Starting /dee2/code/volunteer_pipeline.sh SRR7030825 current disk space = 3050935820288 free memory = 1472335460 SRR7030825 SRAfilesize 9cf6dcad9d3bd936cc7b18b851098d42 SRR7030825.sra SRR7030825.sra file validated SRR7030825 is paired end SRR7030825 is conventional basespace SRR7030825 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030825_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.559 28.0 18.0 31.0 18.0 33.0 2 31.42175 32.0 32.0 33.0 27.0 33.0 3 31.842 33.0 32.0 33.0 28.0 33.0 4 32.2535 33.0 33.0 33.0 31.0 34.0 5 32.50175 33.0 33.0 33.0 32.0 34.0 6 36.5155 38.0 37.0 38.0 34.0 38.0 7 37.063 38.0 38.0 38.0 36.0 38.0 8 37.1115 38.0 38.0 38.0 36.0 38.0 9 37.39125 38.0 38.0 38.0 37.0 38.0 10-14 37.4508 38.0 38.0 38.0 37.0 38.0 15-19 37.49005 38.0 38.0 38.0 37.0 38.0 20-24 37.4465 38.0 38.0 38.0 37.0 38.0 25-29 37.3521 38.0 38.0 38.0 37.0 38.0 30-34 37.29344999999999 38.0 38.0 38.0 37.0 38.0 35-39 37.27375 38.0 38.0 38.0 37.0 38.0 40-44 37.288650000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.24485 38.0 38.0 38.0 36.8 38.0 50-54 37.2556 38.0 38.0 38.0 36.8 38.0 55-59 37.16155 38.0 38.0 38.0 36.0 38.0 60-64 37.0763 38.0 38.0 38.0 36.0 38.0 65-69 36.957550000000005 38.0 38.0 38.0 36.0 38.0 70-74 36.913050000000005 38.0 38.0 38.0 35.4 38.0 75-79 36.814499999999995 38.0 38.0 38.0 35.0 38.0 80-84 36.79305000000001 38.0 38.0 38.0 35.0 38.0 85-89 36.67535 38.0 38.0 38.0 34.4 38.0 90-94 36.60360000000001 38.0 38.0 38.0 34.2 38.0 95-99 36.32115 38.0 37.6 38.0 33.4 38.0 100-104 36.1914 38.0 37.6 38.0 33.6 38.0 105-109 36.00614999999999 38.0 37.0 38.0 32.6 38.0 110-114 36.03745 38.0 37.0 38.0 33.0 38.0 115-119 35.85355 38.0 37.0 38.0 31.8 38.0 120-124 35.81415 38.0 37.0 38.0 31.4 38.0 125-129 35.636250000000004 38.0 36.4 38.0 31.0 38.0 130-134 35.183949999999996 38.0 36.0 38.0 28.4 38.0 135-139 34.843849999999996 38.0 35.2 38.0 27.8 38.0 140-144 34.498749999999994 38.0 35.0 38.0 26.2 38.0 145-149 34.09425 38.0 35.0 38.0 24.6 38.0 150-151 30.641625 36.5 29.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 1.0 7 1.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 2.0 14 0.0 15 0.0 16 2.0 17 3.0 18 0.0 19 1.0 20 3.0 21 5.0 22 3.0 23 8.0 24 5.0 25 6.0 26 14.0 27 19.0 28 30.0 29 37.0 30 65.0 31 52.0 32 73.0 33 122.0 34 192.0 35 320.0 36 706.0 37 2328.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.48507071765322 11.236249345206915 12.467260345730748 39.81141959140911 2 21.75 15.225 35.3 27.725 3 19.025 19.400000000000002 27.800000000000004 33.775 4 22.45 26.325 24.8 26.424999999999997 5 22.85 31.1 24.25 21.8 6 17.375 35.675000000000004 26.450000000000003 20.5 7 15.6 25.75 41.175 17.474999999999998 8 18.375 26.325 31.175000000000004 24.125 9 17.4 24.3 34.449999999999996 23.849999999999998 10-14 20.02 29.195 27.485 23.3 15-19 20.23 28.044999999999998 28.215 23.51 20-24 19.93 28.43 27.779999999999998 23.86 25-29 19.625981299064954 29.24146207310366 27.76638831941597 23.36616830841542 30-34 19.7 28.599999999999998 27.74 23.96 35-39 20.145 28.849999999999998 27.525 23.48 40-44 19.869999999999997 29.060000000000002 27.834999999999997 23.235 45-49 20.555 28.23 27.71 23.505000000000003 50-54 20.405 28.54 27.615000000000002 23.44 55-59 19.725 28.675 27.634999999999998 23.965 60-64 20.015 28.52 27.700000000000003 23.765 65-69 19.42 28.560000000000002 27.965 24.055 70-74 19.939999999999998 29.154999999999998 27.189999999999998 23.715 75-79 19.88 28.15 28.305000000000003 23.665 80-84 19.865 28.27 27.400000000000002 24.465 85-89 20.150000000000002 28.38 27.71 23.76 90-94 20.49 28.655 27.155 23.7 95-99 20.5 28.939999999999998 27.12 23.44 100-104 19.935 28.34 27.894999999999996 23.830000000000002 105-109 20.25 27.765 27.644999999999996 24.34 110-114 20.115 28.575 27.715 23.595 115-119 20.185 28.115000000000002 27.82 23.880000000000003 120-124 20.36 28.535 27.47 23.635 125-129 19.85 28.1 28.275 23.775 130-134 20.395 28.49 27.439999999999998 23.674999999999997 135-139 20.95 28.599999999999998 27.12 23.330000000000002 140-144 20.685000000000002 27.855 27.694999999999997 23.765 145-149 20.830000000000002 28.439999999999998 27.555000000000003 23.175 150-151 20.8625 28.7 26.924999999999997 23.5125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 1.0 19 1.5 20 1.5 21 2.5 22 1.5 23 0.5 24 3.0 25 4.5 26 4.0 27 5.5 28 7.5 29 12.5 30 20.5 31 27.0 32 32.0 33 40.5 34 56.0 35 68.0 36 80.5 37 96.0 38 130.0 39 164.0 40 193.0 41 233.0 42 258.5 43 271.5 44 277.5 45 275.5 46 265.0 47 244.0 48 218.0 49 199.0 50 174.5 51 137.5 52 113.5 53 99.0 54 62.5 55 46.0 56 48.5 57 36.0 58 23.5 59 15.5 60 11.0 61 8.5 62 8.5 63 6.0 64 4.0 65 2.5 66 2.0 67 2.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.55 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.005 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72417251755266 99.425 2 0.25075225677031093 0.5 3 0.025075225677031094 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0125 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.0875 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.425 0.0 0.0 0.0 0.0 110-111 0.5375 0.0 0.0 0.0 0.0 112-113 0.6499999999999999 0.0 0.0 0.0 0.0 114-115 0.725 0.0 0.0 0.0 0.0 116-117 0.775 0.0 0.0 0.0 0.0 118-119 0.825 0.0 0.0 0.0 0.0 120-121 0.85 0.0 0.0 0.0 0.0 122-123 1.0125 0.0 0.0 0.0 0.0 124-125 1.1375000000000002 0.0 0.0 0.0 0.0 126-127 1.35 0.0 0.0 0.0 0.0 128-129 1.6 0.0 0.0 0.0 0.0 130-131 1.75 0.0 0.0 0.0 0.0 132-133 1.8624999999999998 0.0 0.0 0.0 0.0 134-135 2.1375 0.0 0.0 0.0 0.0 136-137 2.2625 0.0 0.0 0.0 0.0 138-139 2.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGGATC 10 0.0068378756 144.95 2 >>END_MODULE SRR7030825 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030825_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.54325 33.0 33.0 34.0 32.0 34.0 2 32.7195 33.0 33.0 34.0 32.0 34.0 3 32.78575 33.0 33.0 34.0 32.0 34.0 4 32.71575 33.0 33.0 34.0 32.0 34.0 5 32.753 33.0 33.0 34.0 32.0 34.0 6 36.86325 38.0 38.0 38.0 36.0 38.0 7 37.03225 38.0 38.0 38.0 36.0 38.0 8 37.06975 38.0 38.0 38.0 36.0 38.0 9 37.0245 38.0 38.0 38.0 36.0 38.0 10-14 37.05565 38.0 38.0 38.0 36.0 38.0 15-19 37.112449999999995 38.0 38.0 38.0 36.0 38.0 20-24 37.0244 38.0 38.0 38.0 36.0 38.0 25-29 36.8069 38.0 38.0 38.0 35.2 38.0 30-34 36.9091 38.0 38.0 38.0 36.0 38.0 35-39 36.81325 38.0 38.0 38.0 35.6 38.0 40-44 36.6507 38.0 38.0 38.0 34.8 38.0 45-49 36.5154 38.0 38.0 38.0 34.0 38.0 50-54 36.609 38.0 38.0 38.0 34.6 38.0 55-59 36.569900000000004 38.0 38.0 38.0 34.4 38.0 60-64 36.5527 38.0 38.0 38.0 34.2 38.0 65-69 36.31545 38.0 38.0 38.0 33.8 38.0 70-74 36.32695 38.0 38.0 38.0 33.8 38.0 75-79 36.2126 38.0 37.6 38.0 33.4 38.0 80-84 36.241200000000006 38.0 37.2 38.0 33.4 38.0 85-89 35.915549999999996 38.0 37.0 38.0 31.8 38.0 90-94 35.8241 38.0 37.0 38.0 31.2 38.0 95-99 35.6171 38.0 36.8 38.0 30.4 38.0 100-104 35.06145 38.0 36.2 38.0 27.8 38.0 105-109 35.080149999999996 38.0 36.0 38.0 28.4 38.0 110-114 35.0697 38.0 36.0 38.0 28.0 38.0 115-119 34.6439 38.0 35.2 38.0 25.2 38.0 120-124 34.37065 38.0 35.0 38.0 23.8 38.0 125-129 34.2757 38.0 34.8 38.0 23.2 38.0 130-134 33.60915 38.0 34.0 38.0 21.8 38.0 135-139 33.243750000000006 38.0 34.0 38.0 16.2 38.0 140-144 32.71079999999999 38.0 33.2 38.0 14.2 38.0 145-149 31.910450000000004 37.8 33.0 38.0 11.4 38.0 150-151 27.676875 35.0 17.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 2.0 4 3.0 5 3.0 6 2.0 7 1.0 8 1.0 9 1.0 10 0.0 11 0.0 12 2.0 13 1.0 14 2.0 15 3.0 16 6.0 17 2.0 18 4.0 19 7.0 20 7.0 21 13.0 22 10.0 23 16.0 24 20.0 25 28.0 26 29.0 27 30.0 28 33.0 29 59.0 30 80.0 31 85.0 32 129.0 33 148.0 34 212.0 35 391.0 36 812.0 37 1856.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.75106329747311 21.391043282461847 14.21065799349512 29.647235426569928 2 25.894420815611706 26.51988991743808 31.298473855391546 16.28721541155867 3 20.845845845845844 27.05205205205205 31.48148148148148 20.62062062062062 4 21.74130597948461 35.30147610708031 24.74355766825119 18.21366024518389 5 25.093820365273956 36.527395546659996 21.94145609206905 16.437327995997 6 20.41531148361271 38.37878408806605 23.267450587940957 17.938453840380287 7 20.424999999999997 22.025 39.45 18.099999999999998 8 21.224999999999998 25.825 28.199999999999996 24.75 9 23.3 25.6 29.175 21.925 10-14 22.45 29.220000000000002 27.04 21.29 15-19 23.405 27.725 27.810000000000002 21.060000000000002 20-24 23.06 28.470000000000002 27.860000000000003 20.61 25-29 22.67 28.685 27.644999999999996 21.0 30-34 23.01 28.21 28.575 20.205000000000002 35-39 22.58 28.105000000000004 28.49 20.825 40-44 23.41 28.42 27.794999999999998 20.375 45-49 23.385 28.494999999999997 28.24 19.88 50-54 23.189999999999998 27.650000000000002 28.875 20.285 55-59 23.189999999999998 26.590000000000003 29.635 20.585 60-64 22.48 27.58 28.970000000000002 20.97 65-69 23.125 27.939999999999998 28.199999999999996 20.735 70-74 23.599999999999998 27.47 28.075 20.855 75-79 23.235 28.03 28.205000000000002 20.53 80-84 23.77 27.889999999999997 27.744999999999997 20.595 85-89 24.065 27.985 27.435 20.515 90-94 23.625 27.975 27.925 20.474999999999998 95-99 23.985 27.779999999999998 27.505000000000003 20.73 100-104 22.935 28.49 27.644999999999996 20.93 105-109 23.89 27.845 27.905 20.36 110-114 23.26 28.16 27.894999999999996 20.685000000000002 115-119 23.5 27.384999999999998 28.76 20.355 120-124 23.46 28.175 28.18 20.185 125-129 23.225 28.095 28.165000000000003 20.515 130-134 24.11 28.4 27.765 19.725 135-139 24.055 28.035 27.76 20.150000000000002 140-144 23.995 27.845 28.185 19.975 145-149 24.46 27.865000000000002 27.639999999999997 20.035 150-151 24.95 28.1375 26.974999999999998 19.9375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 1.5 23 1.5 24 1.0 25 5.0 26 9.0 27 7.5 28 7.5 29 11.0 30 16.0 31 21.5 32 30.5 33 46.5 34 54.5 35 69.0 36 79.5 37 112.0 38 146.5 39 171.0 40 210.5 41 225.5 42 252.5 43 260.0 44 259.5 45 283.0 46 280.0 47 258.0 48 223.0 49 191.5 50 164.5 51 132.5 52 115.0 53 95.5 54 64.5 55 49.5 56 37.0 57 20.5 58 20.5 59 20.0 60 12.5 61 6.0 62 4.5 63 5.0 64 4.5 65 3.0 66 1.5 67 2.0 68 2.5 69 1.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.075 3 0.1 4 0.075 5 0.075 6 0.075 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42152917505031 98.825 2 0.5533199195171026 1.0999999999999999 3 0.025150905432595575 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0125 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.07500000000000001 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.1875 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.4 0.0 0.0 0.0 0.0 110-111 0.5125 0.0 0.0 0.0 0.0 112-113 0.625 0.0 0.0 0.0 0.0 114-115 0.75 0.0 0.0 0.0 0.0 116-117 0.8 0.0 0.0 0.0 0.0 118-119 0.85 0.0 0.0 0.0 0.0 120-121 0.875 0.0 0.0 0.0 0.0 122-123 1.0375 0.0 0.0 0.0 0.0 124-125 1.15 0.0 0.0 0.0 0.0 126-127 1.325 0.0 0.0 0.0 0.0 128-129 1.6 0.0 0.0 0.0 0.0 130-131 1.75 0.0 0.0 0.0 0.0 132-133 1.8624999999999998 0.0 0.0 0.0 0.0 134-135 2.1375 0.0 0.0 0.0 0.0 136-137 2.2625 0.0 0.0 0.0 0.0 138-139 2.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1086228 spots for SRR7030825.sra Written 1086228 spots for SRR7030825.sra Read 1086228 spots for SRR7030825.sra Written 1086228 spots for SRR7030825.sra Read 1086228 spots for SRR7030825.sra Written 1086228 spots for SRR7030825.sra Read 1086228 spots for SRR7030825.sra Written 1086228 spots for SRR7030825.sra Read 1086228 spots for SRR7030825.sra Written 1086228 spots for SRR7030825.sra Read 1086228 spots for SRR7030825.sra Written 1086228 spots for SRR7030825.sra Read 1086228 spots for SRR7030825.sra Written 1086228 spots for SRR7030825.sra Read 1086228 spots for SRR7030825.sra Written 1086228 spots for SRR7030825.sra Read 1086228 spots for SRR7030825.sra Written 1086228 spots for SRR7030825.sra Read 1086228 spots for SRR7030825.sra Written 1086228 spots for SRR7030825.sra Read 1086228 spots for SRR7030825.sra Written 1086228 spots for SRR7030825.sra Read 1086228 spots for SRR7030825.sra Written 1086228 spots for SRR7030825.sra Read 1086228 spots for SRR7030825.sra Written 1086228 spots for SRR7030825.sra Read 1086228 spots for SRR7030825.sra Written 1086228 spots for SRR7030825.sra Read 1086228 spots for SRR7030825.sra Written 1086228 spots for SRR7030825.sra Read 1086228 spots for SRR7030825.sra Written 1086228 spots for SRR7030825.sra Read 1086228 spots for SRR7030825.sra Written 1086228 spots for SRR7030825.sra Read 1086228 spots for SRR7030825.sra Written 1086228 spots for SRR7030825.sra Read 1086242 spots for SRR7030825.sra Written 1086242 spots for SRR7030825.sra Read 1086228 spots for SRR7030825.sra Written 1086228 spots for SRR7030825.sra SRR ids: ['SRR7030825.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wlqyrh0v SRR7030825.sra spots: 21724574 blocks: [[1, 1086228], [1086229, 2172456], [2172457, 3258684], [3258685, 4344912], [4344913, 5431140], [5431141, 6517368], [6517369, 7603596], [7603597, 8689824], [8689825, 9776052], [9776053, 10862280], [10862281, 11948508], [11948509, 13034736], [13034737, 14120964], [14120965, 15207192], [15207193, 16293420], [16293421, 17379648], [17379649, 18465876], [18465877, 19552104], [19552105, 20638332], [20638333, 21724574]] SRR7030825 file size 7340044 SRR7030825 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7030825 SRR7030825_1.fastq SRR7030825_2.fastq Input file: SRR7030825_1.fastq Paired file: SRR7030825_2.fastq trimmed: SRR7030825-trimmed-pair1.fastq, SRR7030825-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 20:40:30 2025 >> started Wed Feb 12 20:40:58 2025 >> done (28.155s) 21724574 read pairs processed; of these: 16838 ( 0.08%) short read pairs filtered out after trimming by size control 19311 ( 0.09%) empty read pairs filtered out after trimming by size control 21688425 (99.83%) read pairs available; of these: 8712996 (40.17%) trimmed read pairs available after processing 12975429 (59.83%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 4 0.00% 20 1 0.00% 21 6 0.00% 22 8 0.00% 23 5 0.00% 24 3 0.00% 25 4 0.00% 26 7 0.00% 27 3 0.00% 28 5 0.00% 29 7 0.00% 30 7 0.00% 31 9 0.00% 32 6 0.00% 33 9 0.00% 34 4 0.00% 35 8 0.00% 36 11 0.00% 37 7 0.00% 38 11 0.00% 39 7 0.00% 40 5 0.00% 41 7 0.00% 42 12 0.00% 43 13 0.00% 44 7 0.00% 45 10 0.00% 46 15 0.00% 47 14 0.00% 48 18 0.00% 49 26 0.00% 50 21 0.00% 51 28 0.00% 52 30 0.00% 53 29 0.00% 54 24 0.00% 55 28 0.00% 56 43 0.00% 57 51 0.00% 58 53 0.00% 59 63 0.00% 60 66 0.00% 61 92 0.00% 62 90 0.00% 63 103 0.00% 64 108 0.00% 65 120 0.00% 66 103 0.00% 67 149 0.00% 68 166 0.00% 69 164 0.00% 70 219 0.00% 71 263 0.00% 72 324 0.00% 73 352 0.00% 74 377 0.00% 75 433 0.00% 76 496 0.00% 77 548 0.00% 78 549 0.00% 79 621 0.00% 80 776 0.00% 81 892 0.00% 82 1113 0.01% 83 1280 0.01% 84 2022 0.01% 85 2791 0.01% 86 2879 0.01% 87 3039 0.01% 88 3346 0.02% 89 3368 0.02% 90 3621 0.02% 91 3784 0.02% 92 4196 0.02% 93 4599 0.02% 94 4858 0.02% 95 5236 0.02% 96 5528 0.03% 97 5792 0.03% 98 6297 0.03% 99 6705 0.03% 100 7143 0.03% 101 7799 0.04% 102 8296 0.04% 103 9033 0.04% 104 9648 0.04% 105 10310 0.05% 106 11015 0.05% 107 11406 0.05% 108 12262 0.06% 109 12682 0.06% 110 13571 0.06% 111 14820 0.07% 112 15930 0.07% 113 16926 0.08% 114 18249 0.08% 115 19566 0.09% 116 20703 0.10% 117 21622 0.10% 118 22891 0.11% 119 23644 0.11% 120 24726 0.11% 121 26311 0.12% 122 27940 0.13% 123 29679 0.14% 124 31514 0.15% 125 33123 0.15% 126 34874 0.16% 127 37023 0.17% 128 38965 0.18% 129 41393 0.19% 130 43801 0.20% 131 46221 0.21% 132 49503 0.23% 133 53071 0.24% 134 56855 0.26% 135 61072 0.28% 136 66513 0.31% 137 71057 0.33% 138 78267 0.36% 139 85370 0.39% 140 91876 0.42% 141 100467 0.46% 142 112439 0.52% 143 128542 0.59% 144 151673 0.70% 145 181831 0.84% 146 230492 1.06% 147 316349 1.46% 148 476645 2.20% 149 933205 4.30% 150 4686584 21.61% 151 12975429 59.83% 21688425 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=5.81 fanout-score-rank=21 prefix-density=0.23 prefix-fanout=5.0 sequence=AACATCTGAATTGCATATGATACGGCTGGAAGTGACCGCAAAGTCATTCGAAGCGGCTCCGATGATATAACGATCACCAGTTCTAACCTCATCACCGAAGACATCGATCACTGCTTCAGCATGAACGGCACGAGGAAATATTGAAGTTGCCGTGAAGGCAAAGAGAAGAAAGGAGAGCACTAGAAAGTTAGT criterion=fanout-score sequence-density=0.03 sequence-density-rank=34 fanout-score=137.32 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=15.6 sequence=AAACAAGAATTTTATTGTTTCCTGTCACACCAAGGCAAACCAAACCAGTCTTCTTTTATGCACCCATACGGATAATACACCTCAGGCCAGCTCCACTAAGCATGTACTCGAAAGCCTTGTTGATTTCTGAGAAAGGGACTTCATGGGTGATGAATTTCTCTAGCTCCAGCTCCTTGTTCATGTACTTCTCGACAACTGAAGGAAGGTCGGAGCGCGGTTTGTAGTT criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.86 fanout-score-rank=29 prefix-density=0.25 prefix-fanout=2.8 sequence=ACTAACTTTCTAGTGCTCTCCTTTCTTCTCTTTGCCTTCACGGCAACTTCAATATTTCCTCGTGCCGTTCATGCTGAAGCAGTGATCGATGTCTTCGGTGATGAGGTTAGAACTGGTGATCGTTATATCATCGGAGCCGCTTCGAATGACTTTGCGGTCACTTCCAGCCGTATCATATGCAATTCAGATGTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=126.55 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=7.5 sequence=AAGCAACAAACCTTAGCCTTCACAAACTTTCTCTATAACCTTGCCTATCCTTGATTCTTAACCCTCCGATCAAACTACTTACCCCCCC SRR7030825 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 20:41:59 Started mapping on | Feb 12 20:41:59 Finished on | Feb 12 20:44:15 Mapping speed, Million of reads per hour | 574.11 Number of input reads | 21688425 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 20710369 Uniquely mapped reads % | 95.49% Average mapped length | 296.60 Number of splices: Total | 18580492 Number of splices: Annotated (sjdb) | 18184399 Number of splices: GT/AG | 18295443 Number of splices: GC/AG | 211802 Number of splices: AT/AC | 13141 Number of splices: Non-canonical | 60106 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.82 Insertion rate per base | 0.03% Insertion average length | 2.79 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 634939 % of reads mapped to multiple loci | 2.93% Number of reads mapped to too many loci | 89768 % of reads mapped to too many loci | 0.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.11% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 360470 360470 360470 N_multimapping 634939 634939 634939 N_noFeature 618474 20484653 735411 N_ambiguous 221351 1760 111809 UnstrandedReadsAssigned:19870544 PositiveStrandReadsAssigned:223956 NegativeStrandReadsAssigned:19863149 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7030825 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7030825-trimmed-pair1.fastq SRR7030825-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,688,425 reads, 19,842,874 reads pseudoaligned [quant] estimated average fragment length: 260.751 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,077 rounds 52401 SRR7030825.ke.tsv 34699 SRR7030825.se.tsv 87100 total ==> SRR7030825.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1758.25 3075 73.666 Potri.005G024800.1.v4.1 1035 775.249 1744 94.7562 Potri.004G059700.1.v4.1 961 701.266 58 3.48375 Potri.007G009000.2.v4.1 1416 1156.25 0 0 Potri.003G141000.2.v4.1 2943 2683.25 895 14.0496 Potri.016G087400.1.v4.1 270 68.4417 1386.18 853.106 Potri.015G069301.1.v4.1 564 309.155 0 0 Potri.010G195200.1.v4.1 1773 1513.25 431.872 12.0212 Potri.012G127500.1.v4.1 977 717.255 9074 532.878 ==> SRR7030825.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 19 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 197 Potri.001G212900.v4.1 138 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 118 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 15 SRR7030825 completed mapping pipeline successfully