Starting /dee2/code/volunteer_pipeline.sh SRR7030822 current disk space = 3050867048448 free memory = 1580484120 SRR7030822 SRAfilesize 52cb0ebc5860035a44cca9e7179d6cce SRR7030822.sra SRR7030822.sra file validated SRR7030822 is paired end SRR7030822 is conventional basespace SRR7030822 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030822_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.82775 33.0 33.0 34.0 27.0 34.0 2 32.73325 33.0 33.0 34.0 32.0 34.0 3 31.9395 33.0 32.0 33.0 28.0 34.0 4 32.2115 33.0 33.0 33.0 31.0 34.0 5 32.73325 33.0 33.0 34.0 32.0 34.0 6 36.68375 38.0 37.0 38.0 34.0 38.0 7 36.8945 38.0 37.0 38.0 34.0 38.0 8 37.301 38.0 38.0 38.0 36.0 38.0 9 37.48725 38.0 38.0 38.0 37.0 38.0 10-14 37.5372 38.0 38.0 38.0 37.0 38.0 15-19 37.543899999999994 38.0 38.0 38.0 37.4 38.0 20-24 37.458349999999996 38.0 38.0 38.0 37.0 38.0 25-29 37.4385 38.0 38.0 38.0 37.0 38.0 30-34 37.4101 38.0 38.0 38.0 37.0 38.0 35-39 37.4002 38.0 38.0 38.0 37.0 38.0 40-44 37.35475 38.0 38.0 38.0 37.0 38.0 45-49 37.32765 38.0 38.0 38.0 37.0 38.0 50-54 37.2786 38.0 38.0 38.0 37.0 38.0 55-59 37.2237 38.0 38.0 38.0 36.2 38.0 60-64 37.1443 38.0 38.0 38.0 36.2 38.0 65-69 37.057050000000004 38.0 38.0 38.0 36.0 38.0 70-74 36.955 38.0 38.0 38.0 35.6 38.0 75-79 36.92475 38.0 38.0 38.0 36.0 38.0 80-84 36.82255 38.0 38.0 38.0 35.0 38.0 85-89 36.79135 38.0 38.0 38.0 35.0 38.0 90-94 36.70885 38.0 38.0 38.0 34.8 38.0 95-99 36.32835 38.0 37.8 38.0 33.4 38.0 100-104 36.35179999999999 38.0 38.0 38.0 33.8 38.0 105-109 36.10175 38.0 37.2 38.0 32.6 38.0 110-114 36.15935 38.0 37.2 38.0 33.6 38.0 115-119 35.9961 38.0 37.0 38.0 33.0 38.0 120-124 35.838849999999994 38.0 37.0 38.0 31.8 38.0 125-129 35.64115 38.0 36.6 38.0 31.4 38.0 130-134 35.233850000000004 38.0 36.0 38.0 28.8 38.0 135-139 34.946149999999996 38.0 35.4 38.0 28.2 38.0 140-144 34.6629 38.0 35.0 38.0 27.6 38.0 145-149 34.081900000000005 38.0 35.0 38.0 23.8 38.0 150-151 30.459875 36.5 29.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 2.0 12 0.0 13 0.0 14 2.0 15 0.0 16 0.0 17 2.0 18 3.0 19 3.0 20 1.0 21 5.0 22 4.0 23 3.0 24 9.0 25 14.0 26 15.0 27 25.0 28 27.0 29 27.0 30 47.0 31 48.0 32 62.0 33 115.0 34 170.0 35 284.0 36 678.0 37 2453.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.941869599371564 11.076197957580519 11.128567687876407 39.85336475517151 2 20.65 13.25 37.1 28.999999999999996 3 18.875 17.45 29.4 34.275 4 22.75 26.0 23.05 28.199999999999996 5 21.099999999999998 31.724999999999998 25.45 21.725 6 19.625 34.175 26.125 20.075000000000003 7 14.45 26.05 40.949999999999996 18.55 8 18.224999999999998 25.174999999999997 31.374999999999996 25.224999999999998 9 17.75 23.1 34.8 24.349999999999998 10-14 19.595000000000002 29.4 26.645000000000003 24.36 15-19 19.945 28.1 28.244999999999997 23.71 20-24 19.52 28.425 27.975 24.08 25-29 19.18 28.895 27.889999999999997 24.035 30-34 19.97 28.055000000000003 28.084999999999997 23.89 35-39 20.064999999999998 28.185 27.515 24.235 40-44 19.785 28.21 27.61 24.395 45-49 19.875 28.134999999999998 28.325 23.665 50-54 20.31 28.16 28.115000000000002 23.415 55-59 20.195 27.705000000000002 28.08 24.02 60-64 19.955000000000002 28.194999999999997 27.825 24.025 65-69 20.665 27.665 27.815 23.855 70-74 19.725 28.42 27.565 24.29 75-79 19.925 28.43 27.43 24.215 80-84 20.150000000000002 27.534999999999997 28.155 24.16 85-89 20.395 27.57 28.4 23.635 90-94 20.785 28.26 27.034999999999997 23.919999999999998 95-99 19.905 27.800000000000004 27.744999999999997 24.55 100-104 20.62 27.384999999999998 27.985 24.01 105-109 20.150000000000002 27.415 28.27 24.165 110-114 20.544999999999998 27.345000000000002 28.084999999999997 24.025 115-119 20.825 27.955000000000002 27.375 23.845 120-124 20.385 27.82 27.68 24.115000000000002 125-129 21.060000000000002 27.705000000000002 27.715 23.52 130-134 20.26 27.950000000000003 27.700000000000003 24.09 135-139 20.95 27.605 28.055000000000003 23.39 140-144 20.66 27.950000000000003 27.195000000000004 24.195 145-149 20.925 28.444999999999997 27.279999999999998 23.35 150-151 20.6875 28.012500000000003 27.8625 23.4375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 1.0 22 2.0 23 1.0 24 0.0 25 1.0 26 5.5 27 11.0 28 12.5 29 16.0 30 20.5 31 25.0 32 30.5 33 38.5 34 49.5 35 61.0 36 79.5 37 99.5 38 121.0 39 142.0 40 165.0 41 213.0 42 242.0 43 249.0 44 262.5 45 274.0 46 278.5 47 260.0 48 242.5 49 225.5 50 202.5 51 156.5 52 124.0 53 105.0 54 71.5 55 56.0 56 42.0 57 31.0 58 25.5 59 18.0 60 11.5 61 7.5 62 4.0 63 3.5 64 4.5 65 2.5 66 1.5 67 1.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.5249999999999995 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.2875 0.0 0.0 0.0 0.0 104-105 0.3 0.0 0.0 0.0 0.0 106-107 0.35 0.0 0.0 0.0 0.0 108-109 0.4 0.0 0.0 0.0 0.0 110-111 0.4125 0.0 0.0 0.0 0.0 112-113 0.44999999999999996 0.0 0.0 0.0 0.0 114-115 0.5125 0.0 0.0 0.0 0.0 116-117 0.6625 0.0 0.0 0.0 0.0 118-119 0.7375 0.0 0.0 0.0 0.0 120-121 0.8500000000000001 0.0 0.0 0.0 0.0 122-123 0.9 0.0 0.0 0.0 0.0 124-125 1.0125 0.0 0.0 0.0 0.0 126-127 1.1125 0.0 0.0 0.0 0.0 128-129 1.2000000000000002 0.0 0.0 0.0 0.0 130-131 1.25 0.0 0.0 0.0 0.0 132-133 1.35 0.0 0.0 0.0 0.0 134-135 1.4874999999999998 0.0 0.0 0.0 0.0 136-137 1.65 0.0 0.0 0.0 0.0 138-139 1.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGGAGG 10 0.0068343505 144.975 3 TGGTAGA 10 0.0068343505 144.975 2 GTCAATT 10 0.0068343505 144.975 6 TCTGGGC 10 0.0068343505 144.975 9 GGGATTC 10 0.0068343505 144.975 2 CCGAAGA 10 0.0068343505 144.975 145 >>END_MODULE SRR7030822 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030822_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.543 33.0 33.0 34.0 32.0 34.0 2 32.64775 33.0 33.0 34.0 32.0 34.0 3 32.73475 33.0 33.0 34.0 32.0 34.0 4 32.6635 33.0 33.0 34.0 32.0 34.0 5 32.692 33.0 33.0 34.0 32.0 34.0 6 36.868 38.0 38.0 38.0 35.0 38.0 7 36.9615 38.0 38.0 38.0 36.0 38.0 8 36.9795 38.0 38.0 38.0 36.0 38.0 9 36.94075 38.0 38.0 38.0 36.0 38.0 10-14 36.991200000000006 38.0 38.0 38.0 36.0 38.0 15-19 37.0084 38.0 38.0 38.0 36.0 38.0 20-24 37.0185 38.0 38.0 38.0 36.0 38.0 25-29 36.75255 38.0 38.0 38.0 35.0 38.0 30-34 36.8149 38.0 38.0 38.0 35.4 38.0 35-39 36.716499999999996 38.0 38.0 38.0 35.0 38.0 40-44 36.54395000000001 38.0 38.0 38.0 34.0 38.0 45-49 36.443 38.0 38.0 38.0 34.0 38.0 50-54 36.5434 38.0 38.0 38.0 34.0 38.0 55-59 36.41635 38.0 37.8 38.0 34.0 38.0 60-64 36.424249999999994 38.0 38.0 38.0 34.0 38.0 65-69 36.186350000000004 38.0 37.4 38.0 33.2 38.0 70-74 36.20255 38.0 37.2 38.0 33.4 38.0 75-79 36.122 38.0 37.0 38.0 32.6 38.0 80-84 36.027049999999996 38.0 37.0 38.0 33.0 38.0 85-89 35.7699 38.0 37.0 38.0 30.6 38.0 90-94 35.6743 38.0 36.8 38.0 30.8 38.0 95-99 35.43429999999999 38.0 36.4 38.0 29.0 38.0 100-104 34.983999999999995 38.0 35.8 38.0 27.2 38.0 105-109 34.9498 38.0 35.6 38.0 27.6 38.0 110-114 34.744899999999994 38.0 35.2 38.0 26.6 38.0 115-119 34.466899999999995 38.0 35.0 38.0 25.0 38.0 120-124 34.26975 38.0 34.6 38.0 23.6 38.0 125-129 34.07285 38.0 34.4 38.0 23.0 38.0 130-134 33.42985 38.0 34.0 38.0 17.8 38.0 135-139 32.9179 38.0 33.6 38.0 14.8 38.0 140-144 32.348749999999995 37.4 32.8 38.0 14.4 38.0 145-149 31.2719 36.0 31.6 38.0 9.0 38.0 150-151 26.895875 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 4.0 4 1.0 5 0.0 6 1.0 7 0.0 8 1.0 9 0.0 10 0.0 11 3.0 12 2.0 13 1.0 14 4.0 15 5.0 16 4.0 17 5.0 18 8.0 19 7.0 20 14.0 21 10.0 22 8.0 23 15.0 24 21.0 25 35.0 26 37.0 27 36.0 28 42.0 29 57.0 30 72.0 31 84.0 32 116.0 33 172.0 34 250.0 35 407.0 36 926.0 37 1651.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.89144572286143 22.736368184092047 14.4072036018009 29.964982491245625 2 26.96348174087044 26.23811905952976 29.5647823911956 17.2336168084042 3 21.56617463097323 27.695771828871653 30.673004753565174 20.06504878658994 4 21.710855427713856 35.317658829414704 23.461730865432717 19.50975487743872 5 24.775 35.9 22.625 16.7 6 20.355088772193046 38.8097024256064 22.50562640660165 18.3295823955989 7 19.7 21.6 39.375 19.325 8 21.349999999999998 26.025 27.950000000000003 24.675 9 22.175 26.25 29.975 21.6 10-14 23.150000000000002 29.26 26.31 21.279999999999998 15-19 22.395 28.999999999999996 27.065 21.54 20-24 22.625 29.24 27.025 21.11 25-29 22.645 28.12 28.144999999999996 21.09 30-34 22.795 28.910000000000004 27.495000000000005 20.8 35-39 22.564999999999998 28.4 27.655 21.38 40-44 23.53 28.389999999999997 27.315 20.765 45-49 22.919999999999998 28.73 27.16 21.19 50-54 23.09 27.450000000000003 27.965 21.495 55-59 23.419999999999998 27.87 27.62 21.09 60-64 22.98 27.68 27.935 21.404999999999998 65-69 23.135 27.735 27.825 21.305 70-74 22.755 28.025 27.85 21.37 75-79 22.755 28.060000000000002 27.845 21.34 80-84 23.825 27.560000000000002 27.529999999999998 21.085 85-89 23.474999999999998 27.91 27.755000000000003 20.86 90-94 23.65 27.525 27.515 21.310000000000002 95-99 23.635 28.384999999999998 27.450000000000003 20.53 100-104 23.724999999999998 27.555000000000003 27.634999999999998 21.085 105-109 23.565 27.939999999999998 27.060000000000002 21.435000000000002 110-114 23.56 28.16 27.284999999999997 20.995 115-119 23.580000000000002 28.03 27.595 20.794999999999998 120-124 23.455000000000002 28.134999999999998 27.634999999999998 20.775 125-129 24.169999999999998 28.050000000000004 27.375 20.405 130-134 23.815 27.744999999999997 28.134999999999998 20.305 135-139 23.84 28.035 27.3 20.825 140-144 23.549999999999997 28.139999999999997 27.839999999999996 20.47 145-149 23.919999999999998 27.400000000000002 27.865000000000002 20.815 150-151 24.0125 28.125 26.8125 21.05 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 2.0 24 3.0 25 5.5 26 6.0 27 3.5 28 4.0 29 7.0 30 11.5 31 17.0 32 23.0 33 32.5 34 43.0 35 54.5 36 68.5 37 102.0 38 141.5 39 169.5 40 193.5 41 221.5 42 252.0 43 285.0 44 309.0 45 279.5 46 270.0 47 265.5 48 233.0 49 217.5 50 170.5 51 132.5 52 116.0 53 86.5 54 67.5 55 62.5 56 45.5 57 24.5 58 23.0 59 20.0 60 9.5 61 5.0 62 4.0 63 4.0 64 3.0 65 1.0 66 1.5 67 1.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.05 3 0.075 4 0.05 5 0.0 6 0.025 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47209653092006 98.925 2 0.5027652086475616 1.0 3 0.025138260432378077 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.2875 0.0 0.0 0.0 0.0 104-105 0.3 0.0 0.0 0.0 0.0 106-107 0.35 0.0 0.0 0.0 0.0 108-109 0.4 0.0 0.0 0.0 0.0 110-111 0.4125 0.0 0.0 0.0 0.0 112-113 0.44999999999999996 0.0 0.0 0.0 0.0 114-115 0.5125 0.0 0.0 0.0 0.0 116-117 0.6375 0.0 0.0 0.0 0.0 118-119 0.7125 0.0 0.0 0.0 0.0 120-121 0.825 0.0 0.0 0.0 0.0 122-123 0.875 0.0 0.0 0.0 0.0 124-125 0.9875 0.0 0.0 0.0 0.0 126-127 1.0875 0.0 0.0 0.0 0.0 128-129 1.1749999999999998 0.0 0.0 0.0 0.0 130-131 1.225 0.0 0.0 0.0 0.0 132-133 1.325 0.0 0.0 0.0 0.0 134-135 1.4375 0.0 0.0 0.0 0.0 136-137 1.6 0.0 0.0 0.0 0.0 138-139 1.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGGTTG 10 0.006830828 145.0 5 >>END_MODULE Read 1005308 spots for SRR7030822.sra Written 1005308 spots for SRR7030822.sra Read 1005308 spots for SRR7030822.sra Written 1005308 spots for SRR7030822.sra Read 1005308 spots for SRR7030822.sra Written 1005308 spots for SRR7030822.sra Read 1005308 spots for SRR7030822.sra Written 1005308 spots for SRR7030822.sra Read 1005308 spots for SRR7030822.sra Written 1005308 spots for SRR7030822.sra Read 1005308 spots for SRR7030822.sra Written 1005308 spots for SRR7030822.sra Read 1005308 spots for SRR7030822.sra Written 1005308 spots for SRR7030822.sra Read 1005308 spots for SRR7030822.sra Written 1005308 spots for SRR7030822.sra Read 1005308 spots for SRR7030822.sra Written 1005308 spots for SRR7030822.sra Read 1005308 spots for SRR7030822.sra Written 1005308 spots for SRR7030822.sra Read 1005308 spots for SRR7030822.sra Written 1005308 spots for SRR7030822.sra Read 1005308 spots for SRR7030822.sra Written 1005308 spots for SRR7030822.sra Read 1005308 spots for SRR7030822.sra Written 1005308 spots for SRR7030822.sra Read 1005308 spots for SRR7030822.sra Written 1005308 spots for SRR7030822.sra Read 1005308 spots for SRR7030822.sra Written 1005308 spots for SRR7030822.sra Read 1005308 spots for SRR7030822.sra Written 1005308 spots for SRR7030822.sra Read 1005319 spots for SRR7030822.sra Written 1005319 spots for SRR7030822.sra Read 1005308 spots for SRR7030822.sra Written 1005308 spots for SRR7030822.sra Read 1005308 spots for SRR7030822.sra Written 1005308 spots for SRR7030822.sra Read 1005308 spots for SRR7030822.sra Written 1005308 spots for SRR7030822.sra SRR ids: ['SRR7030822.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2jgh0i__ SRR7030822.sra spots: 20106171 blocks: [[1, 1005308], [1005309, 2010616], [2010617, 3015924], [3015925, 4021232], [4021233, 5026540], [5026541, 6031848], [6031849, 7037156], [7037157, 8042464], [8042465, 9047772], [9047773, 10053080], [10053081, 11058388], [11058389, 12063696], [12063697, 13069004], [13069005, 14074312], [14074313, 15079620], [15079621, 16084928], [16084929, 17090236], [17090237, 18095544], [18095545, 19100852], [19100853, 20106171]] SRR7030822 file size 6791621 SRR7030822 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7030822 SRR7030822_1.fastq SRR7030822_2.fastq Input file: SRR7030822_1.fastq Paired file: SRR7030822_2.fastq trimmed: SRR7030822-trimmed-pair1.fastq, SRR7030822-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 20:40:30 2025 >> started Wed Feb 12 20:41:06 2025 >> done (35.802s) 20106171 read pairs processed; of these: 9768 ( 0.05%) short read pairs filtered out after trimming by size control 9553 ( 0.05%) empty read pairs filtered out after trimming by size control 20086850 (99.90%) read pairs available; of these: 8114682 (40.40%) trimmed read pairs available after processing 11972168 (59.60%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 3 0.00% 21 1 0.00% 22 3 0.00% 23 6 0.00% 24 4 0.00% 25 5 0.00% 26 3 0.00% 27 5 0.00% 28 1 0.00% 29 7 0.00% 30 3 0.00% 31 4 0.00% 32 6 0.00% 33 2 0.00% 34 4 0.00% 35 6 0.00% 36 6 0.00% 37 12 0.00% 38 3 0.00% 39 3 0.00% 40 5 0.00% 41 7 0.00% 42 4 0.00% 43 3 0.00% 44 12 0.00% 45 6 0.00% 46 8 0.00% 47 10 0.00% 48 13 0.00% 49 10 0.00% 50 12 0.00% 51 13 0.00% 52 17 0.00% 53 24 0.00% 54 19 0.00% 55 32 0.00% 56 20 0.00% 57 39 0.00% 58 38 0.00% 59 44 0.00% 60 40 0.00% 61 52 0.00% 62 56 0.00% 63 67 0.00% 64 82 0.00% 65 76 0.00% 66 92 0.00% 67 116 0.00% 68 88 0.00% 69 151 0.00% 70 144 0.00% 71 177 0.00% 72 179 0.00% 73 256 0.00% 74 265 0.00% 75 297 0.00% 76 342 0.00% 77 353 0.00% 78 374 0.00% 79 451 0.00% 80 547 0.00% 81 611 0.00% 82 723 0.00% 83 856 0.00% 84 1443 0.01% 85 1828 0.01% 86 1973 0.01% 87 2215 0.01% 88 2358 0.01% 89 2476 0.01% 90 2568 0.01% 91 2749 0.01% 92 3071 0.02% 93 3323 0.02% 94 3476 0.02% 95 3665 0.02% 96 3993 0.02% 97 4310 0.02% 98 4501 0.02% 99 4801 0.02% 100 5218 0.03% 101 5678 0.03% 102 5995 0.03% 103 6459 0.03% 104 6890 0.03% 105 7391 0.04% 106 8014 0.04% 107 8412 0.04% 108 9155 0.05% 109 9745 0.05% 110 10191 0.05% 111 11016 0.05% 112 12084 0.06% 113 12915 0.06% 114 13913 0.07% 115 14887 0.07% 116 16030 0.08% 117 16944 0.08% 118 17838 0.09% 119 18614 0.09% 120 19619 0.10% 121 20908 0.10% 122 22354 0.11% 123 23694 0.12% 124 25230 0.13% 125 26847 0.13% 126 28588 0.14% 127 30375 0.15% 128 32567 0.16% 129 34348 0.17% 130 36975 0.18% 131 39150 0.19% 132 41626 0.21% 133 45729 0.23% 134 48936 0.24% 135 53097 0.26% 136 57787 0.29% 137 62991 0.31% 138 68587 0.34% 139 75790 0.38% 140 82677 0.41% 141 90820 0.45% 142 102903 0.51% 143 117736 0.59% 144 139905 0.70% 145 169525 0.84% 146 218020 1.09% 147 300575 1.50% 148 459416 2.29% 149 905545 4.51% 150 4459402 22.20% 151 11972168 59.60% 20086850 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=35 prefix-density=0.21 prefix-fanout=2.2 sequence=GTGGACTCCTTCTGGATGTTGTA criterion=fanout-score sequence-density=0.11 sequence-density-rank=11 fanout-score=118.75 fanout-score-rank=1 prefix-density=0.62 prefix-fanout=21.6 sequence=CCTTCTTCTTGA criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=36 prefix-density=0.37 prefix-fanout=2.1 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.10 sequence-density-rank=21 fanout-score=367.78 fanout-score-rank=1 prefix-density=1.13 prefix-fanout=31.4 sequence=AAGAAGAAGAAA SRR7030822 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 20:41:55 Started mapping on | Feb 12 20:41:55 Finished on | Feb 12 20:43:45 Mapping speed, Million of reads per hour | 657.39 Number of input reads | 20086850 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 19210778 Uniquely mapped reads % | 95.64% Average mapped length | 297.13 Number of splices: Total | 17711071 Number of splices: Annotated (sjdb) | 17433604 Number of splices: GT/AG | 17433621 Number of splices: GC/AG | 224473 Number of splices: AT/AC | 10931 Number of splices: Non-canonical | 42046 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.80 Insertion rate per base | 0.02% Insertion average length | 2.60 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 581137 % of reads mapped to multiple loci | 2.89% Number of reads mapped to too many loci | 74826 % of reads mapped to too many loci | 0.37% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.03% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 307080 307080 307080 N_multimapping 581137 581137 581137 N_noFeature 311141 19032789 393756 N_ambiguous 192895 989 96976 UnstrandedReadsAssigned:18706742 PositiveStrandReadsAssigned:177000 NegativeStrandReadsAssigned:18720046 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7030822 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7030822-trimmed-pair1.fastq SRR7030822-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,086,850 reads, 18,710,160 reads pseudoaligned [quant] estimated average fragment length: 266.718 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,060 rounds 52401 SRR7030822.ke.tsv 34699 SRR7030822.se.tsv 87100 total ==> SRR7030822.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1752.28 2405 55.2955 Potri.005G024800.1.v4.1 1035 769.282 1223 64.0501 Potri.004G059700.1.v4.1 961 695.299 20 1.15888 Potri.007G009000.2.v4.1 1416 1150.28 0 0 Potri.003G141000.2.v4.1 2943 2677.28 661 9.94686 Potri.016G087400.1.v4.1 270 64.6346 960 598.39 Potri.015G069301.1.v4.1 564 303.063 0 0 Potri.010G195200.1.v4.1 1773 1507.28 128 3.42132 Potri.012G127500.1.v4.1 977 711.288 11948 676.751 ==> SRR7030822.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 26 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 194 Potri.001G212900.v4.1 24 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 168 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7030822 completed mapping pipeline successfully