 111 10961 0.06% 112 11754 0.07% 113 12770 0.07% 114 13708 0.08% 115 14806 0.09% 116 15766 0.09% 117 16675 0.10% 118 17346 0.10% 119 18081 0.11% 120 18745 0.11% 121 19928 0.12% 122 21108 0.12% 123 22886 0.13% 124 24230 0.14% 125 25387 0.15% 126 27088 0.16% 127 28535 0.17% 128 30205 0.18% 129 31550 0.18% 130 33471 0.19% 131 35815 0.21% 132 37883 0.22% 133 40468 0.24% 134 43269 0.25% 135 46652 0.27% 136 50560 0.29% 137 54394 0.32% 138 58958 0.34% 139 64092 0.37% 140 68322 0.40% 141 74734 0.43% 142 83231 0.48% 143 94171 0.55% 144 109786 0.64% 145 132924 0.77% 146 167953 0.98% 147 228809 1.33% 148 351012 2.04% 149 705075 4.10% 150 3587605 20.85% 151 10617291 61.69% 17209914 reads passed initial QC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=4.34 fanout-score-rank=12 prefix-density=0.41 prefix-fanout=3.3 sequence=CCATTGCTTGCAATGGAAGTAATGTCATT criterion=fanout-score sequence-density=0.03 sequence-density-rank=34 fanout-score=71.95 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=10.3 sequence=AGAAAGAAGAATAAATATTCCAAGTATTGATCGATGTACACCAACAAGGGACTTTTCATTGAATCAAACGGTTATGTGCCTCTCCACAACAGATAAGATCAGGATCTTCACTTGGTGATGGCGTAGATAGCATAAATAATTCCAGGGAGGTAGCCAAAGAAGGTGAGAAGCAAGCAGATCCAAAACTCCACCCCGCAGCC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=32 prefix-density=0.45 prefix-fanout=2.0 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.10 sequence-density-rank=26 fanout-score=154.08 fanout-score-rank=1 prefix-density=0.63 prefix-fanout=23.9 sequence=CAAAGAAGAAAAACAGTTTCTCAAGAGCAGTATATATAGATCTTTCAGAAGAATTAAGGAGATGGCAGACGAGGGAACAGCTACTTGCATAGACATCTTGTTGGCCATCATCTTGCCTCCGCTTGGTGTCTTCCTCAAGTT SRR7030819 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 19:58:44 Started mapping on | Feb 12 19:58:44 Finished on | Feb 12 20:00:27 Mapping speed, Million of reads per hour | 601.51 Number of input reads | 17209914 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 16470890 Uniquely mapped reads % | 95.71% Average mapped length | 296.90 Number of splices: Total | 15475594 Number of splices: Annotated (sjdb) | 15253264 Number of splices: GT/AG | 15236026 Number of splices: GC/AG | 193606 Number of splices: AT/AC | 10030 Number of splices: Non-canonical | 35932 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.79 Insertion rate per base | 0.02% Insertion average length | 2.69 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 512878 % of reads mapped to multiple loci | 2.98% Number of reads mapped to too many loci | 34495 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.07% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 244769 244769 244769 N_multimapping 512878 512878 512878 N_noFeature 199849 16320238 264854 N_ambiguous 160733 906 74703 UnstrandedReadsAssigned:16110308 PositiveStrandReadsAssigned:149746 NegativeStrandReadsAssigned:16131333 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7030819 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7030819-trimmed-pair1.fastq SRR7030819-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,209,914 reads, 16,126,178 reads pseudoaligned [quant] estimated average fragment length: 251.942 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,053 rounds 52401 SRR7030819.ke.tsv 34699 SRR7030819.se.tsv 87100 total ==> SRR7030819.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1767.06 1885 45.0808 Potri.005G024800.1.v4.1 1035 784.058 1757 94.7011 Potri.004G059700.1.v4.1 961 710.076 21 1.24982 Potri.007G009000.2.v4.1 1416 1165.06 0 0 Potri.003G141000.2.v4.1 2943 2692.06 618 9.70142 Potri.016G087400.1.v4.1 270 68.2796 1264.1 782.386 Potri.015G069301.1.v4.1 564 316.027 0 0 Potri.010G195200.1.v4.1 1773 1522.06 140 3.88712 Potri.012G127500.1.v4.1 977 726.07 11089 645.424 ==> SRR7030819.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 50 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 214 Potri.001G212900.v4.1 11 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 134 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 3 SRR7030819 completed mapping pipeline successfully