Starting /dee2/code/volunteer_pipeline.sh SRR7030827 current disk space = 3050849517568 free memory = 1571393964 SRR7030827 SRAfilesize a6598f9bcab750978c0f6b587af6bcfd SRR7030827.sra SRR7030827.sra file validated SRR7030827 is paired end SRR7030827 is conventional basespace SRR7030827 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030827_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.358 33.0 33.0 34.0 25.0 34.0 2 32.31275 33.0 33.0 34.0 28.0 34.0 3 32.4895 33.0 33.0 34.0 29.0 34.0 4 32.8915 33.0 33.0 34.0 31.0 34.0 5 32.573 33.0 33.0 34.0 31.0 34.0 6 36.18775 38.0 36.0 38.0 33.0 38.0 7 36.77375 38.0 37.0 38.0 35.0 38.0 8 37.155 38.0 38.0 38.0 36.0 38.0 9 37.385 38.0 38.0 38.0 37.0 38.0 10-14 37.409749999999995 38.0 38.0 38.0 37.0 38.0 15-19 37.47355 38.0 38.0 38.0 37.0 38.0 20-24 37.45125 38.0 38.0 38.0 37.0 38.0 25-29 37.397749999999995 38.0 38.0 38.0 37.0 38.0 30-34 37.3197 38.0 38.0 38.0 37.0 38.0 35-39 37.346 38.0 38.0 38.0 37.0 38.0 40-44 37.3085 38.0 38.0 38.0 37.0 38.0 45-49 37.29774999999999 38.0 38.0 38.0 37.0 38.0 50-54 37.28075 38.0 38.0 38.0 37.0 38.0 55-59 37.21595 38.0 38.0 38.0 36.6 38.0 60-64 37.16885 38.0 38.0 38.0 36.4 38.0 65-69 37.05575 38.0 38.0 38.0 36.0 38.0 70-74 36.9928 38.0 38.0 38.0 36.0 38.0 75-79 36.9901 38.0 38.0 38.0 35.8 38.0 80-84 36.91685 38.0 38.0 38.0 35.0 38.0 85-89 36.8375 38.0 38.0 38.0 35.2 38.0 90-94 36.5472 38.0 38.0 38.0 34.0 38.0 95-99 36.476099999999995 38.0 38.0 38.0 34.0 38.0 100-104 36.429649999999995 38.0 38.0 38.0 34.0 38.0 105-109 36.32275 38.0 38.0 38.0 34.0 38.0 110-114 36.26305 38.0 37.8 38.0 33.6 38.0 115-119 36.0803 38.0 37.2 38.0 33.2 38.0 120-124 36.058699999999995 38.0 37.0 38.0 33.0 38.0 125-129 35.788149999999995 38.0 36.8 38.0 31.8 38.0 130-134 35.416199999999996 38.0 36.0 38.0 30.6 38.0 135-139 35.249900000000004 38.0 36.0 38.0 29.4 38.0 140-144 34.842000000000006 38.0 35.2 38.0 28.0 38.0 145-149 34.7018 38.0 35.4 38.0 28.4 38.0 150-151 30.84075 36.5 30.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 3.0 14 1.0 15 0.0 16 2.0 17 0.0 18 2.0 19 3.0 20 5.0 21 1.0 22 1.0 23 8.0 24 4.0 25 15.0 26 10.0 27 22.0 28 31.0 29 23.0 30 36.0 31 56.0 32 76.0 33 103.0 34 128.0 35 268.0 36 714.0 37 2487.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.4176804541768 12.300621789672885 8.110300081103 34.17139767504731 2 20.349999999999998 13.850000000000001 33.975 31.825 3 17.05 20.075000000000003 28.95 33.925 4 22.025 26.224999999999998 25.324999999999996 26.424999999999997 5 21.46609957468101 31.998999249437077 24.418313735301474 22.116587440580435 6 18.5 36.175000000000004 25.275 20.05 7 14.6 27.200000000000003 39.7 18.5 8 14.924999999999999 28.675 31.324999999999996 25.074999999999996 9 17.275 26.1 33.800000000000004 22.825 10-14 19.64 30.2 27.67 22.49 15-19 19.185 29.115000000000002 28.285 23.415 20-24 19.665 29.294999999999998 27.944999999999997 23.095 25-29 19.53 29.29 27.650000000000002 23.53 30-34 19.43 29.74 27.515 23.315 35-39 19.465 29.385 27.72 23.43 40-44 19.53 28.985 27.3 24.185000000000002 45-49 19.965 28.92 27.215 23.9 50-54 19.675 28.82 27.93 23.575 55-59 19.85 28.73 27.91 23.51 60-64 19.53 28.67 28.345 23.455000000000002 65-69 19.605 28.62 27.735 24.04 70-74 19.49 28.48 27.99 24.04 75-79 19.365 28.71 27.810000000000002 24.115000000000002 80-84 19.68 28.625 27.965 23.73 85-89 19.64 28.585 28.110000000000003 23.665 90-94 20.105 28.749999999999996 27.66 23.485 95-99 19.85 29.054999999999996 27.310000000000002 23.785 100-104 20.0 28.895 27.41 23.695 105-109 20.09 28.59 28.044999999999998 23.275000000000002 110-114 20.355 28.194999999999997 27.35 24.099999999999998 115-119 20.580000000000002 28.325 27.694999999999997 23.400000000000002 120-124 20.13 27.884999999999998 27.639999999999997 24.345 125-129 21.055 28.475 27.205000000000002 23.265 130-134 20.68 27.500000000000004 27.894999999999996 23.925 135-139 20.32 28.68 27.255000000000003 23.745 140-144 20.895 28.255000000000003 26.69 24.16 145-149 21.04 28.43 26.825 23.705000000000002 150-151 20.846905537459286 27.323978952643447 27.349035329491358 24.480080180405913 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 1.0 3 0.5 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 1.5 23 2.5 24 4.5 25 6.0 26 8.5 27 11.0 28 14.5 29 21.0 30 24.5 31 29.0 32 45.5 33 57.5 34 73.5 35 86.5 36 98.0 37 121.5 38 140.0 39 162.5 40 191.0 41 233.5 42 252.5 43 243.5 44 244.0 45 250.0 46 245.0 47 233.5 48 222.5 49 196.0 50 175.5 51 142.5 52 101.0 53 80.0 54 61.0 55 48.0 56 40.5 57 34.5 58 26.5 59 17.5 60 10.0 61 9.0 62 10.5 63 5.5 64 1.5 65 1.5 66 1.5 67 1.5 68 2.5 69 2.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.5249999999999995 2 0.0 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.22499999999999998 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62330487192365 99.175 2 0.3264691109994977 0.65 3 0.025113008538422906 0.075 4 0.025113008538422906 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.3125 0.0 0.0 0.0 0.0 106-107 0.3625 0.0 0.0 0.0 0.0 108-109 0.5 0.0 0.0 0.0 0.0 110-111 0.5874999999999999 0.0 0.0 0.0 0.0 112-113 0.6625 0.0 0.0 0.0 0.0 114-115 0.775 0.0 0.0 0.0 0.0 116-117 0.95 0.0 0.0 0.0 0.0 118-119 1.075 0.0 0.0 0.0 0.0 120-121 1.375 0.0 0.0 0.0 0.0 122-123 1.5875 0.0 0.0 0.0 0.0 124-125 1.875 0.0 0.0 0.0 0.0 126-127 2.1625 0.0 0.0 0.0 0.0 128-129 2.425 0.0 0.0 0.0 0.0 130-131 2.7750000000000004 0.0 0.0 0.0 0.0 132-133 3.0999999999999996 0.0 0.0 0.0 0.0 134-135 3.35 0.0 0.0 0.0 0.0 136-137 3.6375 0.0 0.0 0.0 0.0 138-139 3.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCTCTC 10 0.0068378756 144.95 145 >>END_MODULE SRR7030827 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030827_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.745 33.0 33.0 34.0 32.0 34.0 2 32.82975 33.0 33.0 34.0 32.0 34.0 3 32.84825 33.0 33.0 34.0 32.0 34.0 4 32.851 33.0 33.0 34.0 32.0 34.0 5 32.7355 33.0 33.0 34.0 32.0 34.0 6 37.02925 38.0 38.0 38.0 37.0 38.0 7 37.0365 38.0 38.0 38.0 36.0 38.0 8 37.00125 38.0 38.0 38.0 37.0 38.0 9 37.04075 38.0 38.0 38.0 36.0 38.0 10-14 37.01305 38.0 38.0 38.0 36.2 38.0 15-19 36.886649999999996 38.0 38.0 38.0 36.0 38.0 20-24 36.86925 38.0 38.0 38.0 36.0 38.0 25-29 36.8094 38.0 38.0 38.0 36.0 38.0 30-34 36.8164 38.0 38.0 38.0 36.0 38.0 35-39 36.70865 38.0 38.0 38.0 35.8 38.0 40-44 36.64315 38.0 38.0 38.0 35.6 38.0 45-49 36.5749 38.0 38.0 38.0 35.0 38.0 50-54 36.595600000000005 38.0 38.0 38.0 35.2 38.0 55-59 36.4987 38.0 38.0 38.0 35.0 38.0 60-64 36.523700000000005 38.0 38.0 38.0 35.0 38.0 65-69 36.39019999999999 38.0 38.0 38.0 34.4 38.0 70-74 36.401199999999996 38.0 38.0 38.0 34.0 38.0 75-79 36.3139 38.0 38.0 38.0 34.0 38.0 80-84 36.35325 38.0 38.0 38.0 34.0 38.0 85-89 36.286500000000004 38.0 38.0 38.0 34.0 38.0 90-94 36.111000000000004 38.0 38.0 38.0 34.0 38.0 95-99 36.0573 38.0 38.0 38.0 33.6 38.0 100-104 35.672799999999995 38.0 37.2 38.0 31.6 38.0 105-109 35.5119 38.0 37.0 38.0 30.6 38.0 110-114 35.28145000000001 38.0 36.8 38.0 29.6 38.0 115-119 35.20505 38.0 36.2 38.0 29.0 38.0 120-124 35.0022 38.0 36.0 38.0 28.6 38.0 125-129 34.8235 38.0 35.6 38.0 27.6 38.0 130-134 34.72965 38.0 35.4 38.0 27.6 38.0 135-139 34.3294 38.0 35.0 38.0 25.6 38.0 140-144 33.8355 38.0 35.0 38.0 22.2 38.0 145-149 33.205349999999996 38.0 34.2 38.0 18.0 38.0 150-151 29.4535 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 15.0 4 3.0 5 1.0 6 3.0 7 3.0 8 2.0 9 2.0 10 3.0 11 6.0 12 1.0 13 0.0 14 2.0 15 3.0 16 4.0 17 6.0 18 5.0 19 7.0 20 4.0 21 11.0 22 6.0 23 12.0 24 11.0 25 21.0 26 25.0 27 19.0 28 36.0 29 43.0 30 48.0 31 62.0 32 59.0 33 129.0 34 155.0 35 283.0 36 626.0 37 2378.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.30597948461346 23.71778834125594 12.359269452089066 22.61696272204153 2 27.506876719179797 27.406851712928233 28.032008002000502 17.05426356589147 3 20.290217663247436 29.422066549912433 31.07330497873405 19.21441080810608 4 24.06805103827871 33.35001250938204 23.91793845384038 18.663997998498875 5 23.674999999999997 37.1 22.675 16.55 6 21.075 38.25 23.7 16.975 7 21.575 22.95 37.075 18.4 8 21.875 25.374999999999996 28.999999999999996 23.75 9 22.175 24.224999999999998 30.65 22.95 10-14 23.91 28.845 26.125 21.12 15-19 23.515 27.794999999999998 28.125 20.565 20-24 23.54 28.43 27.689999999999998 20.34 25-29 24.04 28.07 27.55 20.34 30-34 23.305 27.939999999999998 28.165000000000003 20.59 35-39 23.52 28.63 27.3 20.549999999999997 40-44 23.56 28.275 27.36 20.805 45-49 23.1 28.585 27.82 20.495 50-54 23.69 28.38 27.83 20.1 55-59 23.665 27.37 27.810000000000002 21.154999999999998 60-64 23.51 28.194999999999997 27.465 20.830000000000002 65-69 23.400000000000002 28.389999999999997 27.975 20.235 70-74 23.135 28.02 28.415000000000003 20.43 75-79 23.990000000000002 27.87 27.88 20.26 80-84 23.335 28.57 27.229999999999997 20.865000000000002 85-89 23.724999999999998 27.529999999999998 28.410000000000004 20.335 90-94 23.97 27.839999999999996 28.07 20.119999999999997 95-99 23.810000000000002 27.310000000000002 28.305000000000003 20.575 100-104 23.21 28.084999999999997 28.34 20.365 105-109 23.97 27.82 28.175 20.035 110-114 23.835 28.465 27.785 19.915 115-119 23.799999999999997 28.765 27.445000000000004 19.99 120-124 24.005000000000003 28.165000000000003 27.71 20.119999999999997 125-129 24.505 28.035 27.355 20.105 130-134 24.025 27.775 28.165000000000003 20.035 135-139 24.635 27.525 27.689999999999998 20.150000000000002 140-144 24.855 27.46 27.825 19.86 145-149 24.79 27.76 28.144999999999996 19.305 150-151 25.196948855820935 26.947605352007002 27.997999249718646 19.85744654245342 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.5 17 1.0 18 0.5 19 0.5 20 1.0 21 0.5 22 0.0 23 0.0 24 0.0 25 2.0 26 4.5 27 4.0 28 9.5 29 12.0 30 12.5 31 20.0 32 26.0 33 33.0 34 47.5 35 68.0 36 80.0 37 96.0 38 118.0 39 150.0 40 206.0 41 251.5 42 281.0 43 281.0 44 267.0 45 279.0 46 273.0 47 260.0 48 250.0 49 211.0 50 161.5 51 134.5 52 101.0 53 75.5 54 65.5 55 49.0 56 45.0 57 36.5 58 22.5 59 15.0 60 12.0 61 9.5 62 7.5 63 5.0 64 5.0 65 2.5 66 0.5 67 0.5 68 1.5 69 1.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.025 3 0.075 4 0.075 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57307885484681 99.125 2 0.4018081366147665 0.8 3 0.025113008538422906 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.3 0.0 0.0 0.0 0.0 106-107 0.3375 0.0 0.0 0.0 0.0 108-109 0.475 0.0 0.0 0.0 0.0 110-111 0.5625 0.0 0.0 0.0 0.0 112-113 0.6375 0.0 0.0 0.0 0.0 114-115 0.75 0.0 0.0 0.0 0.0 116-117 0.8999999999999999 0.0 0.0 0.0 0.0 118-119 1.025 0.0 0.0 0.0 0.0 120-121 1.3 0.0 0.0 0.0 0.0 122-123 1.5 0.0 0.0 0.0 0.0 124-125 1.7374999999999998 0.0 0.0 0.0 0.0 126-127 1.9874999999999998 0.0 0.0 0.0 0.0 128-129 2.25 0.0 0.0 0.0 0.0 130-131 2.5999999999999996 0.0 0.0 0.0 0.0 132-133 2.875 0.0 0.0 0.0 0.0 134-135 3.1375 0.0 0.0 0.0 0.0 136-137 3.4125 0.0 0.0 0.0 0.0 138-139 3.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGATTCC 10 0.006830828 145.0 6 GCATTCA 10 0.006830828 145.0 145 >>END_MODULE Read 1157010 spots for SRR7030827.sra Written 1157010 spots for SRR7030827.sra Read 1157010 spots for SRR7030827.sra Written 1157010 spots for SRR7030827.sra Read 1157010 spots for SRR7030827.sra Written 1157010 spots for SRR7030827.sra Read 1157010 spots for SRR7030827.sra Written 1157010 spots for SRR7030827.sra Read 1157010 spots for SRR7030827.sra Written 1157010 spots for SRR7030827.sra Read 1157010 spots for SRR7030827.sra Written 1157010 spots for SRR7030827.sra Read 1157010 spots for SRR7030827.sra Written 1157010 spots for SRR7030827.sra Read 1157010 spots for SRR7030827.sra Written 1157010 spots for SRR7030827.sra Read 1157010 spots for SRR7030827.sra Written 1157010 spots for SRR7030827.sra Read 1157010 spots for SRR7030827.sra Written 1157010 spots for SRR7030827.sra Read 1157010 spots for SRR7030827.sra Written 1157010 spots for SRR7030827.sra Read 1157010 spots for SRR7030827.sra Written 1157010 spots for SRR7030827.sra Read 1157010 spots for SRR7030827.sra Written 1157010 spots for SRR7030827.sra Read 1157010 spots for SRR7030827.sra Written 1157010 spots for SRR7030827.sra Read 1157010 spots for SRR7030827.sra Written 1157010 spots for SRR7030827.sra Read 1157010 spots for SRR7030827.sra Written 1157010 spots for SRR7030827.sra Read 1157026 spots for SRR7030827.sra Written 1157026 spots for SRR7030827.sra Read 1157010 spots for SRR7030827.sra Written 1157010 spots for SRR7030827.sra Read 1157010 spots for SRR7030827.sra Written 1157010 spots for SRR7030827.sra Read 1157010 spots for SRR7030827.sra Written 1157010 spots for SRR7030827.sra SRR ids: ['SRR7030827.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_q_0ocdjc SRR7030827.sra spots: 23140216 blocks: [[1, 1157010], [1157011, 2314020], [2314021, 3471030], [3471031, 4628040], [4628041, 5785050], [5785051, 6942060], [6942061, 8099070], [8099071, 9256080], [9256081, 10413090], [10413091, 11570100], [11570101, 12727110], [12727111, 13884120], [13884121, 15041130], [15041131, 16198140], [16198141, 17355150], [17355151, 18512160], [18512161, 19669170], [19669171, 20826180], [20826181, 21983190], [21983191, 23140216]] SRR7030827 file size 7819759 SRR7030827 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7030827 SRR7030827_1.fastq SRR7030827_2.fastq Input file: SRR7030827_1.fastq Paired file: SRR7030827_2.fastq trimmed: SRR7030827-trimmed-pair1.fastq, SRR7030827-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 20:45:00 2025 >> started Wed Feb 12 20:45:25 2025 >> done (25.809s) 23140216 read pairs processed; of these: 37058 ( 0.16%) short read pairs filtered out after trimming by size control 27233 ( 0.12%) empty read pairs filtered out after trimming by size control 23075925 (99.72%) read pairs available; of these: 8991014 (38.96%) trimmed read pairs available after processing 14084911 (61.04%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 1 0.00% 20 8 0.00% 21 11 0.00% 22 4 0.00% 23 8 0.00% 24 7 0.00% 25 14 0.00% 26 11 0.00% 27 11 0.00% 28 9 0.00% 29 10 0.00% 30 18 0.00% 31 9 0.00% 32 18 0.00% 33 11 0.00% 34 14 0.00% 35 8 0.00% 36 8 0.00% 37 14 0.00% 38 9 0.00% 39 14 0.00% 40 13 0.00% 41 12 0.00% 42 13 0.00% 43 10 0.00% 44 21 0.00% 45 23 0.00% 46 14 0.00% 47 21 0.00% 48 26 0.00% 49 23 0.00% 50 49 0.00% 51 31 0.00% 52 40 0.00% 53 44 0.00% 54 49 0.00% 55 50 0.00% 56 59 0.00% 57 70 0.00% 58 80 0.00% 59 80 0.00% 60 84 0.00% 61 105 0.00% 62 99 0.00% 63 129 0.00% 64 133 0.00% 65 132 0.00% 66 163 0.00% 67 166 0.00% 68 210 0.00% 69 215 0.00% 70 248 0.00% 71 324 0.00% 72 372 0.00% 73 410 0.00% 74 454 0.00% 75 518 0.00% 76 613 0.00% 77 624 0.00% 78 733 0.00% 79 814 0.00% 80 954 0.00% 81 1131 0.00% 82 1274 0.01% 83 1576 0.01% 84 3334 0.01% 85 4714 0.02% 86 4986 0.02% 87 5670 0.02% 88 5971 0.03% 89 6055 0.03% 90 6049 0.03% 91 6210 0.03% 92 6429 0.03% 93 6615 0.03% 94 6858 0.03% 95 7281 0.03% 96 7743 0.03% 97 8295 0.04% 98 8733 0.04% 99 9292 0.04% 100 9859 0.04% 101 10285 0.04% 102 11202 0.05% 103 12370 0.05% 104 12997 0.06% 105 14212 0.06% 106 15159 0.07% 107 15915 0.07% 108 16946 0.07% 109 17984 0.08% 110 19099 0.08% 111 20470 0.09% 112 21740 0.09% 113 23155 0.10% 114 24746 0.11% 115 26377 0.11% 116 27936 0.12% 117 29666 0.13% 118 30918 0.13% 119 32450 0.14% 120 34195 0.15% 121 35638 0.15% 122 37432 0.16% 123 39280 0.17% 124 41617 0.18% 125 43040 0.19% 126 45785 0.20% 127 47763 0.21% 128 50555 0.22% 129 53043 0.23% 130 55816 0.24% 131 58545 0.25% 132 62066 0.27% 133 65780 0.29% 134 69777 0.30% 135 74932 0.32% 136 78726 0.34% 137 83764 0.36% 138 90639 0.39% 139 97924 0.42% 140 103938 0.45% 141 111608 0.48% 142 121507 0.53% 143 136209 0.59% 144 156476 0.68% 145 183859 0.80% 146 229010 0.99% 147 304591 1.32% 148 453195 1.96% 149 877738 3.80% 150 4636415 20.09% 151 14084911 61.04% 23075925 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=1.93 fanout-score-rank=44 prefix-density=0.20 prefix-fanout=1.9 sequence=ACTGATTCCTTTGCA criterion=fanout-score sequence-density=0.06 sequence-density-rank=28 fanout-score=166.50 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=20.1 sequence=TTTTCTTCTTTCTTTTCTGTGAGTAAAATCAAAATGGCTTCTGTAAATACATGAACATGTCCTGCAAAGGTGAGAGCTGGTCCAATTGGAACTGATCTTGTGAAGCAAAAGGGTAATCTTGGAAGCCATCATCAATGTAATTGAAGTTGAAATCGAAGGCATTATCTAGCTGA criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=3.74 fanout-score-rank=26 prefix-density=0.24 prefix-fanout=2.9 sequence=ACAAAGCTGGTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=219.94 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=10.8 sequence=GAGAGAGAGCCGAGAAAGAAAGATAGTCTTTGGGTCCTTCAACTGCTGCAGAAAGTTTCTCGAAGAAGAAACAAACAAGTTTCTACGGCAGTTGAAATATATAAAAGATCCATCATCTCTTGTTTTCGTAAAACTTCTTTCACAAAGTTTGAATCAAATCACACACTGTATTTGTAGAATGGCTCGTTCTTTCTCAAACGCCAAGGTCATCTCTGGCCTGATCAGCGAGGCAATCAACGGCAGAGGATTCTCAGCTGTTGCATCCCAAGGAGCTGCTGTGTCCAAGGCAAGAAGCGGTGCTGCTGTAATGAAGAAAACAGGGGAGGAGGTTACCAAGACCACCGAGAAGATTTCCTGGGTTCCAGATCCTCGTACTGGATTCTACAGACCAGAGAATGTTGCTCAGGAAATCGATGCGGCTGAATTACGTGCTACTCTCTTGAAGAAGCATTGAAGAAATTACTAATTCATGAGATTAATAAAATCTGATTACTACTACATCATGTTCTAT SRR7030827 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 20:46:06 Started mapping on | Feb 12 20:46:07 Finished on | Feb 12 20:48:50 Mapping speed, Million of reads per hour | 509.65 Number of input reads | 23075925 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 21838924 Uniquely mapped reads % | 94.64% Average mapped length | 295.81 Number of splices: Total | 17531066 Number of splices: Annotated (sjdb) | 17160841 Number of splices: GT/AG | 17237531 Number of splices: GC/AG | 223953 Number of splices: AT/AC | 14055 Number of splices: Non-canonical | 55527 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.04% Deletion average length | 2.75 Insertion rate per base | 0.03% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 698005 % of reads mapped to multiple loci | 3.02% Number of reads mapped to too many loci | 121121 % of reads mapped to too many loci | 0.52% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.73% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 578989 578989 578989 N_multimapping 698005 698005 698005 N_noFeature 608512 21576856 725176 N_ambiguous 251682 1599 105440 UnstrandedReadsAssigned:20978730 PositiveStrandReadsAssigned:260469 NegativeStrandReadsAssigned:21008308 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7030827 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7030827-trimmed-pair1.fastq SRR7030827-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,075,925 reads, 21,103,465 reads pseudoaligned [quant] estimated average fragment length: 236.422 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,173 rounds 52401 SRR7030827.ke.tsv 34699 SRR7030827.se.tsv 87100 total ==> SRR7030827.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1782.58 3750 67.1716 Potri.005G024800.1.v4.1 1035 799.578 1541 61.5382 Potri.004G059700.1.v4.1 961 725.597 28 1.23216 Potri.007G009000.2.v4.1 1416 1180.58 0 0 Potri.003G141000.2.v4.1 2943 2707.58 724.827 8.54784 Potri.016G087400.1.v4.1 270 73.888 1200.9 518.961 Potri.015G069301.1.v4.1 564 330.76 0 0 Potri.010G195200.1.v4.1 1773 1537.58 141.758 2.94383 Potri.012G127500.1.v4.1 977 741.593 10994 473.362 ==> SRR7030827.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 9 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 429 Potri.001G212900.v4.1 410 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 81 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7030827 completed mapping pipeline successfully