Starting /dee2/code/volunteer_pipeline.sh SRR7030820 current disk space = 3050909532160 free memory = 1580125288 SRR7030820 SRAfilesize 4d05820a3324ccc8790185426666c9e5 SRR7030820.sra SRR7030820.sra file validated SRR7030820 is paired end SRR7030820 is conventional basespace SRR7030820 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030820_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.972 33.0 33.0 34.0 30.0 34.0 2 32.5145 33.0 33.0 34.0 30.0 34.0 3 32.394 33.0 33.0 34.0 31.0 34.0 4 32.58525 33.0 33.0 34.0 32.0 34.0 5 32.78775 33.0 33.0 34.0 32.0 34.0 6 37.06325 38.0 38.0 38.0 36.0 38.0 7 37.38525 38.0 38.0 38.0 37.0 38.0 8 37.4785 38.0 38.0 38.0 37.0 38.0 9 37.524 38.0 38.0 38.0 38.0 38.0 10-14 37.51895 38.0 38.0 38.0 38.0 38.0 15-19 37.544200000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.47905 38.0 38.0 38.0 37.8 38.0 25-29 37.438649999999996 38.0 38.0 38.0 37.8 38.0 30-34 37.35 38.0 38.0 38.0 37.2 38.0 35-39 37.35735 38.0 38.0 38.0 37.2 38.0 40-44 37.41925 38.0 38.0 38.0 37.4 38.0 45-49 37.3279 38.0 38.0 38.0 37.0 38.0 50-54 37.25135 38.0 38.0 38.0 37.0 38.0 55-59 37.231500000000004 38.0 38.0 38.0 37.0 38.0 60-64 37.131899999999995 38.0 38.0 38.0 36.6 38.0 65-69 37.134750000000004 38.0 38.0 38.0 36.8 38.0 70-74 37.165499999999994 38.0 38.0 38.0 36.8 38.0 75-79 37.04675 38.0 38.0 38.0 36.2 38.0 80-84 36.82234999999999 38.0 38.0 38.0 35.4 38.0 85-89 36.6591 38.0 38.0 38.0 34.8 38.0 90-94 36.6711 38.0 38.0 38.0 34.6 38.0 95-99 36.637699999999995 38.0 38.0 38.0 35.0 38.0 100-104 36.5658 38.0 38.0 38.0 34.4 38.0 105-109 36.379 38.0 38.0 38.0 33.8 38.0 110-114 36.10015 38.0 37.6 38.0 33.6 38.0 115-119 36.05585 38.0 37.8 38.0 33.0 38.0 120-124 35.876 38.0 37.2 38.0 32.8 38.0 125-129 35.6759 38.0 37.0 38.0 31.0 38.0 130-134 35.334649999999996 38.0 36.2 38.0 29.8 38.0 135-139 34.988800000000005 38.0 35.6 38.0 28.0 38.0 140-144 34.2342 38.0 35.0 38.0 24.0 38.0 145-149 33.9863 38.0 34.6 38.0 23.2 38.0 150-151 29.749499999999998 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 2.0 10 0.0 11 0.0 12 4.0 13 0.0 14 2.0 15 2.0 16 4.0 17 1.0 18 4.0 19 4.0 20 1.0 21 3.0 22 5.0 23 6.0 24 11.0 25 9.0 26 12.0 27 16.0 28 28.0 29 34.0 30 37.0 31 53.0 32 71.0 33 103.0 34 153.0 35 259.0 36 575.0 37 2600.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.99493414387032 11.246200607902736 8.941236068895643 39.81762917933131 2 20.9 14.524999999999999 35.699999999999996 28.875 3 19.400000000000002 18.55 27.950000000000003 34.1 4 22.85 25.775 23.275000000000002 28.1 5 21.65206508135169 32.76595744680851 24.680851063829788 20.90112640801001 6 18.425 34.325 25.75 21.5 7 15.299999999999999 26.875 39.800000000000004 18.025 8 16.425 26.474999999999998 32.025 25.074999999999996 9 17.25 23.125 35.75 23.875 10-14 19.855 29.439999999999998 27.24 23.465 15-19 19.885 28.09 27.87 24.154999999999998 20-24 20.14 28.24 28.055000000000003 23.565 25-29 19.68 29.035 27.284999999999997 24.0 30-34 19.88 28.235 27.625 24.26 35-39 19.74 28.84 27.29 24.13 40-44 19.869999999999997 28.53 28.105000000000004 23.494999999999997 45-49 20.175 28.515 27.6 23.71 50-54 20.34 28.24 27.58 23.84 55-59 20.135 27.584999999999997 27.61 24.67 60-64 20.055 27.310000000000002 28.199999999999996 24.435000000000002 65-69 20.325 28.285 27.705000000000002 23.685000000000002 70-74 20.26 28.64 27.165 23.935000000000002 75-79 19.675 28.07 27.76 24.495 80-84 20.565 27.375 28.34 23.72 85-89 20.3 27.534999999999997 28.095 24.07 90-94 20.48 27.615000000000002 27.744999999999997 24.16 95-99 20.23 27.74 27.725 24.305 100-104 20.105 28.744999999999997 27.465 23.685000000000002 105-109 20.255000000000003 28.205000000000002 27.675 23.865 110-114 20.435 28.07 27.255000000000003 24.240000000000002 115-119 20.145 28.485 27.57 23.799999999999997 120-124 20.549999999999997 27.639999999999997 27.655 24.154999999999998 125-129 20.705000000000002 27.994999999999997 27.505000000000003 23.794999999999998 130-134 20.43 27.79 27.465 24.315 135-139 20.94 27.33 27.800000000000004 23.93 140-144 20.89 27.93 27.0 24.18 145-149 20.955 28.449999999999996 27.05 23.544999999999998 150-151 20.7375 28.1375 26.687499999999996 24.4375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 0.5 20 1.0 21 1.0 22 2.5 23 2.0 24 0.5 25 2.0 26 5.0 27 9.5 28 11.5 29 9.5 30 14.0 31 22.5 32 29.0 33 37.0 34 47.0 35 54.0 36 73.5 37 95.5 38 121.0 39 161.0 40 193.5 41 220.5 42 248.5 43 241.0 44 246.5 45 288.0 46 294.0 47 272.0 48 235.0 49 195.5 50 171.0 51 142.0 52 123.5 53 108.0 54 77.0 55 58.0 56 42.5 57 29.5 58 26.5 59 23.5 60 15.0 61 12.5 62 11.0 63 6.5 64 3.5 65 2.5 66 2.5 67 2.0 68 2.5 69 2.0 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.3 2 0.0 3 0.0 4 0.0 5 0.125 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.07500000000000001 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.2375 0.0 0.0 0.0 0.0 106-107 0.2875 0.0 0.0 0.0 0.0 108-109 0.3125 0.0 0.0 0.0 0.0 110-111 0.425 0.0 0.0 0.0 0.0 112-113 0.525 0.0 0.0 0.0 0.0 114-115 0.625 0.0 0.0 0.0 0.0 116-117 0.7749999999999999 0.0 0.0 0.0 0.0 118-119 0.9 0.0 0.0 0.0 0.0 120-121 1.0375 0.0 0.0 0.0 0.0 122-123 1.125 0.0 0.0 0.0 0.0 124-125 1.3 0.0 0.0 0.0 0.0 126-127 1.4 0.0 0.0 0.0 0.0 128-129 1.6625 0.0 0.0 0.0 0.0 130-131 1.85 0.0 0.0 0.0 0.0 132-133 2.05 0.0 0.0 0.0 0.0 134-135 2.275 0.0 0.0 0.0 0.0 136-137 2.5125 0.0 0.0 0.0 0.0 138-139 2.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGTTACA 10 0.006832588 144.9875 2 >>END_MODULE SRR7030820 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030820_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9885 34.0 33.0 34.0 32.0 34.0 2 33.01975 34.0 33.0 34.0 32.0 34.0 3 33.034 34.0 33.0 34.0 32.0 34.0 4 33.006 34.0 33.0 34.0 32.0 34.0 5 33.01325 34.0 33.0 34.0 32.0 34.0 6 37.153 38.0 38.0 38.0 37.0 38.0 7 37.32375 38.0 38.0 38.0 37.0 38.0 8 37.213 38.0 38.0 38.0 37.0 38.0 9 37.2695 38.0 38.0 38.0 37.0 38.0 10-14 37.2331 38.0 38.0 38.0 37.0 38.0 15-19 37.247499999999995 38.0 38.0 38.0 37.0 38.0 20-24 37.13125 38.0 38.0 38.0 36.8 38.0 25-29 37.1276 38.0 38.0 38.0 37.0 38.0 30-34 37.1317 38.0 38.0 38.0 37.0 38.0 35-39 37.087599999999995 38.0 38.0 38.0 37.0 38.0 40-44 36.9953 38.0 38.0 38.0 36.6 38.0 45-49 36.8618 38.0 38.0 38.0 35.8 38.0 50-54 36.781549999999996 38.0 38.0 38.0 35.8 38.0 55-59 36.8176 38.0 38.0 38.0 36.0 38.0 60-64 36.8148 38.0 38.0 38.0 35.8 38.0 65-69 36.82685 38.0 38.0 38.0 36.0 38.0 70-74 36.634100000000004 38.0 38.0 38.0 35.2 38.0 75-79 36.44285 38.0 38.0 38.0 34.2 38.0 80-84 36.552699999999994 38.0 38.0 38.0 34.4 38.0 85-89 36.5145 38.0 38.0 38.0 34.4 38.0 90-94 36.510749999999994 38.0 38.0 38.0 34.6 38.0 95-99 36.33265 38.0 38.0 38.0 34.2 38.0 100-104 35.9959 38.0 37.8 38.0 32.8 38.0 105-109 35.857549999999996 38.0 37.4 38.0 32.2 38.0 110-114 35.77575 38.0 37.0 38.0 32.2 38.0 115-119 35.5761 38.0 36.8 38.0 30.6 38.0 120-124 35.278650000000006 38.0 36.4 38.0 28.4 38.0 125-129 34.90555 38.0 36.0 38.0 27.8 38.0 130-134 34.81845 38.0 35.8 38.0 27.8 38.0 135-139 34.25150000000001 38.0 34.6 38.0 24.2 38.0 140-144 33.5402 38.0 33.0 38.0 19.8 38.0 145-149 32.66445 38.0 33.2 38.0 13.6 38.0 150-151 28.213625 35.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 3.0 4 1.0 5 3.0 6 1.0 7 1.0 8 1.0 9 1.0 10 3.0 11 1.0 12 0.0 13 1.0 14 4.0 15 2.0 16 4.0 17 4.0 18 8.0 19 11.0 20 2.0 21 8.0 22 8.0 23 7.0 24 14.0 25 23.0 26 15.0 27 27.0 28 33.0 29 47.0 30 45.0 31 61.0 32 68.0 33 120.0 34 181.0 35 274.0 36 607.0 37 2407.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.265664160401 22.305764411027567 12.756892230576442 28.671679197994987 2 24.849699398797593 27.17935871743487 30.38577154308617 17.585170340681362 3 20.150375939849624 27.819548872180448 32.43107769423559 19.598997493734334 4 21.974442495615136 34.15184164369832 25.382109746930592 18.49160611375595 5 23.8716148445336 35.20561685055166 23.219658976930795 17.703109327983952 6 20.424999999999997 39.074999999999996 22.025 18.475 7 19.45 23.549999999999997 37.375 19.625 8 21.580395098774694 26.63165791447862 28.482120530132534 23.305826456614152 9 22.625 26.625 28.725 22.025 10-14 23.04 29.09 26.400000000000002 21.47 15-19 23.145 28.375 27.61 20.87 20-24 23.35350302545382 28.219232884932737 27.49412411861779 20.933139970995647 25-29 23.02960592118424 28.225645129025807 27.695539107821567 21.049209841968395 30-34 23.275000000000002 28.449999999999996 27.365000000000002 20.91 35-39 23.091154557727886 28.456422821141057 27.611380569028455 20.841042052102605 40-44 23.47 28.349999999999998 27.794999999999998 20.385 45-49 22.994545363559023 27.938747935745383 28.239003152679775 20.827703548015812 50-54 23.160216563063965 27.35111289352316 27.927611790655703 21.561058752757166 55-59 23.016787772488097 27.782510648960162 28.288649461287896 20.912052117263844 60-64 23.153103586255188 27.679687890761766 28.12484369529335 21.042364827689692 65-69 24.23121156057803 27.466373318665934 27.906395319765988 20.39601980099005 70-74 23.33116655832792 27.57637881894095 27.806390319515977 21.28606430321516 75-79 23.280820205051263 28.152038009502377 27.881970492623154 20.685171292823206 80-84 23.891194559727985 27.721386069303467 27.486374318715935 20.901045052252613 85-89 23.445 27.779999999999998 28.115000000000002 20.66 90-94 23.631181559077955 28.006400320016 27.57637881894095 20.786039301965097 95-99 23.610624781151518 27.97758991546196 27.717472862788256 20.69431244059827 100-104 24.00140329774971 27.479577005964018 27.94567232997544 20.57334736631083 105-109 24.087335369823226 27.642846411938503 27.677900746156542 20.59191747208173 110-114 23.73237323732373 28.292829282928295 27.262726272627262 20.71207120712071 115-119 23.72 28.110000000000003 27.315 20.855 120-124 23.91 27.32 28.07 20.7 125-129 23.546177308865442 27.816390819540977 27.626381319065953 21.011050552527628 130-134 24.845 28.110000000000003 27.195000000000004 19.85 135-139 24.55 28.065 27.169999999999998 20.215 140-144 25.022529288074498 27.485731450886153 27.435666366276156 20.05607289476319 145-149 24.77298951487483 27.171022926804795 27.642602719109018 20.413384839211357 150-151 23.948422633950926 28.054581872809216 27.42864296444667 20.56835252879319 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 1.0 24 1.5 25 1.5 26 4.0 27 6.5 28 8.0 29 10.0 30 10.0 31 18.0 32 23.0 33 33.5 34 53.0 35 61.5 36 74.0 37 102.5 38 158.0 39 184.5 40 193.5 41 215.5 42 254.5 43 283.5 44 267.0 45 280.0 46 293.5 47 258.0 48 224.0 49 188.0 50 155.0 51 133.0 52 107.0 53 86.5 54 69.0 55 58.0 56 50.5 57 39.5 58 28.0 59 19.0 60 10.5 61 8.0 62 5.5 63 4.5 64 4.0 65 1.0 66 0.0 67 1.0 68 2.5 69 1.5 70 0.0 71 0.0 72 1.0 73 2.0 74 1.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.2 3 0.25 4 0.22499999999999998 5 0.3 6 0.0 7 0.0 8 0.025 9 0.0 10-14 0.0 15-19 0.0 20-24 0.015 25-29 0.02 30-34 0.0 35-39 0.005 40-44 0.0 45-49 0.08499999999999999 50-54 0.26 55-59 0.22499999999999998 60-64 0.034999999999999996 65-69 0.005 70-74 0.005 75-79 0.025 80-84 0.005 85-89 0.0 90-94 0.005 95-99 0.045 100-104 0.23500000000000001 105-109 0.155 110-114 0.01 115-119 0.0 120-124 0.0 125-129 0.005 130-134 0.0 135-139 0.0 140-144 0.13 145-149 0.335 150-151 0.15 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67385850476668 99.325 2 0.3010536879076769 0.6 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.07500000000000001 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.2375 0.0 0.0 0.0 0.0 106-107 0.2875 0.0 0.0 0.0 0.0 108-109 0.3125 0.0 0.0 0.0 0.0 110-111 0.425 0.0 0.0 0.0 0.0 112-113 0.525 0.0 0.0 0.0 0.0 114-115 0.625 0.0 0.0 0.0 0.0 116-117 0.7749999999999999 0.0 0.0 0.0 0.0 118-119 0.9 0.0 0.0 0.0 0.0 120-121 1.0375 0.0 0.0 0.0 0.0 122-123 1.125 0.0 0.0 0.0 0.0 124-125 1.3 0.0 0.0 0.0 0.0 126-127 1.4 0.0 0.0 0.0 0.0 128-129 1.675 0.0 0.0 0.0 0.0 130-131 1.9 0.0 0.0 0.0 0.0 132-133 2.0999999999999996 0.0 0.0 0.0 0.0 134-135 2.35 0.0 0.0 0.0 0.0 136-137 2.5875 0.0 0.0 0.0 0.0 138-139 2.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATAAACA 10 0.006680009 146.0633 2 ATATTCC 10 0.0069393674 144.2375 6 CCGACAC 10 0.0069393674 144.2375 8 >>END_MODULE Read 764492 spots for SRR7030820.sra Written 764492 spots for SRR7030820.sra Read 764492 spots for SRR7030820.sra Written 764492 spots for SRR7030820.sra Read 764492 spots for SRR7030820.sra Written 764492 spots for SRR7030820.sra Read 764492 spots for SRR7030820.sra Written 764492 spots for SRR7030820.sra Read 764492 spots for SRR7030820.sra Written 764492 spots for SRR7030820.sra Read 764492 spots for SRR7030820.sra Written 764492 spots for SRR7030820.sra Read 764492 spots for SRR7030820.sra Written 764492 spots for SRR7030820.sra Read 764492 spots for SRR7030820.sra Written 764492 spots for SRR7030820.sra Read 764492 spots for SRR7030820.sra Written 764492 spots for SRR7030820.sra Read 764492 spots for SRR7030820.sra Written 764492 spots for SRR7030820.sra Read 764492 spots for SRR7030820.sra Written 764492 spots for SRR7030820.sra Read 764492 spots for SRR7030820.sra Written 764492 spots for SRR7030820.sra Read 764492 spots for SRR7030820.sra Written 764492 spots for SRR7030820.sra Read 764492 spots for SRR7030820.sra Written 764492 spots for SRR7030820.sra Read 764492 spots for SRR7030820.sra Written 764492 spots for SRR7030820.sra Read 764492 spots for SRR7030820.sra Written 764492 spots for SRR7030820.sra Read 764492 spots for SRR7030820.sra Written 764492 spots for SRR7030820.sra Read 764492 spots for SRR7030820.sra Written 764492 spots for SRR7030820.sra Read 764506 spots for SRR7030820.sra Written 764506 spots for SRR7030820.sra Read 764492 spots for SRR7030820.sra Written 764492 spots for SRR7030820.sra SRR ids: ['SRR7030820.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8h7e7etu SRR7030820.sra spots: 15289854 blocks: [[1, 764492], [764493, 1528984], [1528985, 2293476], [2293477, 3057968], [3057969, 3822460], [3822461, 4586952], [4586953, 5351444], [5351445, 6115936], [6115937, 6880428], [6880429, 7644920], [7644921, 8409412], [8409413, 9173904], [9173905, 9938396], [9938397, 10702888], [10702889, 11467380], [11467381, 12231872], [12231873, 12996364], [12996365, 13760856], [13760857, 14525348], [14525349, 15289854]] SRR7030820 file size 5159529 SRR7030820 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7030820 SRR7030820_1.fastq SRR7030820_2.fastq Input file: SRR7030820_1.fastq Paired file: SRR7030820_2.fastq trimmed: SRR7030820-trimmed-pair1.fastq, SRR7030820-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 20:34:43 2025 >> started Wed Feb 12 20:35:06 2025 >> done (23.776s) 15289854 read pairs processed; of these: 43342 ( 0.28%) short read pairs filtered out after trimming by size control 38234 ( 0.25%) empty read pairs filtered out after trimming by size control 15208278 (99.47%) read pairs available; of these: 5779155 (38.00%) trimmed read pairs available after processing 9429123 (62.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 3 0.00% 21 0 0.00% 22 5 0.00% 23 2 0.00% 24 1 0.00% 25 5 0.00% 26 8 0.00% 27 3 0.00% 28 6 0.00% 29 2 0.00% 30 9 0.00% 31 7 0.00% 32 2 0.00% 33 2 0.00% 34 3 0.00% 35 2 0.00% 36 4 0.00% 37 5 0.00% 38 4 0.00% 39 6 0.00% 40 6 0.00% 41 8 0.00% 42 4 0.00% 43 11 0.00% 44 10 0.00% 45 10 0.00% 46 8 0.00% 47 9 0.00% 48 16 0.00% 49 16 0.00% 50 11 0.00% 51 22 0.00% 52 11 0.00% 53 20 0.00% 54 26 0.00% 55 24 0.00% 56 24 0.00% 57 26 0.00% 58 35 0.00% 59 35 0.00% 60 41 0.00% 61 46 0.00% 62 54 0.00% 63 62 0.00% 64 66 0.00% 65 90 0.00% 66 71 0.00% 67 94 0.00% 68 104 0.00% 69 116 0.00% 70 134 0.00% 71 190 0.00% 72 207 0.00% 73 235 0.00% 74 233 0.00% 75 260 0.00% 76 339 0.00% 77 373 0.00% 78 389 0.00% 79 441 0.00% 80 537 0.00% 81 611 0.00% 82 765 0.01% 83 985 0.01% 84 2988 0.02% 85 3193 0.02% 86 2868 0.02% 87 2927 0.02% 88 2906 0.02% 89 2896 0.02% 90 3058 0.02% 91 3243 0.02% 92 3340 0.02% 93 3561 0.02% 94 3859 0.03% 95 4245 0.03% 96 4577 0.03% 97 7111 0.05% 98 6728 0.04% 99 4767 0.03% 100 4977 0.03% 101 5313 0.03% 102 5650 0.04% 103 6178 0.04% 104 6551 0.04% 105 7018 0.05% 106 7402 0.05% 107 7848 0.05% 108 8209 0.05% 109 8704 0.06% 110 9386 0.06% 111 9949 0.07% 112 10893 0.07% 113 11610 0.08% 114 12100 0.08% 115 13245 0.09% 116 14060 0.09% 117 14682 0.10% 118 15403 0.10% 119 15844 0.10% 120 16928 0.11% 121 17828 0.12% 122 19609 0.13% 123 19698 0.13% 124 20499 0.13% 125 21521 0.14% 126 22819 0.15% 127 24179 0.16% 128 25411 0.17% 129 26347 0.17% 130 27931 0.18% 131 29694 0.20% 132 31508 0.21% 133 33786 0.22% 134 35968 0.24% 135 38894 0.26% 136 41736 0.27% 137 45015 0.30% 138 49326 0.32% 139 53728 0.35% 140 59102 0.39% 141 65794 0.43% 142 75255 0.49% 143 88009 0.58% 144 109548 0.72% 145 135860 0.89% 146 169260 1.11% 147 216473 1.42% 148 300611 1.98% 149 545327 3.59% 150 3147343 20.69% 151 9429123 62.00% 15208278 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=37 prefix-density=0.20 prefix-fanout=2.0 sequence=ACTGATTCCTTTGCA criterion=fanout-score sequence-density=0.04 sequence-density-rank=30 fanout-score=211.85 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=17.0 sequence=TCTCTTCTTCAGTCTTGGGGTGGTACCCAGGTAACTTCTCCTTGATCTTCTCGAGTAGTCCCTTCTTCTCCTTGGCATCTCCTTCATGGGAAACTGCAGCTTCAGGGGAAACATGTTCAGGAGCTGGAGGAGGGACCTCGTCAGCTTTCTTATGTCCTGGCAATTTCTCCTTGATTTTGTCAAGGAAACCCTTCTTATCCTCTGGTTCATGGGGTGTCTCTGTATGGACTACCTCGACAGGAACACTAGTATCCTCGTGTTCCTTCTCCT criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.27 fanout-score-rank=35 prefix-density=0.37 prefix-fanout=2.2 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.02 sequence-density-rank=34 fanout-score=293.63 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=16.7 sequence=TTTCTTTCTTTATTTTGCATAACTTGATATGGGTTTGTTCCTTCGTGGGCTGTTTCTTCTTTCTTTGATCTATTTTAGCACAGGAGCTGAAGTTGTCACCGTTGATGTCAAGGCAACAAAGGGTTTGCTTGAGTCAGGCTATACTTATCTAGATGTTAGGACAGTGGAAGAGTACAATAAAGGACACGTGGATGGAGAGAAGATATTCAATATTCCTTACTTGTTCAATACACCAGAGGGGAGGGTTAAAAATCCCAACTTTCTGAAGGAGGTCTCAGGTGTGTGCAAGGAGGAAGATAAACTTCTTGTG SRR7030820 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 20:35:50 Started mapping on | Feb 12 20:35:50 Finished on | Feb 12 20:37:24 Mapping speed, Million of reads per hour | 582.44 Number of input reads | 15208278 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14355373 Uniquely mapped reads % | 94.39% Average mapped length | 296.73 Number of splices: Total | 13227718 Number of splices: Annotated (sjdb) | 12978379 Number of splices: GT/AG | 13019162 Number of splices: GC/AG | 163680 Number of splices: AT/AC | 9273 Number of splices: Non-canonical | 35603 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.82 Insertion rate per base | 0.02% Insertion average length | 2.66 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 452455 % of reads mapped to multiple loci | 2.98% Number of reads mapped to too many loci | 187727 % of reads mapped to too many loci | 1.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.20% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 423083 423083 423083 N_multimapping 452455 452455 452455 N_noFeature 339443 14218455 400514 N_ambiguous 147455 926 71132 UnstrandedReadsAssigned:13868475 PositiveStrandReadsAssigned:135992 NegativeStrandReadsAssigned:13883727 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7030820 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7030820-trimmed-pair1.fastq SRR7030820-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,208,278 reads, 13,972,755 reads pseudoaligned [quant] estimated average fragment length: 256.812 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,003 rounds 52401 SRR7030820.ke.tsv 34699 SRR7030820.se.tsv 87100 total ==> SRR7030820.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1762.19 1963 58.0915 Potri.005G024800.1.v4.1 1035 779.188 1821 121.874 Potri.004G059700.1.v4.1 961 705.193 24 1.77479 Potri.007G009000.2.v4.1 1416 1160.19 0 0 Potri.003G141000.2.v4.1 2943 2687.19 541 10.4989 Potri.016G087400.1.v4.1 270 67.7975 880.682 677.408 Potri.015G069301.1.v4.1 564 312.524 0 0 Potri.010G195200.1.v4.1 1773 1517.19 39 1.34051 Potri.012G127500.1.v4.1 977 721.188 6845 494.96 ==> SRR7030820.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 11 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 190 Potri.001G212900.v4.1 22 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 86 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7030820 completed mapping pipeline successfully