Starting /dee2/code/volunteer_pipeline.sh SRR7030824 current disk space = 3050867048448 free memory = 1580483616 SRR7030824 SRAfilesize 7862bd2e7c97002df922d86479a30115 SRR7030824.sra SRR7030824.sra file validated SRR7030824 is paired end SRR7030824 is conventional basespace SRR7030824 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030824_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.01175 33.0 33.0 34.0 30.0 34.0 2 32.44375 33.0 33.0 34.0 29.0 34.0 3 31.50625 33.0 31.0 33.0 28.0 34.0 4 32.219 33.0 32.0 33.0 31.0 34.0 5 32.6525 33.0 33.0 34.0 32.0 34.0 6 35.94825 38.0 36.0 38.0 33.0 38.0 7 36.91575 38.0 37.0 38.0 35.0 38.0 8 37.2565 38.0 38.0 38.0 36.0 38.0 9 37.397 38.0 38.0 38.0 37.0 38.0 10-14 37.50825 38.0 38.0 38.0 37.0 38.0 15-19 37.473749999999995 38.0 38.0 38.0 37.0 38.0 20-24 37.407399999999996 38.0 38.0 38.0 37.0 38.0 25-29 37.443200000000004 38.0 38.0 38.0 37.0 38.0 30-34 37.38535 38.0 38.0 38.0 37.0 38.0 35-39 37.300349999999995 38.0 38.0 38.0 37.0 38.0 40-44 37.2883 38.0 38.0 38.0 36.8 38.0 45-49 37.2666 38.0 38.0 38.0 36.6 38.0 50-54 37.23845 38.0 38.0 38.0 36.4 38.0 55-59 37.212450000000004 38.0 38.0 38.0 36.2 38.0 60-64 37.1041 38.0 38.0 38.0 36.0 38.0 65-69 37.047999999999995 38.0 38.0 38.0 36.0 38.0 70-74 37.03805 38.0 38.0 38.0 36.0 38.0 75-79 37.00125 38.0 38.0 38.0 35.8 38.0 80-84 36.94345 38.0 38.0 38.0 35.6 38.0 85-89 36.83624999999999 38.0 38.0 38.0 35.0 38.0 90-94 36.81555 38.0 38.0 38.0 35.0 38.0 95-99 36.5487 38.0 38.0 38.0 34.2 38.0 100-104 36.545049999999996 38.0 38.0 38.0 34.0 38.0 105-109 36.267250000000004 38.0 37.4 38.0 33.2 38.0 110-114 36.356649999999995 38.0 37.6 38.0 33.6 38.0 115-119 36.18945 38.0 37.0 38.0 33.4 38.0 120-124 35.92715 38.0 37.0 38.0 32.0 38.0 125-129 35.6175 38.0 36.0 38.0 31.0 38.0 130-134 35.2915 38.0 36.0 38.0 29.4 38.0 135-139 35.084950000000006 38.0 35.4 38.0 28.2 38.0 140-144 34.8965 38.0 35.0 38.0 28.0 38.0 145-149 34.37815 38.0 35.0 38.0 27.6 38.0 150-151 30.994625 36.5 31.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 2.0 19 1.0 20 1.0 21 5.0 22 6.0 23 3.0 24 12.0 25 10.0 26 14.0 27 11.0 28 24.0 29 37.0 30 42.0 31 51.0 32 77.0 33 98.0 34 188.0 35 283.0 36 698.0 37 2437.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.10665258711721 11.325237592397043 8.764519535374868 37.80359028511088 2 23.799999999999997 12.75 34.55 28.9 3 19.675 17.224999999999998 27.05 36.05 4 23.05 23.925 22.975 30.049999999999997 5 23.549999999999997 29.275000000000002 24.275 22.900000000000002 6 19.775000000000002 33.0 24.425 22.8 7 15.2 28.375 37.974999999999994 18.45 8 18.0 26.575 31.324999999999996 24.099999999999998 9 17.875 24.4 33.675 24.05 10-14 20.665 29.785 26.445 23.105 15-19 20.73 27.625 27.095000000000002 24.55 20-24 20.535 28.485 27.245 23.735 25-29 20.48 28.255000000000003 27.32 23.945 30-34 21.185000000000002 27.839999999999996 26.83 24.145 35-39 20.96 27.82 26.915 24.305 40-44 20.810000000000002 28.03 27.084999999999997 24.075 45-49 20.94 27.925 27.025 24.11 50-54 21.205 27.534999999999997 26.875 24.385 55-59 21.505 27.750000000000004 27.245 23.5 60-64 20.72 28.13 26.840000000000003 24.310000000000002 65-69 21.154999999999998 27.22 27.48 24.145 70-74 21.3 27.955000000000002 27.229999999999997 23.515 75-79 21.17 27.700000000000003 27.275 23.855 80-84 21.224999999999998 27.544999999999998 27.345000000000002 23.885 85-89 21.235 27.700000000000003 26.795 24.27 90-94 21.38 27.785 26.435 24.4 95-99 21.235 27.639999999999997 27.339999999999996 23.785 100-104 21.235 27.02 27.775 23.97 105-109 21.525 27.560000000000002 26.790000000000003 24.125 110-114 21.735 27.310000000000002 27.195000000000004 23.76 115-119 22.009999999999998 27.089999999999996 27.450000000000003 23.45 120-124 22.05 27.455000000000002 27.01 23.485 125-129 21.425 27.639999999999997 27.1 23.835 130-134 22.18 27.275 27.07 23.474999999999998 135-139 21.87 27.49 26.674999999999997 23.965 140-144 21.855 27.08 27.445000000000004 23.62 145-149 21.73 27.644999999999996 26.325 24.3 150-151 22.19582343378767 26.897586594973117 26.15980992872327 24.746780042515944 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 2.0 25 2.0 26 2.0 27 5.0 28 5.5 29 9.0 30 12.0 31 17.5 32 28.5 33 37.0 34 45.0 35 53.5 36 68.5 37 82.0 38 100.0 39 124.0 40 139.5 41 181.5 42 213.5 43 241.0 44 248.0 45 238.5 46 266.0 47 285.5 48 261.0 49 228.5 50 217.0 51 172.5 52 135.0 53 117.5 54 96.5 55 89.5 56 78.0 57 60.0 58 41.0 59 26.5 60 22.5 61 16.0 62 10.5 63 7.0 64 5.0 65 3.0 66 1.0 67 0.5 68 0.5 69 0.5 70 0.0 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42138364779875 98.8 2 0.5283018867924528 1.05 3 0.05031446540880503 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.0875 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.375 0.0 0.0 0.0 0.0 112-113 0.5125 0.0 0.0 0.0 0.0 114-115 0.6499999999999999 0.0 0.0 0.0 0.0 116-117 0.8999999999999999 0.0 0.0 0.0 0.0 118-119 1.1125 0.0 0.0 0.0 0.0 120-121 1.2875 0.0 0.0 0.0 0.0 122-123 1.4 0.0 0.0 0.0 0.0 124-125 1.625 0.0 0.0 0.0 0.0 126-127 1.8375 0.0 0.0 0.0 0.0 128-129 2.0 0.0 0.0 0.0 0.0 130-131 2.25 0.0 0.0 0.0 0.0 132-133 2.65 0.0 0.0 0.0 0.0 134-135 2.95 0.0 0.0 0.0 0.0 136-137 3.25 0.0 0.0 0.0 0.0 138-139 3.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATTTTT 10 0.006836113 144.9625 2 >>END_MODULE SRR7030824 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030824_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.707 33.0 33.0 34.0 32.0 34.0 2 32.86575 33.0 33.0 34.0 32.0 34.0 3 32.896 33.0 33.0 34.0 32.0 34.0 4 32.858 33.0 33.0 34.0 32.0 34.0 5 32.8075 33.0 33.0 34.0 32.0 34.0 6 37.08075 38.0 38.0 38.0 36.0 38.0 7 37.09425 38.0 38.0 38.0 36.0 38.0 8 37.0795 38.0 38.0 38.0 36.0 38.0 9 37.076 38.0 38.0 38.0 36.0 38.0 10-14 37.0755 38.0 38.0 38.0 36.0 38.0 15-19 37.0314 38.0 38.0 38.0 36.0 38.0 20-24 37.05145 38.0 38.0 38.0 36.0 38.0 25-29 36.892649999999996 38.0 38.0 38.0 35.8 38.0 30-34 36.9649 38.0 38.0 38.0 36.0 38.0 35-39 36.81115 38.0 38.0 38.0 35.4 38.0 40-44 36.8206 38.0 38.0 38.0 35.6 38.0 45-49 36.779849999999996 38.0 38.0 38.0 35.4 38.0 50-54 36.7022 38.0 38.0 38.0 35.0 38.0 55-59 36.63285 38.0 38.0 38.0 34.6 38.0 60-64 36.5934 38.0 38.0 38.0 34.6 38.0 65-69 36.5549 38.0 38.0 38.0 34.4 38.0 70-74 36.417449999999995 38.0 38.0 38.0 34.0 38.0 75-79 36.38565 38.0 38.0 38.0 34.0 38.0 80-84 36.358900000000006 38.0 38.0 38.0 34.0 38.0 85-89 36.211299999999994 38.0 37.4 38.0 33.4 38.0 90-94 36.1468 38.0 37.4 38.0 33.4 38.0 95-99 36.03675 38.0 37.0 38.0 33.2 38.0 100-104 35.6814 38.0 37.0 38.0 31.0 38.0 105-109 35.563599999999994 38.0 37.0 38.0 30.6 38.0 110-114 35.3452 38.0 36.4 38.0 29.2 38.0 115-119 35.23565 38.0 36.0 38.0 28.6 38.0 120-124 34.9384 38.0 35.8 38.0 28.0 38.0 125-129 34.691199999999995 38.0 35.0 38.0 26.6 38.0 130-134 34.285199999999996 38.0 35.0 38.0 23.6 38.0 135-139 33.78155 38.0 34.2 38.0 21.8 38.0 140-144 33.53415 38.0 34.2 38.0 21.0 38.0 145-149 32.56235 38.0 33.4 38.0 15.2 38.0 150-151 28.765749999999997 36.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 2.0 4 1.0 5 0.0 6 0.0 7 2.0 8 3.0 9 1.0 10 1.0 11 1.0 12 0.0 13 3.0 14 0.0 15 5.0 16 5.0 17 2.0 18 6.0 19 4.0 20 7.0 21 10.0 22 9.0 23 12.0 24 13.0 25 19.0 26 32.0 27 38.0 28 36.0 29 50.0 30 46.0 31 80.0 32 92.0 33 129.0 34 184.0 35 333.0 36 699.0 37 2169.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.6 21.6 13.5 31.3 2 25.632040050062578 27.459324155193993 29.336670838548184 17.571964956195245 3 19.959929877285248 29.226145755071375 29.72702228900576 21.086902078637614 4 22.02753441802253 33.09136420525657 24.680851063829788 20.200250312891114 5 24.662331165582792 34.94247123561781 22.26113056528264 18.13406703351676 6 20.125 38.574999999999996 22.175 19.125 7 19.3 23.525 37.525 19.650000000000002 8 21.0 26.424999999999997 27.525 25.05 9 22.75 25.374999999999996 27.950000000000003 23.925 10-14 22.675 29.095 25.900000000000002 22.33 15-19 22.515 28.294999999999998 26.655 22.535 20-24 22.88 29.255 26.035000000000004 21.83 25-29 22.435 28.815 26.700000000000003 22.05 30-34 22.24 28.395 27.255000000000003 22.11 35-39 22.665 28.144999999999996 27.189999999999998 22.0 40-44 22.869999999999997 28.055000000000003 27.11 21.965 45-49 23.1 28.04 26.484999999999996 22.375 50-54 22.884999999999998 27.644999999999996 27.139999999999997 22.33 55-59 23.335 26.99 27.24 22.435 60-64 22.71 27.305 27.450000000000003 22.535 65-69 22.830000000000002 27.29 27.060000000000002 22.82 70-74 22.705000000000002 27.505000000000003 27.060000000000002 22.73 75-79 23.474999999999998 27.41 26.83 22.285 80-84 22.91 27.584999999999997 27.095000000000002 22.41 85-89 23.29 27.405 26.955000000000002 22.35 90-94 23.53 27.3 26.815 22.355 95-99 23.45 27.075 26.779999999999998 22.695 100-104 23.945 26.96 27.275 21.82 105-109 23.04 27.265 26.974999999999998 22.720000000000002 110-114 23.78 27.565 27.200000000000003 21.455 115-119 24.055 27.139999999999997 26.825 21.98 120-124 23.335 27.72 26.99 21.955 125-129 23.935000000000002 26.889999999999997 27.275 21.9 130-134 24.6 27.189999999999998 26.72 21.490000000000002 135-139 24.21 27.325 26.974999999999998 21.490000000000002 140-144 24.6 27.255000000000003 26.32 21.825 145-149 24.265 28.095 26.450000000000003 21.19 150-151 25.087500000000002 26.875 27.425 20.6125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 1.0 25 1.5 26 1.5 27 3.0 28 3.0 29 3.0 30 5.5 31 12.0 32 18.5 33 27.5 34 34.0 35 46.5 36 61.5 37 80.5 38 110.5 39 152.5 40 187.5 41 202.0 42 216.5 43 240.0 44 270.0 45 286.0 46 277.0 47 260.5 48 243.0 49 235.5 50 206.0 51 158.5 52 154.0 53 127.5 54 93.5 55 76.5 56 50.0 57 35.5 58 30.5 59 28.5 60 21.0 61 12.5 62 7.5 63 6.5 64 5.0 65 2.5 66 1.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.125 3 0.17500000000000002 4 0.125 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.275 #Duplication Level Percentage of deduplicated Percentage of total 1 98.60086491986772 96.89999999999999 2 1.1956245230221318 2.35 3 0.10175527855507505 0.3 4 0.05087763927753752 0.2 5 0.05087763927753752 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTCAATCGTAAATCACAAATACATACACGTTTACTCATCAGCTCGAAAA 5 0.125 No Hit CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.037500000000000006 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.225 0.0 0.0 0.0 0.0 110-111 0.32499999999999996 0.0 0.0 0.0 0.0 112-113 0.4625 0.0 0.0 0.0 0.0 114-115 0.6000000000000001 0.0 0.0 0.0 0.0 116-117 0.8500000000000001 0.0 0.0 0.0 0.0 118-119 1.0625 0.0 0.0 0.0 0.0 120-121 1.2374999999999998 0.0 0.0 0.0 0.0 122-123 1.35 0.0 0.0 0.0 0.0 124-125 1.6 0.0 0.0 0.0 0.0 126-127 1.8125 0.0 0.0 0.0 0.0 128-129 1.975 0.0 0.0 0.0 0.0 130-131 2.25 0.0 0.0 0.0 0.0 132-133 2.65 0.0 0.0 0.0 0.0 134-135 2.95 0.0 0.0 0.0 0.0 136-137 3.275 0.0 0.0 0.0 0.0 138-139 3.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTACCA 10 0.006830828 145.0 6 CATTACC 10 0.006830828 145.0 5 >>END_MODULE Read 928437 spots for SRR7030824.sra Written 928437 spots for SRR7030824.sra Read 928437 spots for SRR7030824.sra Written 928437 spots for SRR7030824.sra Read 928437 spots for SRR7030824.sra Written 928437 spots for SRR7030824.sra Read 928437 spots for SRR7030824.sra Written 928437 spots for SRR7030824.sra Read 928437 spots for SRR7030824.sra Written 928437 spots for SRR7030824.sra Read 928437 spots for SRR7030824.sra Written 928437 spots for SRR7030824.sra Read 928437 spots for SRR7030824.sra Written 928437 spots for SRR7030824.sra Read 928437 spots for SRR7030824.sra Written 928437 spots for SRR7030824.sra Read 928437 spots for SRR7030824.sra Written 928437 spots for SRR7030824.sra Read 928437 spots for SRR7030824.sra Written 928437 spots for SRR7030824.sra Read 928437 spots for SRR7030824.sra Written 928437 spots for SRR7030824.sra Read 928437 spots for SRR7030824.sra Written 928437 spots for SRR7030824.sra Read 928437 spots for SRR7030824.sra Written 928437 spots for SRR7030824.sra Read 928437 spots for SRR7030824.sra Written 928437 spots for SRR7030824.sra Read 928437 spots for SRR7030824.sra Written 928437 spots for SRR7030824.sra Read 928437 spots for SRR7030824.sra Written 928437 spots for SRR7030824.sra Read 928448 spots for SRR7030824.sra Written 928448 spots for SRR7030824.sra Read 928437 spots for SRR7030824.sra Written 928437 spots for SRR7030824.sra Read 928437 spots for SRR7030824.sra Written 928437 spots for SRR7030824.sra Read 928437 spots for SRR7030824.sra Written 928437 spots for SRR7030824.sra SRR ids: ['SRR7030824.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_y0xjo4cj SRR7030824.sra spots: 18568751 blocks: [[1, 928437], [928438, 1856874], [1856875, 2785311], [2785312, 3713748], [3713749, 4642185], [4642186, 5570622], [5570623, 6499059], [6499060, 7427496], [7427497, 8355933], [8355934, 9284370], [9284371, 10212807], [10212808, 11141244], [11141245, 12069681], [12069682, 12998118], [12998119, 13926555], [13926556, 14854992], [14854993, 15783429], [15783430, 16711866], [16711867, 17640303], [17640304, 18568751]] SRR7030824 file size 6270640 SRR7030824 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7030824 SRR7030824_1.fastq SRR7030824_2.fastq Input file: SRR7030824_1.fastq Paired file: SRR7030824_2.fastq trimmed: SRR7030824-trimmed-pair1.fastq, SRR7030824-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 20:43:47 2025 >> started Wed Feb 12 20:44:07 2025 >> done (20.542s) 18568751 read pairs processed; of these: 12240 ( 0.07%) short read pairs filtered out after trimming by size control 11087 ( 0.06%) empty read pairs filtered out after trimming by size control 18545424 (99.87%) read pairs available; of these: 7202782 (38.84%) trimmed read pairs available after processing 11342642 (61.16%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 6 0.00% 21 4 0.00% 22 2 0.00% 23 4 0.00% 24 4 0.00% 25 5 0.00% 26 4 0.00% 27 3 0.00% 28 5 0.00% 29 2 0.00% 30 6 0.00% 31 2 0.00% 32 4 0.00% 33 3 0.00% 34 4 0.00% 35 7 0.00% 36 5 0.00% 37 5 0.00% 38 6 0.00% 39 6 0.00% 40 7 0.00% 41 3 0.00% 42 6 0.00% 43 9 0.00% 44 9 0.00% 45 13 0.00% 46 13 0.00% 47 14 0.00% 48 13 0.00% 49 15 0.00% 50 11 0.00% 51 21 0.00% 52 15 0.00% 53 16 0.00% 54 22 0.00% 55 23 0.00% 56 30 0.00% 57 21 0.00% 58 40 0.00% 59 36 0.00% 60 56 0.00% 61 62 0.00% 62 54 0.00% 63 67 0.00% 64 81 0.00% 65 86 0.00% 66 95 0.00% 67 97 0.00% 68 131 0.00% 69 115 0.00% 70 147 0.00% 71 168 0.00% 72 196 0.00% 73 215 0.00% 74 290 0.00% 75 288 0.00% 76 323 0.00% 77 333 0.00% 78 385 0.00% 79 443 0.00% 80 516 0.00% 81 571 0.00% 82 736 0.00% 83 788 0.00% 84 1537 0.01% 85 2076 0.01% 86 2234 0.01% 87 2360 0.01% 88 2567 0.01% 89 2625 0.01% 90 2766 0.01% 91 2864 0.02% 92 3134 0.02% 93 3265 0.02% 94 3535 0.02% 95 3842 0.02% 96 4243 0.02% 97 4433 0.02% 98 4662 0.03% 99 4989 0.03% 100 5543 0.03% 101 5938 0.03% 102 6455 0.03% 103 6952 0.04% 104 7551 0.04% 105 8121 0.04% 106 8767 0.05% 107 9310 0.05% 108 9909 0.05% 109 10575 0.06% 110 11212 0.06% 111 11818 0.06% 112 12855 0.07% 113 13893 0.07% 114 14923 0.08% 115 16185 0.09% 116 16991 0.09% 117 18423 0.10% 118 19210 0.10% 119 20506 0.11% 120 21556 0.12% 121 22880 0.12% 122 24307 0.13% 123 25567 0.14% 124 27310 0.15% 125 29078 0.16% 126 30500 0.16% 127 32008 0.17% 128 34078 0.18% 129 35832 0.19% 130 37880 0.20% 131 40012 0.22% 132 42571 0.23% 133 46065 0.25% 134 48949 0.26% 135 52531 0.28% 136 56244 0.30% 137 60490 0.33% 138 65297 0.35% 139 71865 0.39% 140 76380 0.41% 141 82829 0.45% 142 92439 0.50% 143 104264 0.56% 144 121101 0.65% 145 145529 0.78% 146 184495 0.99% 147 249457 1.35% 148 381929 2.06% 149 772170 4.16% 150 3894230 21.00% 151 11342642 61.16% 18545424 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=4.33 fanout-score-rank=24 prefix-density=0.43 prefix-fanout=3.5 sequence=TGAGCTTCACCGCCTTTCCGGCTAGCGAAGGGGACGAGAGGGCCATTGTTGCTGCTGCCATT criterion=fanout-score sequence-density=0.02 sequence-density-rank=39 fanout-score=74.97 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=12.2 sequence=CTTCAAAAAACCAATAAAAAAAGGAAAAGCAACGATCTTTTTGCCAGAGCCCAGGTACAATTTGAACAAAGCAACCCTAACAGATAGCTAGGGACTCATCAAATCTTGGAACCTAGACACCCTTCGGCTTGGAGGCGATAAAACTGATGCACTGCACTTGACGAGTGTTGTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGGGACTGGTGGTGCTCGCGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTGTTGCGAAGAAGGTACTCAATTTCCTGGGCCAATTGCTCAGTAGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGGAGGCCACACCTGCATGCATTGAACTCTTCCGCCATTGCTTGC criterion=sequence-density sequence-density=0.85 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=39 prefix-density=0.87 prefix-fanout=2.1 sequence=GCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGCTAACAATGACATTACTTCCATTGCAAGCAATGGCGGAAGAGTTCAATGCATGCAGGTGTGGCCTCCAACTGGATTGAAGAAGTTCGAGACTCTTTCTTACCTTCCAGATCTCACTACTGAGCAATTGGCCCAGGAAATTGAGTACCTTCTTCGCAACAAGTGGGTTCCTTGCTTGGAATTCGAGTTGGAGAAAGGTTGGGTCTACCGCGAGCACCACCAGTCCCCAGGGTACTATGATGGACGCTACTGGACTATGTGGAAACTACCCATGTTTGGATGCACTGAGGCATCTCAGGTGCTGATTGAGCTCGAGGAGGCGAAGAAAGCTTACCCTAACTCCTTTATCCGTATCATTGGATTCGACAACACTCGTCAAGTGCAGTGCATCAGTTTTATCGCCTCCAAGCCGAAGGGTGTCTAGGTTCCAAGATTTGATGAGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=70.41 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=7.1 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACC SRR7030824 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 20:44:49 Started mapping on | Feb 12 20:44:50 Finished on | Feb 12 20:46:33 Mapping speed, Million of reads per hour | 648.19 Number of input reads | 18545424 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 17591277 Uniquely mapped reads % | 94.86% Average mapped length | 296.93 Number of splices: Total | 17211891 Number of splices: Annotated (sjdb) | 17013545 Number of splices: GT/AG | 16907086 Number of splices: GC/AG | 257403 Number of splices: AT/AC | 12698 Number of splices: Non-canonical | 34704 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.78 Insertion rate per base | 0.02% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 652963 % of reads mapped to multiple loci | 3.52% Number of reads mapped to too many loci | 137632 % of reads mapped to too many loci | 0.74% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.75% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 315185 315185 315185 N_multimapping 652963 652963 652963 N_noFeature 208790 17415668 268416 N_ambiguous 223323 538 106972 UnstrandedReadsAssigned:17159164 PositiveStrandReadsAssigned:175071 NegativeStrandReadsAssigned:17215889 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7030824 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7030824-trimmed-pair1.fastq SRR7030824-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,545,424 reads, 17,441,724 reads pseudoaligned [quant] estimated average fragment length: 250.364 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,020 rounds 52401 SRR7030824.ke.tsv 34699 SRR7030824.se.tsv 87100 total ==> SRR7030824.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1768.64 1175 25.5739 Potri.005G024800.1.v4.1 1035 785.636 478 23.4209 Potri.004G059700.1.v4.1 961 711.668 23 1.24408 Potri.007G009000.2.v4.1 1416 1166.64 0 0 Potri.003G141000.2.v4.1 2943 2693.64 358 5.11612 Potri.016G087400.1.v4.1 270 70.1855 1474.67 808.806 Potri.015G069301.1.v4.1 564 317.87 0 0 Potri.010G195200.1.v4.1 1773 1523.64 11 0.277913 Potri.012G127500.1.v4.1 977 727.643 4443 235.047 ==> SRR7030824.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 22 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 405 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 9 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 0 SRR7030824 completed mapping pipeline successfully