Starting /dee2/code/volunteer_pipeline.sh SRR7030823 current disk space = 3050867048448 free memory = 1580484120 SRR7030823 SRAfilesize 9e43547a95917c18f4f309c579568d68 SRR7030823.sra SRR7030823.sra file validated SRR7030823 is paired end SRR7030823 is conventional basespace SRR7030823 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030823_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.384 33.0 33.0 34.0 31.0 34.0 2 32.8485 34.0 33.0 34.0 31.0 34.0 3 31.85425 33.0 31.0 33.0 28.0 34.0 4 32.23225 33.0 33.0 33.0 31.0 34.0 5 32.813 33.0 33.0 34.0 32.0 34.0 6 36.89375 38.0 37.0 38.0 35.0 38.0 7 37.369 38.0 38.0 38.0 37.0 38.0 8 37.43875 38.0 38.0 38.0 37.0 38.0 9 37.57475 38.0 38.0 38.0 38.0 38.0 10-14 37.59994999999999 38.0 38.0 38.0 38.0 38.0 15-19 37.606950000000005 38.0 38.0 38.0 38.0 38.0 20-24 37.591950000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.54585 38.0 38.0 38.0 38.0 38.0 30-34 37.4668 38.0 38.0 38.0 37.4 38.0 35-39 37.48004999999999 38.0 38.0 38.0 37.2 38.0 40-44 37.4542 38.0 38.0 38.0 37.0 38.0 45-49 37.47529999999999 38.0 38.0 38.0 37.2 38.0 50-54 37.4049 38.0 38.0 38.0 37.0 38.0 55-59 37.3828 38.0 38.0 38.0 37.0 38.0 60-64 37.2904 38.0 38.0 38.0 37.0 38.0 65-69 37.166000000000004 38.0 38.0 38.0 36.4 38.0 70-74 37.1697 38.0 38.0 38.0 36.0 38.0 75-79 37.1773 38.0 38.0 38.0 36.2 38.0 80-84 37.116949999999996 38.0 38.0 38.0 36.0 38.0 85-89 36.9988 38.0 38.0 38.0 36.0 38.0 90-94 36.9591 38.0 38.0 38.0 35.8 38.0 95-99 36.8619 38.0 38.0 38.0 35.2 38.0 100-104 36.66145 38.0 38.0 38.0 34.6 38.0 105-109 36.6012 38.0 38.0 38.0 34.0 38.0 110-114 36.46945 38.0 38.0 38.0 34.2 38.0 115-119 36.3303 38.0 38.0 38.0 34.0 38.0 120-124 36.14615 38.0 37.8 38.0 33.4 38.0 125-129 35.9127 38.0 37.0 38.0 33.0 38.0 130-134 35.69785 38.0 36.4 38.0 32.2 38.0 135-139 35.5471 38.0 36.0 38.0 31.8 38.0 140-144 35.224599999999995 38.0 36.0 38.0 31.0 38.0 145-149 34.78415 38.0 35.8 38.0 29.2 38.0 150-151 31.312375 36.5 31.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 2.0 16 0.0 17 0.0 18 3.0 19 0.0 20 2.0 21 5.0 22 4.0 23 5.0 24 7.0 25 10.0 26 16.0 27 15.0 28 16.0 29 29.0 30 25.0 31 49.0 32 51.0 33 93.0 34 144.0 35 201.0 36 556.0 37 2765.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.621415416995525 10.78663509602736 10.128913443830571 40.46303604314654 2 22.2 14.274999999999999 33.15 30.375000000000004 3 19.575 17.8 27.150000000000002 35.475 4 22.775000000000002 24.7 23.724999999999998 28.799999999999997 5 23.325000000000003 29.075 26.3 21.3 6 19.75 34.150000000000006 25.275 20.825 7 14.124999999999998 25.75 41.225 18.9 8 17.525 25.0 32.2 25.275 9 18.15 25.074999999999996 33.2 23.575 10-14 19.994999999999997 29.715000000000003 26.805 23.485 15-19 19.575 28.465 27.725 24.235 20-24 19.505 28.37 27.775 24.349999999999998 25-29 20.044999999999998 28.294999999999998 27.805000000000003 23.855 30-34 19.580000000000002 28.315 27.839999999999996 24.265 35-39 19.84 28.410000000000004 27.255000000000003 24.495 40-44 19.86 28.78 27.169999999999998 24.19 45-49 20.47 27.815 27.48 24.235 50-54 19.950000000000003 28.215 27.88 23.955000000000002 55-59 19.895 27.750000000000004 27.58 24.775 60-64 20.175 27.805000000000003 27.63 24.39 65-69 20.09 28.110000000000003 27.529999999999998 24.27 70-74 20.24 28.055000000000003 27.495000000000005 24.21 75-79 20.785 27.725 27.04 24.45 80-84 20.580000000000002 27.279999999999998 28.375 23.765 85-89 20.385 27.685 28.189999999999998 23.74 90-94 20.875 27.47 27.279999999999998 24.375 95-99 20.735 27.55 27.12 24.595 100-104 20.665 28.044999999999998 27.400000000000002 23.89 105-109 20.68 27.474999999999998 27.77 24.075 110-114 20.925 27.77 27.38 23.925 115-119 20.555 27.384999999999998 28.155 23.905 120-124 20.974999999999998 26.91 27.750000000000004 24.365000000000002 125-129 20.794999999999998 27.339999999999996 27.685 24.18 130-134 21.18 27.435 27.145000000000003 24.240000000000002 135-139 21.2 27.169999999999998 27.700000000000003 23.93 140-144 20.830000000000002 28.035 27.389999999999997 23.745 145-149 20.595 27.87 27.205000000000002 24.33 150-151 21.325 27.725 26.8625 24.087500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 1.5 25 5.0 26 6.0 27 11.0 28 14.5 29 12.5 30 15.0 31 16.0 32 29.5 33 39.0 34 41.0 35 59.5 36 77.0 37 88.0 38 114.5 39 148.0 40 169.5 41 196.0 42 224.5 43 258.0 44 261.5 45 251.0 46 258.5 47 257.5 48 244.5 49 229.0 50 199.5 51 166.0 52 138.0 53 108.0 54 85.0 55 65.0 56 49.0 57 37.5 58 33.0 59 26.0 60 20.0 61 17.5 62 11.0 63 4.5 64 4.0 65 2.0 66 0.0 67 1.0 68 1.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.9750000000000005 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57318604067285 99.15 2 0.42681395932714034 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.1125 0.0 0.0 0.0 0.0 104-105 0.16249999999999998 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.3375 0.0 0.0 0.0 0.0 110-111 0.4375 0.0 0.0 0.0 0.0 112-113 0.5125 0.0 0.0 0.0 0.0 114-115 0.575 0.0 0.0 0.0 0.0 116-117 0.7125 0.0 0.0 0.0 0.0 118-119 0.8625 0.0 0.0 0.0 0.0 120-121 0.9375 0.0 0.0 0.0 0.0 122-123 1.0499999999999998 0.0 0.0 0.0 0.0 124-125 1.25 0.0 0.0 0.0 0.0 126-127 1.4625 0.0 0.0 0.0 0.0 128-129 1.675 0.0 0.0 0.0 0.0 130-131 1.85 0.0 0.0 0.0 0.0 132-133 2.1125 0.0 0.0 0.0 0.0 134-135 2.3625 0.0 0.0 0.0 0.0 136-137 2.5875 0.0 0.0 0.0 0.0 138-139 2.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTGTAG 10 0.0068343505 144.975 8 TTGACTT 10 0.0068343505 144.975 2 ACCTCGA 10 0.0068343505 144.975 145 >>END_MODULE SRR7030823 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030823_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.885 33.0 33.0 34.0 32.0 34.0 2 33.01725 34.0 33.0 34.0 32.0 34.0 3 32.962 34.0 33.0 34.0 32.0 34.0 4 33.02625 34.0 33.0 34.0 32.0 34.0 5 33.0445 34.0 33.0 34.0 32.0 34.0 6 37.2555 38.0 38.0 38.0 37.0 38.0 7 37.30325 38.0 38.0 38.0 37.0 38.0 8 37.43425 38.0 38.0 38.0 37.0 38.0 9 37.335 38.0 38.0 38.0 37.0 38.0 10-14 37.2665 38.0 38.0 38.0 37.0 38.0 15-19 37.231399999999994 38.0 38.0 38.0 37.0 38.0 20-24 37.29145 38.0 38.0 38.0 37.0 38.0 25-29 37.2303 38.0 38.0 38.0 36.8 38.0 30-34 37.21315 38.0 38.0 38.0 37.0 38.0 35-39 37.09285 38.0 38.0 38.0 36.4 38.0 40-44 37.01219999999999 38.0 38.0 38.0 36.2 38.0 45-49 36.95465 38.0 38.0 38.0 36.0 38.0 50-54 36.94795 38.0 38.0 38.0 36.0 38.0 55-59 36.8946 38.0 38.0 38.0 36.0 38.0 60-64 36.89125 38.0 38.0 38.0 36.0 38.0 65-69 36.848200000000006 38.0 38.0 38.0 35.6 38.0 70-74 36.83825 38.0 38.0 38.0 35.8 38.0 75-79 36.76635 38.0 38.0 38.0 35.2 38.0 80-84 36.72795 38.0 38.0 38.0 35.0 38.0 85-89 36.5139 38.0 38.0 38.0 34.6 38.0 90-94 36.50735 38.0 38.0 38.0 34.0 38.0 95-99 36.2244 38.0 38.0 38.0 33.6 38.0 100-104 36.025150000000004 38.0 37.2 38.0 33.2 38.0 105-109 35.855450000000005 38.0 37.0 38.0 32.6 38.0 110-114 35.8018 38.0 37.0 38.0 32.4 38.0 115-119 35.41635 38.0 36.6 38.0 29.6 38.0 120-124 35.354049999999994 38.0 36.0 38.0 30.6 38.0 125-129 35.07985 38.0 36.0 38.0 28.6 38.0 130-134 34.47545 38.0 35.4 38.0 25.2 38.0 135-139 34.33025 38.0 35.0 38.0 24.2 38.0 140-144 33.92719999999999 38.0 34.6 38.0 23.0 38.0 145-149 33.323499999999996 38.0 34.2 38.0 18.2 38.0 150-151 29.770125 36.0 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 1.0 4 2.0 5 1.0 6 0.0 7 1.0 8 1.0 9 0.0 10 1.0 11 2.0 12 0.0 13 3.0 14 0.0 15 3.0 16 5.0 17 3.0 18 6.0 19 11.0 20 2.0 21 8.0 22 15.0 23 10.0 24 11.0 25 15.0 26 17.0 27 21.0 28 34.0 29 39.0 30 39.0 31 51.0 32 80.0 33 92.0 34 161.0 35 307.0 36 709.0 37 2347.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.71964956195244 21.101376720901126 13.441802252816021 29.737171464330416 2 26.790185277916873 26.314471707561342 30.771156735102657 16.124186279419128 3 21.437515652391685 28.399699474079636 30.227898822940148 19.93488605058853 4 23.38507761642464 33.77566349524287 23.360040060090135 19.479218828242363 5 24.943707780835627 35.7518138603953 21.916437327995997 17.38804103077308 6 21.25 38.0 23.525 17.224999999999998 7 20.4 22.15 38.025 19.425 8 22.525000000000002 25.624999999999996 27.474999999999998 24.375 9 21.2 26.325 29.099999999999998 23.375 10-14 23.125 29.565 25.745 21.565 15-19 23.25 28.744999999999997 26.915 21.09 20-24 22.275 29.215000000000003 26.729999999999997 21.78 25-29 23.745 29.459999999999997 25.855 20.94 30-34 22.595000000000002 28.435 27.515 21.455 35-39 22.485 28.144999999999996 27.85 21.52 40-44 23.415 27.825 27.275 21.485000000000003 45-49 22.98 27.665 27.99 21.365000000000002 50-54 23.86 27.595 27.43 21.115000000000002 55-59 23.425 27.24 28.189999999999998 21.145 60-64 22.715 28.165000000000003 27.27 21.85 65-69 22.915 27.74 27.694999999999997 21.65 70-74 23.72 27.29 27.744999999999997 21.245 75-79 23.755000000000003 27.785 27.455000000000002 21.005 80-84 23.665 28.43 27.01 20.895 85-89 23.474999999999998 28.165000000000003 26.974999999999998 21.385 90-94 23.645 28.175 26.85 21.33 95-99 23.955000000000002 27.98 27.315 20.75 100-104 24.145 27.689999999999998 27.029999999999998 21.135 105-109 24.265 28.28 26.72 20.735 110-114 24.175 28.299999999999997 26.995 20.53 115-119 24.12 27.99 26.875 21.015 120-124 23.87 27.400000000000002 27.46 21.27 125-129 23.84 28.12 26.93 21.11 130-134 24.485 27.605 27.455000000000002 20.455000000000002 135-139 24.355 28.000000000000004 27.025 20.62 140-144 24.529999999999998 27.96 26.950000000000003 20.560000000000002 145-149 24.605 27.205000000000002 27.48 20.71 150-151 23.775 27.1625 28.1625 20.9 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.5 23 1.5 24 3.0 25 2.0 26 0.5 27 1.5 28 4.0 29 10.0 30 12.0 31 13.0 32 21.5 33 30.5 34 40.0 35 50.5 36 69.5 37 102.5 38 130.5 39 155.0 40 182.5 41 210.0 42 255.5 43 282.0 44 278.5 45 279.5 46 279.5 47 262.5 48 235.0 49 213.5 50 188.5 51 162.0 52 121.5 53 88.5 54 74.0 55 54.0 56 43.5 57 40.5 58 29.0 59 18.5 60 14.0 61 10.0 62 8.0 63 5.0 64 2.5 65 1.0 66 2.5 67 2.5 68 0.5 69 1.0 70 1.5 71 1.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.15 3 0.17500000000000002 4 0.15 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29471032745592 98.55000000000001 2 0.654911838790932 1.3 3 0.05037783375314861 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.1875 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.3375 0.0 0.0 0.0 0.0 110-111 0.4375 0.0 0.0 0.0 0.0 112-113 0.5 0.0 0.0 0.0 0.0 114-115 0.55 0.0 0.0 0.0 0.0 116-117 0.6875 0.0 0.0 0.0 0.0 118-119 0.8374999999999999 0.0 0.0 0.0 0.0 120-121 0.9125 0.0 0.0 0.0 0.0 122-123 1.025 0.0 0.0 0.0 0.0 124-125 1.225 0.0 0.0 0.0 0.0 126-127 1.4125 0.0 0.0 0.0 0.0 128-129 1.625 0.0 0.0 0.0 0.0 130-131 1.8 0.0 0.0 0.0 0.0 132-133 2.0625 0.0 0.0 0.0 0.0 134-135 2.3 0.0 0.0 0.0 0.0 136-137 2.5 0.0 0.0 0.0 0.0 138-139 2.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTCGAT 10 0.006830828 145.0 145 >>END_MODULE Read 803972 spots for SRR7030823.sra Written 803972 spots for SRR7030823.sra Read 803972 spots for SRR7030823.sra Written 803972 spots for SRR7030823.sra Read 803972 spots for SRR7030823.sra Written 803972 spots for SRR7030823.sra Read 803972 spots for SRR7030823.sra Written 803972 spots for SRR7030823.sra Read 803972 spots for SRR7030823.sra Written 803972 spots for SRR7030823.sra Read 803972 spots for SRR7030823.sra Written 803972 spots for SRR7030823.sra Read 803972 spots for SRR7030823.sra Written 803972 spots for SRR7030823.sra Read 803972 spots for SRR7030823.sra Written 803972 spots for SRR7030823.sra Read 803972 spots for SRR7030823.sra Written 803972 spots for SRR7030823.sra Read 803972 spots for SRR7030823.sra Written 803972 spots for SRR7030823.sra Read 803972 spots for SRR7030823.sra Written 803972 spots for SRR7030823.sra Read 803972 spots for SRR7030823.sra Written 803972 spots for SRR7030823.sra Read 803980 spots for SRR7030823.sra Written 803980 spots for SRR7030823.sra Read 803972 spots for SRR7030823.sra Written 803972 spots for SRR7030823.sra Read 803972 spots for SRR7030823.sra Written 803972 spots for SRR7030823.sra Read 803972 spots for SRR7030823.sra Written 803972 spots for SRR7030823.sra Read 803972 spots for SRR7030823.sra Written 803972 spots for SRR7030823.sra Read 803972 spots for SRR7030823.sra Written 803972 spots for SRR7030823.sra Read 803972 spots for SRR7030823.sra Written 803972 spots for SRR7030823.sra Read 803972 spots for SRR7030823.sra Written 803972 spots for SRR7030823.sra SRR ids: ['SRR7030823.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ok3shqce SRR7030823.sra spots: 16079448 blocks: [[1, 803972], [803973, 1607944], [1607945, 2411916], [2411917, 3215888], [3215889, 4019860], [4019861, 4823832], [4823833, 5627804], [5627805, 6431776], [6431777, 7235748], [7235749, 8039720], [8039721, 8843692], [8843693, 9647664], [9647665, 10451636], [10451637, 11255608], [11255609, 12059580], [12059581, 12863552], [12863553, 13667524], [13667525, 14471496], [14471497, 15275468], [15275469, 16079448]] SRR7030823 file size 5427096 SRR7030823 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7030823 SRR7030823_1.fastq SRR7030823_2.fastq Input file: SRR7030823_1.fastq Paired file: SRR7030823_2.fastq trimmed: SRR7030823-trimmed-pair1.fastq, SRR7030823-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 20:38:34 2025 >> started Wed Feb 12 20:38:52 2025 >> done (17.859s) 16079448 read pairs processed; of these: 8928 ( 0.06%) short read pairs filtered out after trimming by size control 9073 ( 0.06%) empty read pairs filtered out after trimming by size control 16061447 (99.89%) read pairs available; of these: 5854195 (36.45%) trimmed read pairs available after processing 10207252 (63.55%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 2 0.00% 20 4 0.00% 21 2 0.00% 22 4 0.00% 23 5 0.00% 24 4 0.00% 25 1 0.00% 26 2 0.00% 27 4 0.00% 28 4 0.00% 29 4 0.00% 30 9 0.00% 31 6 0.00% 32 3 0.00% 33 1 0.00% 34 1 0.00% 35 2 0.00% 36 3 0.00% 37 6 0.00% 38 3 0.00% 39 4 0.00% 40 5 0.00% 41 2 0.00% 42 0 0.00% 43 5 0.00% 44 6 0.00% 45 7 0.00% 46 12 0.00% 47 9 0.00% 48 11 0.00% 49 11 0.00% 50 13 0.00% 51 15 0.00% 52 14 0.00% 53 15 0.00% 54 15 0.00% 55 16 0.00% 56 20 0.00% 57 27 0.00% 58 41 0.00% 59 32 0.00% 60 32 0.00% 61 55 0.00% 62 46 0.00% 63 48 0.00% 64 56 0.00% 65 69 0.00% 66 60 0.00% 67 78 0.00% 68 106 0.00% 69 114 0.00% 70 129 0.00% 71 143 0.00% 72 159 0.00% 73 186 0.00% 74 215 0.00% 75 238 0.00% 76 269 0.00% 77 302 0.00% 78 340 0.00% 79 400 0.00% 80 409 0.00% 81 497 0.00% 82 594 0.00% 83 720 0.00% 84 1219 0.01% 85 1593 0.01% 86 1712 0.01% 87 1859 0.01% 88 2070 0.01% 89 2128 0.01% 90 2345 0.01% 91 2558 0.02% 92 2578 0.02% 93 2880 0.02% 94 3092 0.02% 95 3379 0.02% 96 3580 0.02% 97 3933 0.02% 98 4067 0.03% 99 4500 0.03% 100 4706 0.03% 101 5131 0.03% 102 5389 0.03% 103 6063 0.04% 104 6273 0.04% 105 6865 0.04% 106 7483 0.05% 107 7959 0.05% 108 8302 0.05% 109 8802 0.05% 110 9205 0.06% 111 10438 0.06% 112 10993 0.07% 113 11811 0.07% 114 12729 0.08% 115 13604 0.08% 116 14722 0.09% 117 15328 0.10% 118 15864 0.10% 119 16733 0.10% 120 17782 0.11% 121 18618 0.12% 122 19660 0.12% 123 21031 0.13% 124 22089 0.14% 125 23356 0.15% 126 25365 0.16% 127 26309 0.16% 128 27189 0.17% 129 28884 0.18% 130 30314 0.19% 131 31911 0.20% 132 34226 0.21% 133 36393 0.23% 134 39261 0.24% 135 41376 0.26% 136 44809 0.28% 137 47865 0.30% 138 52648 0.33% 139 55773 0.35% 140 59327 0.37% 141 64660 0.40% 142 71921 0.45% 143 80255 0.50% 144 93764 0.58% 145 112640 0.70% 146 139898 0.87% 147 188084 1.17% 148 289697 1.80% 149 569555 3.55% 150 3292021 20.50% 151 10207252 63.55% 16061447 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=39 prefix-density=0.21 prefix-fanout=2.0 sequence=CGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTT criterion=fanout-score sequence-density=0.11 sequence-density-rank=18 fanout-score=358.47 fanout-score-rank=1 prefix-density=1.15 prefix-fanout=33.0 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.38 fanout-score-rank=31 prefix-density=0.32 prefix-fanout=2.2 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=110.10 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=5.9 sequence=TCCTGCTCTCGCAATCGCTGCTTCTTTGTCTGTCTTTGGGTCGATCCGAAAGAGAGGAGCTCTTCTGCGCAATCATGTTGGTCTATCAAGATCTTCTCTCTGGTGATGAGCTTCTCTC SRR7030823 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 20:39:47 Started mapping on | Feb 12 20:39:47 Finished on | Feb 12 20:41:19 Mapping speed, Million of reads per hour | 628.49 Number of input reads | 16061447 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 15218010 Uniquely mapped reads % | 94.75% Average mapped length | 297.15 Number of splices: Total | 15178809 Number of splices: Annotated (sjdb) | 14941592 Number of splices: GT/AG | 14929943 Number of splices: GC/AG | 199453 Number of splices: AT/AC | 11785 Number of splices: Non-canonical | 37628 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.78 Insertion rate per base | 0.02% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 458007 % of reads mapped to multiple loci | 2.85% Number of reads mapped to too many loci | 219413 % of reads mapped to too many loci | 1.37% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.87% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 395990 395990 395990 N_multimapping 458007 458007 458007 N_noFeature 284593 15066908 341308 N_ambiguous 176351 693 81566 UnstrandedReadsAssigned:14757066 PositiveStrandReadsAssigned:150409 NegativeStrandReadsAssigned:14795136 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7030823 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7030823-trimmed-pair1.fastq SRR7030823-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,061,447 reads, 14,917,219 reads pseudoaligned [quant] estimated average fragment length: 250.756 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,150 rounds 52401 SRR7030823.ke.tsv 34699 SRR7030823.se.tsv 87100 total ==> SRR7030823.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1768.24 1388 37.197 Potri.005G024800.1.v4.1 1035 785.244 591 35.6651 Potri.004G059700.1.v4.1 961 711.255 17 1.13262 Potri.007G009000.2.v4.1 1416 1166.24 1 0.0406323 Potri.003G141000.2.v4.1 2943 2693.24 470 8.26957 Potri.016G087400.1.v4.1 270 69.6724 1193.07 811.455 Potri.015G069301.1.v4.1 564 317.741 0 0 Potri.010G195200.1.v4.1 1773 1523.24 48 1.49325 Potri.012G127500.1.v4.1 977 727.25 7514 489.608 ==> SRR7030823.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 5 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 278 Potri.001G212900.v4.1 21 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 11 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7030823 completed mapping pipeline successfully