Starting /dee2/code/volunteer_pipeline.sh SRR7030826 current disk space = 3050861727744 free memory = 1581665164 SRR7030826 SRAfilesize ef6f137ff330db30a433bf0e3069eff8 SRR7030826.sra SRR7030826.sra file validated SRR7030826 is paired end SRR7030826 is conventional basespace SRR7030826 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030826_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.05825 33.0 33.0 34.0 30.0 34.0 2 32.4835 33.0 33.0 34.0 29.0 34.0 3 31.2765 33.0 31.0 33.0 27.0 34.0 4 32.26575 33.0 32.0 33.0 31.0 34.0 5 32.158 33.0 32.0 33.0 31.0 34.0 6 36.517 38.0 37.0 38.0 34.0 38.0 7 37.16025 38.0 38.0 38.0 36.0 38.0 8 37.2225 38.0 38.0 38.0 36.0 38.0 9 37.4205 38.0 38.0 38.0 37.0 38.0 10-14 37.479949999999995 38.0 38.0 38.0 37.0 38.0 15-19 37.4777 38.0 38.0 38.0 37.0 38.0 20-24 37.435249999999996 38.0 38.0 38.0 37.0 38.0 25-29 37.39465 38.0 38.0 38.0 37.0 38.0 30-34 37.31795 38.0 38.0 38.0 37.0 38.0 35-39 37.322799999999994 38.0 38.0 38.0 37.0 38.0 40-44 37.2252 38.0 38.0 38.0 36.8 38.0 45-49 37.21155 38.0 38.0 38.0 36.2 38.0 50-54 37.242 38.0 38.0 38.0 36.6 38.0 55-59 37.19735 38.0 38.0 38.0 36.2 38.0 60-64 37.1328 38.0 38.0 38.0 36.0 38.0 65-69 37.0846 38.0 38.0 38.0 36.0 38.0 70-74 37.0137 38.0 38.0 38.0 35.8 38.0 75-79 37.0067 38.0 38.0 38.0 36.0 38.0 80-84 36.87610000000001 38.0 38.0 38.0 35.2 38.0 85-89 36.77635 38.0 38.0 38.0 35.0 38.0 90-94 36.75075 38.0 38.0 38.0 34.6 38.0 95-99 36.519999999999996 38.0 38.0 38.0 34.2 38.0 100-104 36.48819999999999 38.0 38.0 38.0 34.0 38.0 105-109 36.2151 38.0 37.4 38.0 33.2 38.0 110-114 36.38725 38.0 37.8 38.0 33.8 38.0 115-119 36.1346 38.0 37.4 38.0 33.4 38.0 120-124 35.91335 38.0 37.0 38.0 32.2 38.0 125-129 35.56825 38.0 36.2 38.0 31.0 38.0 130-134 35.2729 38.0 36.0 38.0 29.6 38.0 135-139 34.99295 38.0 35.4 38.0 28.2 38.0 140-144 34.884550000000004 38.0 35.0 38.0 28.2 38.0 145-149 34.430600000000005 38.0 35.0 38.0 27.2 38.0 150-151 31.167125 36.5 31.0 38.0 13.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 2.0 18 0.0 19 3.0 20 2.0 21 4.0 22 7.0 23 5.0 24 12.0 25 11.0 26 13.0 27 17.0 28 24.0 29 28.0 30 38.0 31 51.0 32 64.0 33 104.0 34 181.0 35 298.0 36 698.0 37 2436.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.088794926004226 10.914376321353066 8.0338266384778 34.9630021141649 2 22.85 12.950000000000001 34.025 30.175 3 18.475 17.65 28.725 35.15 4 21.55 25.85 26.474999999999998 26.125 5 22.900000000000002 29.5 25.924999999999997 21.675 6 18.825 34.125 24.85 22.2 7 14.549999999999999 27.875 40.675 16.900000000000002 8 17.375 25.35 32.6 24.675 9 17.1 24.975 33.475 24.45 10-14 20.14 29.325000000000003 27.185 23.35 15-19 20.044999999999998 27.950000000000003 27.83 24.175 20-24 19.52 28.815 28.355000000000004 23.31 25-29 20.255000000000003 28.49 27.625 23.630000000000003 30-34 20.125 28.46 27.625 23.79 35-39 20.11 27.950000000000003 27.955000000000002 23.985 40-44 19.86 28.425 27.775 23.94 45-49 19.71 28.125 28.155 24.01 50-54 20.044999999999998 28.215 28.08 23.66 55-59 19.835 28.425 27.865000000000002 23.875 60-64 20.075000000000003 28.78 27.54 23.605 65-69 20.165 28.144999999999996 27.915 23.775 70-74 20.630000000000003 28.16 27.544999999999998 23.665 75-79 20.375 29.035 27.24 23.35 80-84 20.29 27.85 27.700000000000003 24.16 85-89 20.395 28.410000000000004 27.400000000000002 23.794999999999998 90-94 20.810000000000002 28.035 27.560000000000002 23.595 95-99 20.49 27.96 27.994999999999997 23.555 100-104 19.975 27.855 28.23 23.94 105-109 20.565 28.34 27.584999999999997 23.51 110-114 20.53 27.900000000000002 27.55 24.02 115-119 20.51 28.17 27.939999999999998 23.380000000000003 120-124 20.595 28.29 27.685 23.43 125-129 20.22 28.560000000000002 27.439999999999998 23.78 130-134 21.075 28.34 27.52 23.064999999999998 135-139 21.175 27.675 27.705000000000002 23.445 140-144 20.605 27.505000000000003 28.060000000000002 23.830000000000002 145-149 20.965 27.805000000000003 27.555000000000003 23.674999999999997 150-151 19.57744718089761 28.6160770096262 27.678459807475935 24.128016002000248 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 2.0 23 2.5 24 2.0 25 2.5 26 4.5 27 6.0 28 9.0 29 16.5 30 17.5 31 23.0 32 34.0 33 41.0 34 46.0 35 60.5 36 90.0 37 110.0 38 124.5 39 154.5 40 185.0 41 215.5 42 236.0 43 247.5 44 266.5 45 273.5 46 274.0 47 265.0 48 242.5 49 211.0 50 171.0 51 138.5 52 114.0 53 94.5 54 80.0 55 59.5 56 42.5 57 30.5 58 23.5 59 22.0 60 17.0 61 13.5 62 10.0 63 5.0 64 3.5 65 3.0 66 1.0 67 0.5 68 0.5 69 0.0 70 0.5 71 0.5 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.4 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0125 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.07500000000000001 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.1875 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.30000000000000004 0.0 0.0 0.0 0.0 110-111 0.3875 0.0 0.0 0.0 0.0 112-113 0.48750000000000004 0.0 0.0 0.0 0.0 114-115 0.6 0.0 0.0 0.0 0.0 116-117 0.6375 0.0 0.0 0.0 0.0 118-119 0.7375 0.0 0.0 0.0 0.0 120-121 0.8374999999999999 0.0 0.0 0.0 0.0 122-123 1.0125 0.0 0.0 0.0 0.0 124-125 1.175 0.0 0.0 0.0 0.0 126-127 1.4 0.0 0.0 0.0 0.0 128-129 1.5375 0.0 0.0 0.0 0.0 130-131 1.75 0.0 0.0 0.0 0.0 132-133 2.075 0.0 0.0 0.0 0.0 134-135 2.3499999999999996 0.0 0.0 0.0 0.0 136-137 2.5250000000000004 0.0 0.0 0.0 0.0 138-139 2.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7030826 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030826_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.755 33.0 33.0 34.0 32.0 34.0 2 32.88425 33.0 33.0 34.0 32.0 34.0 3 32.89625 34.0 33.0 34.0 32.0 34.0 4 32.91275 34.0 33.0 34.0 32.0 34.0 5 32.87925 33.0 33.0 34.0 32.0 34.0 6 37.156 38.0 38.0 38.0 36.0 38.0 7 37.208 38.0 38.0 38.0 37.0 38.0 8 37.213 38.0 38.0 38.0 37.0 38.0 9 37.24625 38.0 38.0 38.0 37.0 38.0 10-14 37.12045 38.0 38.0 38.0 36.4 38.0 15-19 37.04365 38.0 38.0 38.0 36.0 38.0 20-24 37.0754 38.0 38.0 38.0 36.0 38.0 25-29 36.9277 38.0 38.0 38.0 36.0 38.0 30-34 37.033899999999996 38.0 38.0 38.0 36.0 38.0 35-39 36.90585 38.0 38.0 38.0 36.0 38.0 40-44 36.85654999999999 38.0 38.0 38.0 36.0 38.0 45-49 36.849849999999996 38.0 38.0 38.0 35.6 38.0 50-54 36.758399999999995 38.0 38.0 38.0 35.2 38.0 55-59 36.81825 38.0 38.0 38.0 35.2 38.0 60-64 36.709649999999996 38.0 38.0 38.0 35.2 38.0 65-69 36.693200000000004 38.0 38.0 38.0 35.0 38.0 70-74 36.569399999999995 38.0 38.0 38.0 34.4 38.0 75-79 36.56575 38.0 38.0 38.0 34.2 38.0 80-84 36.495599999999996 38.0 38.0 38.0 34.0 38.0 85-89 36.251050000000006 38.0 37.6 38.0 33.8 38.0 90-94 36.272850000000005 38.0 37.8 38.0 33.6 38.0 95-99 36.0388 38.0 37.0 38.0 33.0 38.0 100-104 35.8487 38.0 37.0 38.0 31.8 38.0 105-109 35.769600000000004 38.0 37.0 38.0 31.4 38.0 110-114 35.602599999999995 38.0 36.8 38.0 30.6 38.0 115-119 35.37765 38.0 36.2 38.0 29.8 38.0 120-124 35.212149999999994 38.0 36.0 38.0 28.4 38.0 125-129 34.95625 38.0 35.8 38.0 27.8 38.0 130-134 34.695299999999996 38.0 35.0 38.0 26.4 38.0 135-139 34.329 38.0 35.0 38.0 24.8 38.0 140-144 33.937 38.0 35.0 38.0 23.0 38.0 145-149 33.13225 38.0 34.0 38.0 17.2 38.0 150-151 28.917749999999998 36.0 18.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 4.0 4 2.0 5 0.0 6 1.0 7 2.0 8 1.0 9 2.0 10 1.0 11 1.0 12 0.0 13 2.0 14 1.0 15 1.0 16 5.0 17 4.0 18 4.0 19 6.0 20 9.0 21 8.0 22 6.0 23 5.0 24 12.0 25 13.0 26 17.0 27 27.0 28 34.0 29 38.0 30 47.0 31 73.0 32 80.0 33 133.0 34 210.0 35 318.0 36 712.0 37 2217.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.619809904952476 21.635817908954476 12.681340670335167 26.063031515757878 2 27.909887359198997 26.68335419274093 28.936170212765955 16.470588235294116 3 21.85778668002003 27.516274411617424 31.77265898848272 18.85327991987982 4 23.178973717146434 34.04255319148936 24.405506883604506 18.3729662077597 5 24.574574574574577 35.985985985985984 23.14814814814815 16.29129129129129 6 21.125 38.800000000000004 22.35 17.724999999999998 7 20.275000000000002 22.525000000000002 39.300000000000004 17.9 8 21.975 26.1 28.15 23.775 9 22.35 25.95 28.95 22.75 10-14 22.865 30.09 26.085 20.96 15-19 23.48 28.375 27.665 20.48 20-24 23.035 28.305000000000003 27.71 20.95 25-29 23.315 28.310000000000002 27.565 20.810000000000002 30-34 23.11 28.52 27.800000000000004 20.57 35-39 22.725 27.935 27.805000000000003 21.535 40-44 22.835 28.77 27.639999999999997 20.755000000000003 45-49 22.770000000000003 27.744999999999997 28.535 20.95 50-54 22.955000000000002 28.199999999999996 27.92 20.925 55-59 22.830000000000002 28.67 27.91 20.59 60-64 22.79 28.025 28.38 20.805 65-69 23.119999999999997 27.58 28.189999999999998 21.11 70-74 23.69 27.284999999999997 28.470000000000002 20.555 75-79 22.97 27.985 27.685 21.36 80-84 23.580000000000002 27.889999999999997 28.015 20.515 85-89 23.345 28.09 27.694999999999997 20.87 90-94 23.215 28.035 28.044999999999998 20.705000000000002 95-99 23.615 27.315 28.34 20.73 100-104 23.925 28.225 27.77 20.080000000000002 105-109 23.735 28.050000000000004 27.735 20.48 110-114 23.630000000000003 28.244999999999997 27.045 21.08 115-119 23.97 28.685 27.250000000000004 20.095 120-124 23.880000000000003 27.955000000000002 28.044999999999998 20.119999999999997 125-129 23.89 27.825 27.529999999999998 20.755000000000003 130-134 24.525 28.194999999999997 27.785 19.495 135-139 23.669999999999998 28.225 27.994999999999997 20.11 140-144 24.2 27.860000000000003 27.644999999999996 20.294999999999998 145-149 24.675 28.07 27.13 20.125 150-151 24.2625 28.599999999999998 27.450000000000003 19.6875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.0 17 0.5 18 1.0 19 1.0 20 2.0 21 2.5 22 1.0 23 0.5 24 1.0 25 2.0 26 4.0 27 5.5 28 7.0 29 11.0 30 14.5 31 17.5 32 26.5 33 42.0 34 52.0 35 68.0 36 86.0 37 98.5 38 137.5 39 173.5 40 204.0 41 240.0 42 259.0 43 279.5 44 281.5 45 268.5 46 260.5 47 245.0 48 230.0 49 201.5 50 161.5 51 131.0 52 107.5 53 88.0 54 66.0 55 49.5 56 41.5 57 34.0 58 26.5 59 17.5 60 10.5 61 9.5 62 9.0 63 7.5 64 5.0 65 2.0 66 1.0 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.125 3 0.15 4 0.125 5 0.1 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44695827048768 98.9 2 0.5530417295123178 1.0999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0125 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.0625 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.16249999999999998 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.3625 0.0 0.0 0.0 0.0 112-113 0.4625 0.0 0.0 0.0 0.0 114-115 0.575 0.0 0.0 0.0 0.0 116-117 0.6375 0.0 0.0 0.0 0.0 118-119 0.7375 0.0 0.0 0.0 0.0 120-121 0.8374999999999999 0.0 0.0 0.0 0.0 122-123 1.0375 0.0 0.0 0.0 0.0 124-125 1.2 0.0 0.0 0.0 0.0 126-127 1.4375 0.0 0.0 0.0 0.0 128-129 1.5875 0.0 0.0 0.0 0.0 130-131 1.8 0.0 0.0 0.0 0.0 132-133 2.125 0.0 0.0 0.0 0.0 134-135 2.375 0.0 0.0 0.0 0.0 136-137 2.55 0.0 0.0 0.0 0.0 138-139 2.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1002057 spots for SRR7030826.sra Written 1002057 spots for SRR7030826.sra Read 1002057 spots for SRR7030826.sra Written 1002057 spots for SRR7030826.sra Read 1002057 spots for SRR7030826.sra Written 1002057 spots for SRR7030826.sra Read 1002057 spots for SRR7030826.sra Written 1002057 spots for SRR7030826.sra Read 1002057 spots for SRR7030826.sra Written 1002057 spots for SRR7030826.sra Read 1002057 spots for SRR7030826.sra Written 1002057 spots for SRR7030826.sra Read 1002057 spots for SRR7030826.sra Written 1002057 spots for SRR7030826.sra Read 1002057 spots for SRR7030826.sra Written 1002057 spots for SRR7030826.sra Read 1002057 spots for SRR7030826.sra Written 1002057 spots for SRR7030826.sra Read 1002057 spots for SRR7030826.sra Written 1002057 spots for SRR7030826.sra Read 1002057 spots for SRR7030826.sra Written 1002057 spots for SRR7030826.sra Read 1002057 spots for SRR7030826.sra Written 1002057 spots for SRR7030826.sra Read 1002057 spots for SRR7030826.sra Written 1002057 spots for SRR7030826.sra Read 1002057 spots for SRR7030826.sra Written 1002057 spots for SRR7030826.sra Read 1002057 spots for SRR7030826.sra Written 1002057 spots for SRR7030826.sra Read 1002057 spots for SRR7030826.sra Written 1002057 spots for SRR7030826.sra Read 1002057 spots for SRR7030826.sra Written 1002057 spots for SRR7030826.sra Read 1002057 spots for SRR7030826.sra Written 1002057 spots for SRR7030826.sra Read 1002057 spots for SRR7030826.sra Written 1002057 spots for SRR7030826.sra Read 1002071 spots for SRR7030826.sra Written 1002071 spots for SRR7030826.sra SRR ids: ['SRR7030826.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6zllag9_ SRR7030826.sra spots: 20041154 blocks: [[1, 1002057], [1002058, 2004114], [2004115, 3006171], [3006172, 4008228], [4008229, 5010285], [5010286, 6012342], [6012343, 7014399], [7014400, 8016456], [8016457, 9018513], [9018514, 10020570], [10020571, 11022627], [11022628, 12024684], [12024685, 13026741], [13026742, 14028798], [14028799, 15030855], [15030856, 16032912], [16032913, 17034969], [17034970, 18037026], [18037027, 19039083], [19039084, 20041154]] SRR7030826 file size 6769589 SRR7030826 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7030826 SRR7030826_1.fastq SRR7030826_2.fastq Input file: SRR7030826_1.fastq Paired file: SRR7030826_2.fastq trimmed: SRR7030826-trimmed-pair1.fastq, SRR7030826-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 20:39:43 2025 >> started Wed Feb 12 20:40:16 2025 >> done (33.034s) 20041154 read pairs processed; of these: 17068 ( 0.09%) short read pairs filtered out after trimming by size control 13592 ( 0.07%) empty read pairs filtered out after trimming by size control 20010494 (99.85%) read pairs available; of these: 7587321 (37.92%) trimmed read pairs available after processing 12423173 (62.08%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 1 0.00% 20 4 0.00% 21 4 0.00% 22 5 0.00% 23 5 0.00% 24 4 0.00% 25 8 0.00% 26 8 0.00% 27 4 0.00% 28 5 0.00% 29 8 0.00% 30 9 0.00% 31 6 0.00% 32 9 0.00% 33 6 0.00% 34 8 0.00% 35 4 0.00% 36 3 0.00% 37 8 0.00% 38 8 0.00% 39 4 0.00% 40 5 0.00% 41 8 0.00% 42 8 0.00% 43 12 0.00% 44 13 0.00% 45 8 0.00% 46 8 0.00% 47 12 0.00% 48 12 0.00% 49 11 0.00% 50 13 0.00% 51 17 0.00% 52 26 0.00% 53 16 0.00% 54 33 0.00% 55 28 0.00% 56 40 0.00% 57 41 0.00% 58 37 0.00% 59 51 0.00% 60 60 0.00% 61 62 0.00% 62 69 0.00% 63 75 0.00% 64 82 0.00% 65 92 0.00% 66 97 0.00% 67 126 0.00% 68 140 0.00% 69 148 0.00% 70 165 0.00% 71 185 0.00% 72 201 0.00% 73 255 0.00% 74 303 0.00% 75 333 0.00% 76 398 0.00% 77 463 0.00% 78 497 0.00% 79 549 0.00% 80 612 0.00% 81 734 0.00% 82 850 0.00% 83 1092 0.01% 84 1911 0.01% 85 2549 0.01% 86 2751 0.01% 87 2954 0.01% 88 3148 0.02% 89 3242 0.02% 90 3430 0.02% 91 3527 0.02% 92 3777 0.02% 93 3941 0.02% 94 4267 0.02% 95 4542 0.02% 96 4909 0.02% 97 5234 0.03% 98 5535 0.03% 99 5846 0.03% 100 6352 0.03% 101 6732 0.03% 102 7391 0.04% 103 7708 0.04% 104 8318 0.04% 105 9001 0.04% 106 9678 0.05% 107 10334 0.05% 108 10895 0.05% 109 11805 0.06% 110 12464 0.06% 111 13314 0.07% 112 14189 0.07% 113 15228 0.08% 114 16153 0.08% 115 17402 0.09% 116 18403 0.09% 117 19682 0.10% 118 20699 0.10% 119 21742 0.11% 120 22533 0.11% 121 23950 0.12% 122 25098 0.13% 123 26641 0.13% 124 28125 0.14% 125 29762 0.15% 126 31307 0.16% 127 32966 0.16% 128 34988 0.17% 129 36870 0.18% 130 39211 0.20% 131 41454 0.21% 132 43891 0.22% 133 46578 0.23% 134 49879 0.25% 135 53887 0.27% 136 57589 0.29% 137 62106 0.31% 138 67787 0.34% 139 74389 0.37% 140 79911 0.40% 141 86505 0.43% 142 95724 0.48% 143 108381 0.54% 144 126547 0.63% 145 153265 0.77% 146 192658 0.96% 147 261989 1.31% 148 401219 2.01% 149 805213 4.02% 150 4119729 20.59% 151 12423173 62.08% 20010494 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=40 prefix-density=0.14 prefix-fanout=2.0 sequence=GAGAAGAGTAGA criterion=fanout-score sequence-density=0.04 sequence-density-rank=36 fanout-score=122.83 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=12.9 sequence=AAACAAGAATTTTATTGTTTCCTGTCACACCAAGGCAAACCAAACCAGTCTTCTTTTATGCACCCATACGGATAATACACCTCAGGCCAGCTCCACTAAGCATGTACTCGAAAGCCTTGTTGATTTCTGAGAAAGGGACTTCATGGGTGATGAATTTCTCTAGCTCCAGCTCCTTGTTCATGTACTTCTCGACAACTGAAGGAAGGTCGGAGCGCGGTTTGTAGTT criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.63 fanout-score-rank=33 prefix-density=0.28 prefix-fanout=2.4 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.06 sequence-density-rank=25 fanout-score=266.75 fanout-score-rank=1 prefix-density=0.71 prefix-fanout=24.0 sequence=AAGAAGAAAAACAGTTTCTCAAGAGCAGTATATATAGATCTTTCAGAAGAATTAAGGAGATGGCAGACGAGGGAACAGCTACTTGCATAGACATCTTGTTGGCCATCATCTTGCCTCCGCTTGGTGTCTTCCTCAAGTT SRR7030826 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 20:41:06 Started mapping on | Feb 12 20:41:06 Finished on | Feb 12 20:43:07 Mapping speed, Million of reads per hour | 595.35 Number of input reads | 20010494 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 19031624 Uniquely mapped reads % | 95.11% Average mapped length | 296.77 Number of splices: Total | 17137317 Number of splices: Annotated (sjdb) | 16777465 Number of splices: GT/AG | 16865574 Number of splices: GC/AG | 206267 Number of splices: AT/AC | 12582 Number of splices: Non-canonical | 52894 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.84 Insertion rate per base | 0.02% Insertion average length | 2.68 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 559703 % of reads mapped to multiple loci | 2.80% Number of reads mapped to too many loci | 132183 % of reads mapped to too many loci | 0.66% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.31% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 438081 438081 438081 N_multimapping 559703 559703 559703 N_noFeature 506193 18799039 627532 N_ambiguous 205742 1421 93783 UnstrandedReadsAssigned:18319689 PositiveStrandReadsAssigned:231164 NegativeStrandReadsAssigned:18310309 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7030826 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7030826-trimmed-pair1.fastq SRR7030826-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,010,494 reads, 18,329,566 reads pseudoaligned [quant] estimated average fragment length: 251.378 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,260 rounds 52401 SRR7030826.ke.tsv 34699 SRR7030826.se.tsv 87100 total ==> SRR7030826.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1767.62 1842 43.6213 Potri.005G024800.1.v4.1 1035 784.622 1765 94.1636 Potri.004G059700.1.v4.1 961 710.647 15 0.883559 Potri.007G009000.2.v4.1 1416 1165.62 0 0 Potri.003G141000.2.v4.1 2943 2692.62 750 11.6596 Potri.016G087400.1.v4.1 270 69.2369 1041.54 629.706 Potri.015G069301.1.v4.1 564 316.882 0 0 Potri.010G195200.1.v4.1 1773 1522.62 157 4.31625 Potri.012G127500.1.v4.1 977 726.622 15151 872.834 ==> SRR7030826.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 263 Potri.001G212900.v4.1 105 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 36 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 11 SRR7030826 completed mapping pipeline successfully