Starting /dee2/code/volunteer_pipeline.sh SRR7030821 current disk space = 3050890936320 free memory = 1503056408 SRR7030821 SRAfilesize 2e39f4c5e44150791f0858f362b16cbf SRR7030821.sra SRR7030821.sra file validated SRR7030821 is paired end SRR7030821 is conventional basespace SRR7030821 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030821_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.8775 32.0 18.0 33.0 18.0 34.0 2 30.6635 31.0 29.0 33.0 27.0 34.0 3 31.68 33.0 31.0 33.0 27.0 34.0 4 31.8545 33.0 31.0 33.0 29.0 34.0 5 32.08875 33.0 32.0 33.0 31.0 34.0 6 36.258 38.0 36.0 38.0 33.0 38.0 7 36.90825 38.0 37.0 38.0 35.0 38.0 8 37.19925 38.0 38.0 38.0 36.0 38.0 9 37.327 38.0 38.0 38.0 36.0 38.0 10-14 37.3606 38.0 38.0 38.0 36.8 38.0 15-19 37.4493 38.0 38.0 38.0 37.0 38.0 20-24 37.455799999999996 38.0 38.0 38.0 37.0 38.0 25-29 37.4102 38.0 38.0 38.0 37.0 38.0 30-34 37.36835000000001 38.0 38.0 38.0 37.0 38.0 35-39 37.32475 38.0 38.0 38.0 37.0 38.0 40-44 37.29535 38.0 38.0 38.0 37.0 38.0 45-49 37.306050000000006 38.0 38.0 38.0 37.0 38.0 50-54 37.288 38.0 38.0 38.0 36.8 38.0 55-59 37.21515 38.0 38.0 38.0 36.2 38.0 60-64 37.11729999999999 38.0 38.0 38.0 36.0 38.0 65-69 37.0066 38.0 38.0 38.0 36.0 38.0 70-74 37.01755 38.0 38.0 38.0 36.0 38.0 75-79 36.991049999999994 38.0 38.0 38.0 35.8 38.0 80-84 36.895199999999996 38.0 38.0 38.0 35.2 38.0 85-89 36.8214 38.0 38.0 38.0 35.0 38.0 90-94 36.7023 38.0 38.0 38.0 34.8 38.0 95-99 36.51775 38.0 38.0 38.0 34.2 38.0 100-104 36.5021 38.0 38.0 38.0 34.0 38.0 105-109 36.4077 38.0 37.8 38.0 34.0 38.0 110-114 36.305099999999996 38.0 37.6 38.0 34.0 38.0 115-119 35.97345 38.0 37.0 38.0 32.8 38.0 120-124 35.8393 38.0 37.0 38.0 32.0 38.0 125-129 35.694950000000006 38.0 36.4 38.0 31.0 38.0 130-134 35.271699999999996 38.0 36.0 38.0 29.0 38.0 135-139 34.9302 38.0 35.2 38.0 27.8 38.0 140-144 35.000249999999994 38.0 35.6 38.0 29.0 38.0 145-149 34.368649999999995 38.0 35.0 38.0 27.0 38.0 150-151 30.749875 36.5 29.5 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 0.0 15 1.0 16 3.0 17 1.0 18 0.0 19 0.0 20 5.0 21 1.0 22 2.0 23 5.0 24 11.0 25 12.0 26 11.0 27 14.0 28 27.0 29 36.0 30 37.0 31 56.0 32 91.0 33 111.0 34 151.0 35 290.0 36 803.0 37 2331.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.02768903088392 14.297124600638977 8.599574014909479 36.07561235356763 2 19.925 15.425 34.35 30.3 3 17.375 20.25 27.250000000000004 35.125 4 20.724999999999998 30.049999999999997 22.45 26.775 5 22.163654618473895 35.21586345381526 22.665662650602407 19.954819277108435 6 19.125 36.199999999999996 24.5 20.175 7 14.325 27.250000000000004 39.800000000000004 18.625 8 16.475 27.025 30.8 25.7 9 16.375 25.124999999999996 33.900000000000006 24.6 10-14 19.71 29.445 27.35 23.494999999999997 15-19 19.63 28.51 27.685 24.175 20-24 19.595000000000002 28.71 28.115000000000002 23.580000000000002 25-29 19.325 29.175 27.584999999999997 23.915 30-34 19.505 28.57 27.779999999999998 24.145 35-39 19.68 28.599999999999998 27.72 24.0 40-44 19.705000000000002 28.605000000000004 27.91 23.78 45-49 20.244999999999997 28.7 27.060000000000002 23.995 50-54 19.615 28.499999999999996 27.77 24.115000000000002 55-59 19.81 28.415000000000003 28.005000000000003 23.77 60-64 20.275000000000002 28.455000000000002 27.555000000000003 23.715 65-69 19.994999999999997 28.185 28.375 23.445 70-74 19.245 28.07 28.465 24.22 75-79 20.24 28.01 27.72 24.03 80-84 19.919999999999998 28.425 28.18 23.474999999999998 85-89 19.8 28.29 28.189999999999998 23.72 90-94 19.695 28.415000000000003 28.265 23.625 95-99 19.285 28.93 27.925 23.86 100-104 19.945 28.28 27.765 24.01 105-109 20.16 28.365000000000002 27.93 23.544999999999998 110-114 19.965 28.17 28.299999999999997 23.565 115-119 19.744999999999997 28.110000000000003 28.025 24.12 120-124 20.335 28.28 27.74 23.645 125-129 20.115 28.084999999999997 27.58 24.22 130-134 20.755000000000003 28.205000000000002 27.85 23.189999999999998 135-139 20.82 27.894999999999996 27.46 23.825 140-144 20.330000000000002 27.72 28.095 23.855 145-149 20.565 27.655 28.134999999999998 23.645 150-151 20.925856228829506 28.17714214025844 27.07314013298206 23.823861497929997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 1.0 22 3.5 23 4.5 24 3.0 25 3.5 26 6.0 27 8.5 28 10.5 29 14.0 30 23.0 31 36.0 32 43.0 33 45.0 34 62.0 35 84.0 36 95.0 37 121.5 38 136.0 39 149.0 40 196.0 41 227.0 42 238.5 43 251.5 44 253.0 45 248.5 46 256.5 47 255.0 48 225.0 49 184.0 50 170.5 51 156.5 52 113.5 53 86.0 54 68.0 55 52.5 56 41.0 57 26.0 58 19.0 59 17.0 60 13.5 61 12.0 62 10.5 63 5.5 64 4.5 65 3.5 66 2.0 67 3.5 68 2.5 69 1.5 70 1.5 71 0.5 72 0.5 73 1.5 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.1 2 0.0 3 0.0 4 0.0 5 0.4 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.36250000000000004 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64868255959848 99.275 2 0.32622333751568383 0.65 3 0.02509410288582183 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.1375 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.1875 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.3125 0.0 0.0 0.0 0.0 110-111 0.35 0.0 0.0 0.0 0.0 112-113 0.45 0.0 0.0 0.0 0.0 114-115 0.475 0.0 0.0 0.0 0.0 116-117 0.6125 0.0 0.0 0.0 0.0 118-119 0.675 0.0 0.0 0.0 0.0 120-121 0.725 0.0 0.0 0.0 0.0 122-123 0.7875000000000001 0.0 0.0 0.0 0.0 124-125 0.825 0.0 0.0 0.0 0.0 126-127 0.8625 0.0 0.0 0.0 0.0 128-129 1.025 0.0 0.0 0.0 0.0 130-131 1.25 0.0 0.0 0.0 0.0 132-133 1.4 0.0 0.0 0.0 0.0 134-135 1.55 0.0 0.0 0.0 0.0 136-137 1.7625 0.0 0.0 0.0 0.0 138-139 1.9874999999999998 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGAGTT 10 0.0068396386 144.9375 145 >>END_MODULE SRR7030821 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030821_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7775 33.0 33.0 34.0 32.0 34.0 2 32.873 33.0 33.0 34.0 32.0 34.0 3 32.85125 33.0 33.0 34.0 32.0 34.0 4 32.8605 33.0 33.0 34.0 32.0 34.0 5 32.879 34.0 33.0 34.0 32.0 34.0 6 37.095 38.0 38.0 38.0 36.0 38.0 7 37.10375 38.0 38.0 38.0 37.0 38.0 8 37.1255 38.0 38.0 38.0 37.0 38.0 9 37.1145 38.0 38.0 38.0 37.0 38.0 10-14 36.9658 38.0 38.0 38.0 36.0 38.0 15-19 37.004149999999996 38.0 38.0 38.0 36.0 38.0 20-24 37.0141 38.0 38.0 38.0 36.4 38.0 25-29 36.9536 38.0 38.0 38.0 36.2 38.0 30-34 36.9265 38.0 38.0 38.0 36.0 38.0 35-39 36.821850000000005 38.0 38.0 38.0 35.8 38.0 40-44 36.81455 38.0 38.0 38.0 36.0 38.0 45-49 36.73665 38.0 38.0 38.0 35.8 38.0 50-54 36.777499999999996 38.0 38.0 38.0 35.8 38.0 55-59 36.73605 38.0 38.0 38.0 35.4 38.0 60-64 36.6526 38.0 38.0 38.0 35.0 38.0 65-69 36.62695 38.0 38.0 38.0 35.0 38.0 70-74 36.536699999999996 38.0 38.0 38.0 34.6 38.0 75-79 36.403949999999995 38.0 38.0 38.0 34.0 38.0 80-84 36.397999999999996 38.0 38.0 38.0 34.0 38.0 85-89 36.2836 38.0 38.0 38.0 33.8 38.0 90-94 36.2843 38.0 38.0 38.0 34.0 38.0 95-99 36.040499999999994 38.0 37.8 38.0 33.2 38.0 100-104 35.91525 38.0 37.2 38.0 32.6 38.0 105-109 35.803450000000005 38.0 37.0 38.0 32.6 38.0 110-114 35.4994 38.0 36.6 38.0 30.0 38.0 115-119 35.272200000000005 38.0 36.2 38.0 29.0 38.0 120-124 35.1959 38.0 36.0 38.0 28.8 38.0 125-129 35.01905 38.0 36.0 38.0 28.0 38.0 130-134 34.6962 38.0 35.4 38.0 27.0 38.0 135-139 34.460100000000004 38.0 35.0 38.0 25.4 38.0 140-144 34.08095 38.0 35.0 38.0 23.2 38.0 145-149 33.418549999999996 38.0 34.0 38.0 20.4 38.0 150-151 29.475 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 2.0 4 6.0 5 1.0 6 2.0 7 1.0 8 2.0 9 0.0 10 2.0 11 1.0 12 1.0 13 3.0 14 1.0 15 2.0 16 4.0 17 3.0 18 6.0 19 6.0 20 7.0 21 7.0 22 7.0 23 13.0 24 10.0 25 22.0 26 16.0 27 26.0 28 26.0 29 48.0 30 47.0 31 66.0 32 86.0 33 106.0 34 171.0 35 257.0 36 693.0 37 2340.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.449999999999996 22.475 11.975 24.099999999999998 2 28.275 24.95 29.4 17.375 3 20.3 28.575 31.95 19.175 4 23.325000000000003 34.025 24.55 18.099999999999998 5 23.775 35.975 22.7 17.549999999999997 6 20.9 37.824999999999996 22.8 18.475 7 20.075000000000003 22.85 37.574999999999996 19.5 8 22.0 25.85 27.55 24.6 9 22.275 25.5 29.425 22.8 10-14 22.965 29.49 26.6 20.945 15-19 23.080000000000002 28.33 27.525 21.065 20-24 23.115 28.79 27.305 20.79 25-29 23.05 28.765 27.555000000000003 20.630000000000003 30-34 22.58 28.57 27.98 20.87 35-39 24.11 27.529999999999998 27.79 20.57 40-44 22.775000000000002 28.535 27.689999999999998 21.0 45-49 23.535 28.42 27.79 20.255000000000003 50-54 23.14 28.439999999999998 27.975 20.445 55-59 23.305 28.395 27.41 20.89 60-64 23.27 27.875 28.275 20.580000000000002 65-69 23.57 27.450000000000003 28.235 20.745 70-74 23.645 27.6 27.73 21.025 75-79 23.599999999999998 28.43 27.47 20.5 80-84 23.380000000000003 28.235 27.925 20.46 85-89 23.16 28.27 27.700000000000003 20.87 90-94 24.2 27.505000000000003 27.955000000000002 20.34 95-99 23.315 28.03 28.34 20.315 100-104 23.68 28.4 28.144999999999996 19.775000000000002 105-109 23.41 28.01 28.54 20.04 110-114 23.925 27.99 28.015 20.07 115-119 23.34 28.685 27.915 20.06 120-124 23.54 28.33 27.445000000000004 20.685000000000002 125-129 23.9 27.965 27.805000000000003 20.330000000000002 130-134 23.635 28.52 27.73 20.115 135-139 23.93 27.765 28.125 20.18 140-144 24.404999999999998 28.395 26.86 20.34 145-149 24.68 27.939999999999998 27.694999999999997 19.685 150-151 24.637137137137138 28.065565565565564 27.464964964964967 19.832332332332335 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.5 22 0.5 23 0.5 24 2.0 25 2.5 26 4.0 27 5.0 28 8.5 29 16.0 30 25.5 31 31.5 32 32.0 33 34.0 34 48.0 35 72.0 36 80.5 37 93.0 38 123.5 39 149.0 40 199.5 41 246.0 42 263.0 43 265.0 44 272.0 45 278.5 46 261.0 47 251.5 48 235.0 49 199.5 50 156.0 51 137.5 52 121.0 53 90.5 54 70.5 55 58.0 56 39.5 57 27.5 58 21.0 59 14.5 60 14.0 61 9.5 62 10.5 63 8.5 64 4.0 65 1.0 66 1.0 67 2.0 68 2.5 69 2.0 70 1.0 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82460536206464 99.6 2 0.12528188423953898 0.25 3 0.05011275369581559 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.1375 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.1875 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.3125 0.0 0.0 0.0 0.0 110-111 0.35 0.0 0.0 0.0 0.0 112-113 0.45 0.0 0.0 0.0 0.0 114-115 0.475 0.0 0.0 0.0 0.0 116-117 0.625 0.0 0.0 0.0 0.0 118-119 0.7 0.0 0.0 0.0 0.0 120-121 0.7625 0.0 0.0 0.0 0.0 122-123 0.8125 0.0 0.0 0.0 0.0 124-125 0.85 0.0 0.0 0.0 0.0 126-127 0.9125000000000001 0.0 0.0 0.0 0.0 128-129 1.075 0.0 0.0 0.0 0.0 130-131 1.2999999999999998 0.0 0.0 0.0 0.0 132-133 1.4500000000000002 0.0 0.0 0.0 0.0 134-135 1.6 0.0 0.0 0.0 0.0 136-137 1.8125 0.0 0.0 0.0 0.0 138-139 2.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1080107 spots for SRR7030821.sra Written 1080107 spots for SRR7030821.sra Read 1080107 spots for SRR7030821.sra Written 1080107 spots for SRR7030821.sra Read 1080107 spots for SRR7030821.sra Written 1080107 spots for SRR7030821.sra Read 1080107 spots for SRR7030821.sra Written 1080107 spots for SRR7030821.sra Read 1080107 spots for SRR7030821.sra Written 1080107 spots for SRR7030821.sra Read 1080107 spots for SRR7030821.sra Written 1080107 spots for SRR7030821.sra Read 1080107 spots for SRR7030821.sra Written 1080107 spots for SRR7030821.sra Read 1080107 spots for SRR7030821.sra Written 1080107 spots for SRR7030821.sra Read 1080107 spots for SRR7030821.sra Written 1080107 spots for SRR7030821.sra Read 1080107 spots for SRR7030821.sra Written 1080107 spots for SRR7030821.sra Read 1080107 spots for SRR7030821.sra Written 1080107 spots for SRR7030821.sra Read 1080107 spots for SRR7030821.sra Written 1080107 spots for SRR7030821.sra Read 1080107 spots for SRR7030821.sra Written 1080107 spots for SRR7030821.sra Read 1080107 spots for SRR7030821.sra Written 1080107 spots for SRR7030821.sra Read 1080107 spots for SRR7030821.sra Written 1080107 spots for SRR7030821.sra Read 1080107 spots for SRR7030821.sra Written 1080107 spots for SRR7030821.sra Read 1080107 spots for SRR7030821.sra Written 1080107 spots for SRR7030821.sra Read 1080107 spots for SRR7030821.sra Written 1080107 spots for SRR7030821.sra Read 1080107 spots for SRR7030821.sra Written 1080107 spots for SRR7030821.sra Read 1080125 spots for SRR7030821.sra Written 1080125 spots for SRR7030821.sra SRR ids: ['SRR7030821.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7x9zywi9 SRR7030821.sra spots: 21602158 blocks: [[1, 1080107], [1080108, 2160214], [2160215, 3240321], [3240322, 4320428], [4320429, 5400535], [5400536, 6480642], [6480643, 7560749], [7560750, 8640856], [8640857, 9720963], [9720964, 10801070], [10801071, 11881177], [11881178, 12961284], [12961285, 14041391], [14041392, 15121498], [15121499, 16201605], [16201606, 17281712], [17281713, 18361819], [18361820, 19441926], [19441927, 20522033], [20522034, 21602158]] SRR7030821 file size 7298562 SRR7030821 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7030821 SRR7030821_1.fastq SRR7030821_2.fastq Input file: SRR7030821_1.fastq Paired file: SRR7030821_2.fastq trimmed: SRR7030821-trimmed-pair1.fastq, SRR7030821-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 20:38:37 2025 >> started Wed Feb 12 20:39:02 2025 >> done (24.429s) 21602158 read pairs processed; of these: 25289 ( 0.12%) short read pairs filtered out after trimming by size control 22838 ( 0.11%) empty read pairs filtered out after trimming by size control 21554031 (99.78%) read pairs available; of these: 7999464 (37.11%) trimmed read pairs available after processing 13554567 (62.89%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 6 0.00% 21 5 0.00% 22 5 0.00% 23 4 0.00% 24 4 0.00% 25 2 0.00% 26 6 0.00% 27 1 0.00% 28 2 0.00% 29 3 0.00% 30 10 0.00% 31 7 0.00% 32 3 0.00% 33 8 0.00% 34 5 0.00% 35 4 0.00% 36 1 0.00% 37 3 0.00% 38 2 0.00% 39 6 0.00% 40 8 0.00% 41 7 0.00% 42 8 0.00% 43 12 0.00% 44 11 0.00% 45 9 0.00% 46 7 0.00% 47 18 0.00% 48 17 0.00% 49 15 0.00% 50 12 0.00% 51 21 0.00% 52 22 0.00% 53 22 0.00% 54 28 0.00% 55 19 0.00% 56 23 0.00% 57 36 0.00% 58 30 0.00% 59 53 0.00% 60 39 0.00% 61 41 0.00% 62 52 0.00% 63 64 0.00% 64 61 0.00% 65 77 0.00% 66 73 0.00% 67 100 0.00% 68 103 0.00% 69 131 0.00% 70 150 0.00% 71 167 0.00% 72 170 0.00% 73 212 0.00% 74 223 0.00% 75 265 0.00% 76 300 0.00% 77 358 0.00% 78 359 0.00% 79 423 0.00% 80 506 0.00% 81 557 0.00% 82 728 0.00% 83 886 0.00% 84 2073 0.01% 85 2836 0.01% 86 2926 0.01% 87 2972 0.01% 88 3346 0.02% 89 3226 0.01% 90 3206 0.01% 91 3391 0.02% 92 3636 0.02% 93 3790 0.02% 94 3873 0.02% 95 4135 0.02% 96 4469 0.02% 97 4573 0.02% 98 5020 0.02% 99 5321 0.02% 100 5643 0.03% 101 5908 0.03% 102 6290 0.03% 103 6674 0.03% 104 7365 0.03% 105 7865 0.04% 106 8340 0.04% 107 8717 0.04% 108 9334 0.04% 109 10000 0.05% 110 10663 0.05% 111 11360 0.05% 112 12365 0.06% 113 13379 0.06% 114 14256 0.07% 115 15208 0.07% 116 16335 0.08% 117 17242 0.08% 118 18187 0.08% 119 18827 0.09% 120 19838 0.09% 121 21511 0.10% 122 22753 0.11% 123 24112 0.11% 124 25621 0.12% 125 27378 0.13% 126 29033 0.13% 127 30398 0.14% 128 32333 0.15% 129 33993 0.16% 130 36338 0.17% 131 38995 0.18% 132 41514 0.19% 133 44757 0.21% 134 48768 0.23% 135 52576 0.24% 136 57219 0.27% 137 60933 0.28% 138 66642 0.31% 139 73011 0.34% 140 78403 0.36% 141 86583 0.40% 142 95900 0.44% 143 110062 0.51% 144 130466 0.61% 145 158796 0.74% 146 203309 0.94% 147 278572 1.29% 148 424584 1.97% 149 851286 3.95% 150 4504514 20.90% 151 13554567 62.89% 21554031 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=2.72 fanout-score-rank=35 prefix-density=0.15 prefix-fanout=2.7 sequence=GTGGACTCCTTCTGGATGTTGTA criterion=fanout-score sequence-density=0.09 sequence-density-rank=5 fanout-score=380.60 fanout-score-rank=1 prefix-density=0.98 prefix-fanout=36.1 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=5.08 fanout-score-rank=27 prefix-density=0.27 prefix-fanout=3.4 sequence=CATGGCAACCAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=77.85 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=7.6 sequence=AACTCTCTTGCAACCTGAAACAGGGAAACCAGTTAGTCGGGAACCAAAATCAAGGCTATGGCATCACTAGCAACCTTTGCTGCAGTGCAACCGGCCACCATCAAAGGCCTTGGTGGTAGCTCCCTCAGTGGAACCAAGCTCCATGTTAAACCATCACGCCAGGGCTTAAGACCCAAAAGCTTGAGGAGTGGTGCTGTGGTGGCCAAGTATGGTGACAAGAGTGTCTACTTTGATTTGGAGGATTT SRR7030821 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 20:39:56 Started mapping on | Feb 12 20:39:56 Finished on | Feb 12 20:42:01 Mapping speed, Million of reads per hour | 620.76 Number of input reads | 21554031 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 20262885 Uniquely mapped reads % | 94.01% Average mapped length | 297.30 Number of splices: Total | 20114062 Number of splices: Annotated (sjdb) | 19721330 Number of splices: GT/AG | 19778717 Number of splices: GC/AG | 265654 Number of splices: AT/AC | 15801 Number of splices: Non-canonical | 53890 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.82 Insertion rate per base | 0.02% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 596356 % of reads mapped to multiple loci | 2.77% Number of reads mapped to too many loci | 317486 % of reads mapped to too many loci | 1.47% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.50% % of reads unmapped: other | 0.25% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 719659 719659 719659 N_multimapping 596356 596356 596356 N_noFeature 650928 20071667 727399 N_ambiguous 228463 1181 113105 UnstrandedReadsAssigned:19383494 PositiveStrandReadsAssigned:190037 NegativeStrandReadsAssigned:19422381 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7030821 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7030821-trimmed-pair1.fastq SRR7030821-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,554,031 reads, 19,553,534 reads pseudoaligned [quant] estimated average fragment length: 259.429 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,077 rounds 52401 SRR7030821.ke.tsv 34699 SRR7030821.se.tsv 87100 total ==> SRR7030821.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1759.57 1757 38.9288 Potri.005G024800.1.v4.1 1035 776.571 721 36.196 Potri.004G059700.1.v4.1 961 702.577 18 0.998815 Potri.007G009000.2.v4.1 1416 1157.57 4 0.134716 Potri.003G141000.2.v4.1 2943 2684.57 822.46 11.9439 Potri.016G087400.1.v4.1 270 65.9334 1304.4 771.278 Potri.015G069301.1.v4.1 564 309.843 0 0 Potri.010G195200.1.v4.1 1773 1514.57 145 3.73237 Potri.012G127500.1.v4.1 977 718.571 13803 748.877 ==> SRR7030821.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 8 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 360 Potri.001G212900.v4.1 19 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 66 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR7030821 completed mapping pipeline successfully