Starting /dee2/code/volunteer_pipeline.sh SRR7030828 current disk space = 3050777960448 free memory = 1580546424 SRR7030828 SRAfilesize 582fde6539f12c2383b6acc12a130333 SRR7030828.sra SRR7030828.sra file validated SRR7030828 is paired end SRR7030828 is conventional basespace SRR7030828 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030828_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.64625 32.0 18.0 33.0 18.0 34.0 2 31.6635 33.0 30.0 34.0 27.0 34.0 3 32.0985 33.0 31.0 34.0 28.0 34.0 4 32.5945 33.0 33.0 34.0 32.0 34.0 5 32.68625 33.0 33.0 34.0 32.0 34.0 6 36.3675 38.0 37.0 38.0 34.0 38.0 7 37.19475 38.0 38.0 38.0 36.0 38.0 8 37.18425 38.0 38.0 38.0 36.0 38.0 9 37.438 38.0 38.0 38.0 37.0 38.0 10-14 37.46945 38.0 38.0 38.0 37.2 38.0 15-19 37.5129 38.0 38.0 38.0 37.2 38.0 20-24 37.48555 38.0 38.0 38.0 37.2 38.0 25-29 37.419200000000004 38.0 38.0 38.0 37.0 38.0 30-34 37.36165 38.0 38.0 38.0 37.0 38.0 35-39 37.3335 38.0 38.0 38.0 37.0 38.0 40-44 37.2448 38.0 38.0 38.0 36.8 38.0 45-49 37.275 38.0 38.0 38.0 36.6 38.0 50-54 37.26465 38.0 38.0 38.0 37.0 38.0 55-59 37.2096 38.0 38.0 38.0 36.4 38.0 60-64 37.17555 38.0 38.0 38.0 36.2 38.0 65-69 37.19075 38.0 38.0 38.0 36.0 38.0 70-74 37.03595 38.0 38.0 38.0 36.0 38.0 75-79 37.00195 38.0 38.0 38.0 36.0 38.0 80-84 36.87915 38.0 38.0 38.0 35.2 38.0 85-89 36.85105 38.0 38.0 38.0 35.0 38.0 90-94 36.7749 38.0 38.0 38.0 35.0 38.0 95-99 36.501599999999996 38.0 38.0 38.0 34.2 38.0 100-104 36.5075 38.0 38.0 38.0 34.0 38.0 105-109 36.38005 38.0 38.0 38.0 34.0 38.0 110-114 36.2569 38.0 37.8 38.0 33.6 38.0 115-119 36.106100000000005 38.0 37.2 38.0 33.0 38.0 120-124 35.858 38.0 37.0 38.0 31.8 38.0 125-129 35.61785 38.0 36.2 38.0 31.0 38.0 130-134 35.2454 38.0 36.0 38.0 29.0 38.0 135-139 35.03675 38.0 35.4 38.0 27.8 38.0 140-144 34.90915 38.0 35.0 38.0 28.4 38.0 145-149 34.22240000000001 38.0 35.0 38.0 25.4 38.0 150-151 30.842875 36.5 29.5 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 0.0 16 1.0 17 1.0 18 0.0 19 1.0 20 4.0 21 6.0 22 4.0 23 1.0 24 8.0 25 12.0 26 10.0 27 19.0 28 31.0 29 31.0 30 37.0 31 54.0 32 92.0 33 96.0 34 159.0 35 279.0 36 723.0 37 2428.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.266576454668474 12.341001353179973 9.472259810554803 40.920162381596754 2 21.95 14.325 33.575 30.15 3 18.375 19.475 26.924999999999997 35.225 4 21.7 28.175 23.200000000000003 26.924999999999997 5 22.911455727863935 33.291645822911455 24.012006003001503 19.78489244622311 6 19.829957489372344 35.83395848962241 24.281070267566893 20.05501375343836 7 15.1 26.5 40.8 17.599999999999998 8 18.45 25.974999999999998 31.175000000000004 24.4 9 18.35 24.625 34.425 22.6 10-14 19.7 29.459999999999997 27.58 23.26 15-19 19.3 28.075 28.389999999999997 24.235 20-24 19.525000000000002 28.43 28.435 23.61 25-29 19.825 28.935 27.634999999999998 23.605 30-34 19.794999999999998 28.83 27.815 23.56 35-39 19.575 28.475 28.225 23.724999999999998 40-44 19.125 28.439999999999998 28.360000000000003 24.075 45-49 19.36 28.51 27.985 24.145 50-54 19.645000000000003 29.14 27.36 23.855 55-59 19.885 28.58 27.715 23.82 60-64 19.775000000000002 28.810000000000002 27.26 24.154999999999998 65-69 19.695 28.494999999999997 27.765 24.044999999999998 70-74 19.88 27.975 27.744999999999997 24.4 75-79 20.064999999999998 28.49 27.87 23.575 80-84 19.525000000000002 27.839999999999996 28.38 24.255 85-89 20.1 28.18 28.13 23.59 90-94 20.085 27.63 28.599999999999998 23.685000000000002 95-99 20.380000000000003 28.294999999999998 28.050000000000004 23.275000000000002 100-104 20.78 28.17 27.605 23.445 105-109 20.405 28.285 27.83 23.48 110-114 20.195 27.935 28.005000000000003 23.865 115-119 20.39 27.865000000000002 27.71 24.035 120-124 20.044999999999998 28.415000000000003 28.134999999999998 23.405 125-129 20.150000000000002 28.560000000000002 27.650000000000002 23.64 130-134 19.8 28.305000000000003 28.09 23.805 135-139 20.105 28.02 27.92 23.955000000000002 140-144 20.505000000000003 27.855 27.77 23.87 145-149 20.315 28.4 27.295 23.990000000000002 150-151 20.030026272988867 28.725134492681097 27.386463155260856 23.858376079069185 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 1.0 24 2.0 25 3.5 26 9.0 27 10.0 28 10.5 29 16.0 30 23.0 31 24.5 32 31.0 33 44.5 34 49.5 35 65.0 36 89.0 37 112.5 38 129.5 39 151.5 40 195.0 41 235.5 42 254.0 43 258.5 44 269.0 45 266.5 46 271.0 47 271.5 48 255.5 49 211.0 50 159.0 51 135.0 52 109.0 53 86.0 54 63.5 55 46.0 56 33.0 57 26.5 58 23.5 59 17.0 60 10.5 61 8.5 62 7.0 63 5.5 64 4.0 65 1.5 66 0.0 67 0.5 68 1.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.625 2 0.0 3 0.0 4 0.0 5 0.05 6 0.025 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.7743795437453 99.5 2 0.17548257708698922 0.35000000000000003 3 0.0501378791677112 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1125 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.16249999999999998 0.0 0.0 0.0 0.0 110-111 0.2 0.0 0.0 0.0 0.0 112-113 0.2875 0.0 0.0 0.0 0.0 114-115 0.35 0.0 0.0 0.0 0.0 116-117 0.3625 0.0 0.0 0.0 0.0 118-119 0.4125 0.0 0.0 0.0 0.0 120-121 0.4875 0.0 0.0 0.0 0.0 122-123 0.55 0.0 0.0 0.0 0.0 124-125 0.6125 0.0 0.0 0.0 0.0 126-127 0.7625 0.0 0.0 0.0 0.0 128-129 0.8875 0.0 0.0 0.0 0.0 130-131 0.925 0.0 0.0 0.0 0.0 132-133 1.1 0.0 0.0 0.0 0.0 134-135 1.25 0.0 0.0 0.0 0.0 136-137 1.35 0.0 0.0 0.0 0.0 138-139 1.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCAGCC 10 0.005853838 152.57895 1 GGTAAAA 10 0.005853838 152.57895 1 GAACTCA 10 0.0068378756 144.95 5 >>END_MODULE SRR7030828 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030828_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9015 33.0 33.0 34.0 32.0 34.0 2 32.97575 33.0 33.0 34.0 32.0 34.0 3 32.9675 34.0 33.0 34.0 32.0 34.0 4 33.00175 34.0 33.0 34.0 32.0 34.0 5 33.042 34.0 33.0 34.0 32.0 34.0 6 37.22375 38.0 38.0 38.0 37.0 38.0 7 37.2945 38.0 38.0 38.0 37.0 38.0 8 37.2965 38.0 38.0 38.0 37.0 38.0 9 37.232 38.0 38.0 38.0 37.0 38.0 10-14 37.1933 38.0 38.0 38.0 36.8 38.0 15-19 37.183049999999994 38.0 38.0 38.0 37.0 38.0 20-24 37.1619 38.0 38.0 38.0 37.0 38.0 25-29 37.14405000000001 38.0 38.0 38.0 37.0 38.0 30-34 37.094049999999996 38.0 38.0 38.0 36.4 38.0 35-39 37.0376 38.0 38.0 38.0 36.0 38.0 40-44 37.0127 38.0 38.0 38.0 36.0 38.0 45-49 36.8065 38.0 38.0 38.0 35.4 38.0 50-54 36.9996 38.0 38.0 38.0 36.0 38.0 55-59 36.931549999999994 38.0 38.0 38.0 35.8 38.0 60-64 36.85510000000001 38.0 38.0 38.0 35.6 38.0 65-69 36.805099999999996 38.0 38.0 38.0 35.2 38.0 70-74 36.71750000000001 38.0 38.0 38.0 35.0 38.0 75-79 36.655150000000006 38.0 38.0 38.0 35.0 38.0 80-84 36.4653 38.0 38.0 38.0 33.8 38.0 85-89 36.4895 38.0 38.0 38.0 34.0 38.0 90-94 36.3621 38.0 38.0 38.0 33.8 38.0 95-99 36.27435 38.0 38.0 38.0 34.0 38.0 100-104 36.0985 38.0 37.2 38.0 33.2 38.0 105-109 35.92645 38.0 37.0 38.0 32.6 38.0 110-114 35.6623 38.0 36.8 38.0 31.0 38.0 115-119 35.551100000000005 38.0 36.2 38.0 30.8 38.0 120-124 35.42475 38.0 36.4 38.0 30.6 38.0 125-129 35.106550000000006 38.0 36.0 38.0 28.2 38.0 130-134 34.76925 38.0 35.0 38.0 27.6 38.0 135-139 34.5629 38.0 35.0 38.0 26.6 38.0 140-144 33.95015 38.0 35.0 38.0 22.6 38.0 145-149 33.17295 38.0 34.0 38.0 17.0 38.0 150-151 29.278 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 3.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 2.0 11 0.0 12 0.0 13 2.0 14 0.0 15 5.0 16 3.0 17 2.0 18 4.0 19 2.0 20 6.0 21 7.0 22 12.0 23 11.0 24 12.0 25 16.0 26 25.0 27 29.0 28 28.0 29 35.0 30 51.0 31 65.0 32 81.0 33 111.0 34 160.0 35 296.0 36 664.0 37 2362.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.4 21.4 13.925 29.275000000000002 2 25.41906429822367 26.79509632224168 31.723792844633476 16.062046534901175 3 19.154788697174293 28.257064266066518 32.13303325831458 20.455113778444613 4 22.66700025018764 34.42581936452339 24.49337002752064 18.413810357768327 5 23.775 35.3 24.375 16.55 6 20.330495743615423 38.5828743114672 23.83575363044567 17.250876314471707 7 20.31523642732049 21.691268451338505 37.3530147610708 20.640480360270203 8 20.365273955466602 26.46985238929197 28.42131598699024 24.74355766825119 9 20.31523642732049 25.969477107830873 31.298473855391546 22.416812609457093 10-14 22.690210594767645 28.832974838677405 27.14721624731129 21.329598319243658 15-19 22.415603900975245 28.502125531382845 28.042010502625658 21.040260065016252 20-24 22.34558639659915 28.967241810452617 27.721930482620653 20.96524131032758 25-29 22.490622655663916 28.51712928232058 27.921980495123783 21.070267566891722 30-34 22.495623905976494 28.072018004501125 28.75218804701175 20.68017004251063 35-39 22.90072518129532 27.996999249812454 27.726931732933235 21.37534383595899 40-44 22.660665166291576 28.362090522630655 28.11202800700175 20.86521630407602 45-49 23.080770192548137 27.886971742935735 28.30207551887972 20.730182545636406 50-54 23.325831457864467 28.017004251062765 28.247061765441362 20.41010252563141 55-59 23.190797699424856 28.077019254813703 28.29707426856714 20.4351087771943 60-64 23.045761440360092 28.31707926981745 27.656914228557138 20.980245061265315 65-69 23.385846461615404 27.581895473868467 28.562140535133786 20.470117529382346 70-74 23.188115840544192 27.564647626669338 28.214875206322215 21.03236132646426 75-79 23.479087452471482 28.497098258955372 27.641584950970582 20.38222933760256 80-84 23.480566254814665 27.997598919513784 27.872542644189885 20.649292181481666 85-89 23.29082270567642 27.741935483870968 27.976994248562143 20.990247561890474 90-94 23.700925231307828 28.367091772943237 27.906976744186046 20.02500625156289 95-99 23.795948987246813 28.16704176044011 28.1470367591898 19.88997249312328 100-104 24.148451958185365 28.164857700195068 27.39458810583704 20.292102235782526 105-109 23.448206872405343 27.699694893212623 28.129845445906064 20.722252788475966 110-114 23.475868967241812 28.08202050512628 27.901975493873472 20.54013503375844 115-119 23.975993998499625 28.387096774193548 27.49187296824206 20.145036259064767 120-124 23.752125637691307 28.523557067120137 27.48324497349205 20.24107232169651 125-129 24.316079019754937 28.64216054013503 27.4368592148037 19.604901225306325 130-134 24.016004001000248 28.11202800700175 27.576894223555886 20.29507376844211 135-139 23.600900225056265 27.941985496374095 27.921980495123783 20.53513378344586 140-144 24.081020255063766 27.731932983245812 28.11202800700175 20.075018754688674 145-149 24.616154038509627 27.991997999499873 27.46686671667917 19.924981245311326 150-151 25.17814726840855 27.340917614701837 27.84098012251531 19.6399549943743 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 1.0 23 2.0 24 2.0 25 4.0 26 6.0 27 4.0 28 3.5 29 10.5 30 14.0 31 20.5 32 30.5 33 36.5 34 49.0 35 68.0 36 88.0 37 109.5 38 132.5 39 163.0 40 212.5 41 260.0 42 276.0 43 277.5 44 286.5 45 294.5 46 276.5 47 250.5 48 224.5 49 188.0 50 156.5 51 130.5 52 105.0 53 87.5 54 68.5 55 43.5 56 30.0 57 23.0 58 15.5 59 14.5 60 14.0 61 7.0 62 5.0 63 3.0 64 0.5 65 0.5 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.025 4 0.075 5 0.0 6 0.15 7 0.075 8 0.075 9 0.075 10-14 0.045 15-19 0.025 20-24 0.025 25-29 0.025 30-34 0.025 35-39 0.025 40-44 0.025 45-49 0.025 50-54 0.025 55-59 0.025 60-64 0.025 65-69 0.025 70-74 0.034999999999999996 75-79 0.06 80-84 0.045 85-89 0.025 90-94 0.025 95-99 0.025 100-104 0.034999999999999996 105-109 0.034999999999999996 110-114 0.025 115-119 0.025 120-124 0.03 125-129 0.025 130-134 0.025 135-139 0.025 140-144 0.025 145-149 0.025 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3193849256365 98.5 2 0.604991177211999 1.2 3 0.050415931434333254 0.15 4 0.0 0.0 5 0.0 0.0 6 0.025207965717166627 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTAAGTAAGGAGACACGATGGCTAAGTTTGCTGTGGCTAATCTCGTGAT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1125 0.0 0.0 0.0 0.0 104-105 0.16249999999999998 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.1875 0.0 0.0 0.0 0.0 110-111 0.225 0.0 0.0 0.0 0.0 112-113 0.3125 0.0 0.0 0.0 0.0 114-115 0.375 0.0 0.0 0.0 0.0 116-117 0.3875 0.0 0.0 0.0 0.0 118-119 0.4375 0.0 0.0 0.0 0.0 120-121 0.5125 0.0 0.0 0.0 0.0 122-123 0.6 0.0 0.0 0.0 0.0 124-125 0.6625000000000001 0.0 0.0 0.0 0.0 126-127 0.8125 0.0 0.0 0.0 0.0 128-129 0.9375 0.0 0.0 0.0 0.0 130-131 0.975 0.0 0.0 0.0 0.0 132-133 1.15 0.0 0.0 0.0 0.0 134-135 1.2999999999999998 0.0 0.0 0.0 0.0 136-137 1.4 0.0 0.0 0.0 0.0 138-139 1.4875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1053292 spots for SRR7030828.sra Written 1053292 spots for SRR7030828.sra Read 1053292 spots for SRR7030828.sra Written 1053292 spots for SRR7030828.sra Read 1053292 spots for SRR7030828.sra Written 1053292 spots for SRR7030828.sra Read 1053292 spots for SRR7030828.sra Written 1053292 spots for SRR7030828.sra Read 1053292 spots for SRR7030828.sra Written 1053292 spots for SRR7030828.sra Read 1053292 spots for SRR7030828.sra Written 1053292 spots for SRR7030828.sra Read 1053292 spots for SRR7030828.sra Written 1053292 spots for SRR7030828.sra Read 1053292 spots for SRR7030828.sra Written 1053292 spots for SRR7030828.sra Read 1053292 spots for SRR7030828.sra Written 1053292 spots for SRR7030828.sra Read 1053300 spots for SRR7030828.sra Written 1053300 spots for SRR7030828.sra Read 1053292 spots for SRR7030828.sra Written 1053292 spots for SRR7030828.sra Read 1053292 spots for SRR7030828.sra Written 1053292 spots for SRR7030828.sra Read 1053292 spots for SRR7030828.sra Written 1053292 spots for SRR7030828.sra Read 1053292 spots for SRR7030828.sra Written 1053292 spots for SRR7030828.sra Read 1053292 spots for SRR7030828.sra Written 1053292 spots for SRR7030828.sra Read 1053292 spots for SRR7030828.sra Written 1053292 spots for SRR7030828.sra Read 1053292 spots for SRR7030828.sra Written 1053292 spots for SRR7030828.sra Read 1053292 spots for SRR7030828.sra Written 1053292 spots for SRR7030828.sra Read 1053292 spots for SRR7030828.sra Written 1053292 spots for SRR7030828.sra Read 1053292 spots for SRR7030828.sra Written 1053292 spots for SRR7030828.sra SRR ids: ['SRR7030828.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_skjl24fb SRR7030828.sra spots: 21065848 blocks: [[1, 1053292], [1053293, 2106584], [2106585, 3159876], [3159877, 4213168], [4213169, 5266460], [5266461, 6319752], [6319753, 7373044], [7373045, 8426336], [8426337, 9479628], [9479629, 10532920], [10532921, 11586212], [11586213, 12639504], [12639505, 13692796], [13692797, 14746088], [14746089, 15799380], [15799381, 16852672], [16852673, 17905964], [17905965, 18959256], [18959257, 20012548], [20012549, 21065848]] SRR7030828 file size 7116824 SRR7030828 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7030828 SRR7030828_1.fastq SRR7030828_2.fastq Input file: SRR7030828_1.fastq Paired file: SRR7030828_2.fastq trimmed: SRR7030828-trimmed-pair1.fastq, SRR7030828-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 21:27:16 2025 >> started Wed Feb 12 21:27:39 2025 >> done (22.529s) 21065848 read pairs processed; of these: 20520 ( 0.10%) short read pairs filtered out after trimming by size control 10871 ( 0.05%) empty read pairs filtered out after trimming by size control 21034457 (99.85%) read pairs available; of these: 8011944 (38.09%) trimmed read pairs available after processing 13022513 (61.91%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 2 0.00% 21 3 0.00% 22 8 0.00% 23 5 0.00% 24 9 0.00% 25 4 0.00% 26 2 0.00% 27 6 0.00% 28 7 0.00% 29 4 0.00% 30 6 0.00% 31 2 0.00% 32 4 0.00% 33 5 0.00% 34 3 0.00% 35 4 0.00% 36 6 0.00% 37 4 0.00% 38 2 0.00% 39 4 0.00% 40 5 0.00% 41 4 0.00% 42 7 0.00% 43 5 0.00% 44 6 0.00% 45 10 0.00% 46 6 0.00% 47 8 0.00% 48 11 0.00% 49 12 0.00% 50 9 0.00% 51 17 0.00% 52 21 0.00% 53 22 0.00% 54 22 0.00% 55 19 0.00% 56 22 0.00% 57 27 0.00% 58 29 0.00% 59 28 0.00% 60 43 0.00% 61 56 0.00% 62 62 0.00% 63 54 0.00% 64 76 0.00% 65 77 0.00% 66 109 0.00% 67 89 0.00% 68 108 0.00% 69 135 0.00% 70 159 0.00% 71 162 0.00% 72 187 0.00% 73 189 0.00% 74 258 0.00% 75 287 0.00% 76 318 0.00% 77 339 0.00% 78 400 0.00% 79 429 0.00% 80 485 0.00% 81 604 0.00% 82 664 0.00% 83 789 0.00% 84 1411 0.01% 85 1829 0.01% 86 1828 0.01% 87 1936 0.01% 88 2196 0.01% 89 2257 0.01% 90 2522 0.01% 91 2729 0.01% 92 2878 0.01% 93 3066 0.01% 94 3354 0.02% 95 3601 0.02% 96 3915 0.02% 97 4173 0.02% 98 4475 0.02% 99 5207 0.02% 100 4920 0.02% 101 5271 0.03% 102 5740 0.03% 103 6160 0.03% 104 6490 0.03% 105 7053 0.03% 106 7643 0.04% 107 7954 0.04% 108 8484 0.04% 109 9162 0.04% 110 9557 0.05% 111 10499 0.05% 112 11248 0.05% 113 12075 0.06% 114 12867 0.06% 115 13750 0.07% 116 14882 0.07% 117 15463 0.07% 118 16226 0.08% 119 17132 0.08% 120 17895 0.09% 121 19120 0.09% 122 20294 0.10% 123 21604 0.10% 124 22823 0.11% 125 24061 0.11% 126 25913 0.12% 127 27307 0.13% 128 29261 0.14% 129 30758 0.15% 130 32684 0.16% 131 35055 0.17% 132 37174 0.18% 133 39985 0.19% 134 43492 0.21% 135 46669 0.22% 136 51473 0.24% 137 55308 0.26% 138 60870 0.29% 139 67167 0.32% 140 72607 0.35% 141 79869 0.38% 142 89693 0.43% 143 102710 0.49% 144 122516 0.58% 145 151290 0.72% 146 196053 0.93% 147 271179 1.29% 148 425263 2.02% 149 874999 4.16% 150 4660436 22.16% 151 13022513 61.91% 21034457 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=5.28 fanout-score-rank=25 prefix-density=0.24 prefix-fanout=4.7 sequence=AACATCTGAATTGCATATGATACGGCTGGAAGTGACCGCAAAGTCATTCGAAGCGGCTCCGATGATATAACGATCACCAGTTCTAACCTCATCACCGAAGACATCGATCACTGCTTCAGCATGAACGGCACGAGGAAATATTGAAGTTGCCGTGAAGGCAAAGAGAAGAAAGGAGAGCACTAGAAAGTTAGT criterion=fanout-score sequence-density=0.05 sequence-density-rank=28 fanout-score=130.03 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=16.0 sequence=TTCTCCTTCTCTTCTTCAGTCTTGGGGTGGTACCCAGGTAACTTCTCCTTGATCTTCTCGAGTAGTCCCTTCTTCTCCTTGGCATCTCCTTCATGGGAAACTGCAGCTTCAGGGGAAACATGTTCAGGAGCTGGAGGAGGGACCTCGTCAGCTTTCTTATGTCCTGGCAATTTCTCCTTGATTTTGTCAAGGAAACCCTTCTTATCCTCTGGTTCATGGGGTGTCTCTGTATGGACTACCTCGACAGGAACACTAGTATCCTCGTGTTCCTTCTCCT criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=34 prefix-density=0.40 prefix-fanout=2.1 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.10 sequence-density-rank=13 fanout-score=99.32 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=19.3 sequence=AAGAGAAGAAAA SRR7030828 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 21:28:22 Started mapping on | Feb 12 21:28:23 Finished on | Feb 12 21:30:08 Mapping speed, Million of reads per hour | 721.18 Number of input reads | 21034457 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 20185091 Uniquely mapped reads % | 95.96% Average mapped length | 297.58 Number of splices: Total | 19055931 Number of splices: Annotated (sjdb) | 18699534 Number of splices: GT/AG | 18772121 Number of splices: GC/AG | 216468 Number of splices: AT/AC | 12720 Number of splices: Non-canonical | 54622 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.80 Insertion rate per base | 0.02% Insertion average length | 2.83 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 585890 % of reads mapped to multiple loci | 2.79% Number of reads mapped to too many loci | 41552 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.03% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 274777 274777 274777 N_multimapping 585890 585890 585890 N_noFeature 398099 19986504 489268 N_ambiguous 206399 1430 98323 UnstrandedReadsAssigned:19580593 PositiveStrandReadsAssigned:197157 NegativeStrandReadsAssigned:19597500 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7030828 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7030828-trimmed-pair1.fastq SRR7030828-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,034,457 reads, 19,531,037 reads pseudoaligned [quant] estimated average fragment length: 268.925 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,007 rounds 52401 SRR7030828.ke.tsv 34699 SRR7030828.se.tsv 87100 total ==> SRR7030828.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1750.08 2465 59.6861 Potri.005G024800.1.v4.1 1035 767.075 1503 83.0298 Potri.004G059700.1.v4.1 961 693.087 12 0.733679 Potri.007G009000.2.v4.1 1416 1148.08 0 0 Potri.003G141000.2.v4.1 2943 2675.08 1059.27 16.7796 Potri.016G087400.1.v4.1 270 63.7904 1605.36 1066.42 Potri.015G069301.1.v4.1 564 301.008 0 0 Potri.010G195200.1.v4.1 1773 1505.08 450 12.6697 Potri.012G127500.1.v4.1 977 709.075 12646 755.742 ==> SRR7030828.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 149 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 258 Potri.001G212900.v4.1 106 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 107 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR7030828 completed mapping pipeline successfully