Starting /dee2/code/volunteer_pipeline.sh SRR7030829 current disk space = 3050641760256 free memory = 1573342228 SRR7030829 SRAfilesize 8bfb6bb8096a77f8fd76ba409c2a7043 SRR7030829.sra SRR7030829.sra file validated SRR7030829 is paired end SRR7030829 is conventional basespace SRR7030829 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030829_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.14375 32.0 25.0 33.0 18.0 34.0 2 31.99325 33.0 31.0 34.0 28.0 34.0 3 32.18525 33.0 33.0 34.0 29.0 34.0 4 32.2805 33.0 33.0 33.0 31.0 34.0 5 32.85275 33.0 33.0 34.0 32.0 34.0 6 36.1915 38.0 36.0 38.0 33.0 38.0 7 36.7545 38.0 37.0 38.0 34.0 38.0 8 37.26875 38.0 38.0 38.0 36.0 38.0 9 37.47075 38.0 38.0 38.0 37.0 38.0 10-14 37.4775 38.0 38.0 38.0 37.0 38.0 15-19 37.467650000000006 38.0 38.0 38.0 37.0 38.0 20-24 37.46795 38.0 38.0 38.0 37.0 38.0 25-29 37.430099999999996 38.0 38.0 38.0 37.0 38.0 30-34 37.3808 38.0 38.0 38.0 37.0 38.0 35-39 37.34345 38.0 38.0 38.0 37.0 38.0 40-44 37.263400000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.278099999999995 38.0 38.0 38.0 37.0 38.0 50-54 37.2346 38.0 38.0 38.0 36.8 38.0 55-59 37.208450000000006 38.0 38.0 38.0 36.2 38.0 60-64 37.17215 38.0 38.0 38.0 36.4 38.0 65-69 37.15925 38.0 38.0 38.0 36.0 38.0 70-74 37.05645 38.0 38.0 38.0 36.0 38.0 75-79 37.0012 38.0 38.0 38.0 35.8 38.0 80-84 36.8287 38.0 38.0 38.0 35.2 38.0 85-89 36.8569 38.0 38.0 38.0 35.4 38.0 90-94 36.78685 38.0 38.0 38.0 35.0 38.0 95-99 36.52115 38.0 38.0 38.0 34.0 38.0 100-104 36.518950000000004 38.0 38.0 38.0 34.0 38.0 105-109 36.42115 38.0 38.0 38.0 34.0 38.0 110-114 36.352 38.0 38.0 38.0 34.0 38.0 115-119 36.18435 38.0 37.4 38.0 33.4 38.0 120-124 35.92715 38.0 37.0 38.0 32.6 38.0 125-129 35.7211 38.0 36.4 38.0 31.4 38.0 130-134 35.2476 38.0 36.0 38.0 29.6 38.0 135-139 35.06535 38.0 35.8 38.0 28.4 38.0 140-144 34.88615 38.0 35.6 38.0 28.2 38.0 145-149 34.336850000000005 38.0 35.0 38.0 27.0 38.0 150-151 31.06175 36.5 31.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 2.0 14 0.0 15 2.0 16 0.0 17 1.0 18 0.0 19 2.0 20 2.0 21 2.0 22 3.0 23 5.0 24 9.0 25 11.0 26 21.0 27 25.0 28 30.0 29 27.0 30 39.0 31 50.0 32 74.0 33 102.0 34 145.0 35 275.0 36 636.0 37 2535.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.96869146374097 12.764249397912764 8.91089108910891 37.356168049237354 2 21.875 12.875 32.975 32.275 3 18.575 17.075000000000003 27.35 37.0 4 22.425 23.375 23.65 30.55 5 23.1615807903952 29.814907453726864 24.187093546773387 22.836418209104554 6 19.8 33.975 24.025 22.2 7 17.275 27.150000000000002 37.85 17.724999999999998 8 18.275 26.125 31.65 23.95 9 18.25 23.75 34.125 23.875 10-14 20.175 29.93 26.32 23.575 15-19 19.814999999999998 27.54 27.994999999999997 24.65 20-24 20.03 28.000000000000004 27.71 24.26 25-29 20.02 28.08 27.884999999999998 24.015 30-34 19.900000000000002 27.675 27.994999999999997 24.43 35-39 20.605 27.97 27.37 24.055 40-44 20.54 28.189999999999998 27.224999999999998 24.044999999999998 45-49 20.380000000000003 27.405 28.03 24.185000000000002 50-54 20.345 28.360000000000003 27.284999999999997 24.01 55-59 20.65 27.715 27.250000000000004 24.385 60-64 20.405 27.810000000000002 27.045 24.740000000000002 65-69 20.13 27.534999999999997 27.3 25.035 70-74 20.78 27.29 27.855 24.075 75-79 20.49 27.175 28.08 24.255 80-84 20.68 27.665 27.54 24.115000000000002 85-89 19.96 27.889999999999997 27.584999999999997 24.565 90-94 20.775 27.925 27.400000000000002 23.9 95-99 20.745 27.389999999999997 27.529999999999998 24.335 100-104 21.545 27.084999999999997 27.175 24.195 105-109 20.830000000000002 28.015 27.485 23.669999999999998 110-114 21.12 27.815 27.425 23.64 115-119 21.560000000000002 27.785 27.250000000000004 23.405 120-124 21.05 27.474999999999998 27.245 24.23 125-129 21.27 27.224999999999998 27.35 24.154999999999998 130-134 20.965 27.355 27.605 24.075 135-139 21.09 27.435 27.800000000000004 23.674999999999997 140-144 21.595 27.625 26.75 24.03 145-149 21.85 27.37 27.255000000000003 23.525 150-151 20.98672677185074 27.39794640621087 26.408715251690456 25.206611570247933 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 1.0 22 1.0 23 1.0 24 2.0 25 3.0 26 3.5 27 2.5 28 3.0 29 6.5 30 11.0 31 15.0 32 23.0 33 32.0 34 44.0 35 66.5 36 83.5 37 92.5 38 112.0 39 140.5 40 159.5 41 190.5 42 207.5 43 227.0 44 267.5 45 271.5 46 274.0 47 277.5 48 258.0 49 230.5 50 200.0 51 162.5 52 133.0 53 106.0 54 82.0 55 68.0 56 51.5 57 48.0 58 44.0 59 31.0 60 21.5 61 16.0 62 11.5 63 6.5 64 3.5 65 2.0 66 1.0 67 0.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.575 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.17500000000000002 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5227329816629 99.05000000000001 2 0.4772670183371013 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.2375 0.0 0.0 0.0 0.0 102-103 0.30000000000000004 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.42500000000000004 0.0 0.0 0.0 0.0 108-109 0.48750000000000004 0.0 0.0 0.0 0.0 110-111 0.525 0.0 0.0 0.0 0.0 112-113 0.65 0.0 0.0 0.0 0.0 114-115 0.775 0.0 0.0 0.0 0.0 116-117 0.8625 0.0 0.0 0.0 0.0 118-119 1.0375 0.0 0.0 0.0 0.0 120-121 1.2375 0.0 0.0 0.0 0.0 122-123 1.375 0.0 0.0 0.0 0.0 124-125 1.5625 0.0 0.0 0.0 0.0 126-127 1.85 0.0 0.0 0.0 0.0 128-129 2.0125 0.0 0.0 0.0 0.0 130-131 2.1875 0.0 0.0 0.0 0.0 132-133 2.525 0.0 0.0 0.0 0.0 134-135 2.8499999999999996 0.0 0.0 0.0 0.0 136-137 3.175 0.0 0.0 0.0 0.0 138-139 3.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7030829 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030829_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.82875 33.0 33.0 34.0 32.0 34.0 2 32.89125 33.0 33.0 34.0 32.0 34.0 3 32.96475 34.0 33.0 34.0 32.0 34.0 4 32.9315 34.0 33.0 34.0 32.0 34.0 5 32.98575 34.0 33.0 34.0 32.0 34.0 6 37.12625 38.0 38.0 38.0 37.0 38.0 7 37.16125 38.0 38.0 38.0 37.0 38.0 8 37.19675 38.0 38.0 38.0 37.0 38.0 9 37.239 38.0 38.0 38.0 37.0 38.0 10-14 37.167649999999995 38.0 38.0 38.0 37.0 38.0 15-19 37.10945 38.0 38.0 38.0 36.6 38.0 20-24 37.0419 38.0 38.0 38.0 36.6 38.0 25-29 37.06255 38.0 38.0 38.0 36.6 38.0 30-34 36.99565 38.0 38.0 38.0 36.0 38.0 35-39 36.91355 38.0 38.0 38.0 36.0 38.0 40-44 36.856049999999996 38.0 38.0 38.0 36.0 38.0 45-49 36.64305 38.0 38.0 38.0 35.0 38.0 50-54 36.866200000000006 38.0 38.0 38.0 36.0 38.0 55-59 36.75189999999999 38.0 38.0 38.0 35.6 38.0 60-64 36.70925 38.0 38.0 38.0 35.0 38.0 65-69 36.652049999999996 38.0 38.0 38.0 35.0 38.0 70-74 36.595749999999995 38.0 38.0 38.0 34.2 38.0 75-79 36.595600000000005 38.0 38.0 38.0 34.8 38.0 80-84 36.38535 38.0 38.0 38.0 33.8 38.0 85-89 36.379599999999996 38.0 38.0 38.0 34.0 38.0 90-94 36.240449999999996 38.0 38.0 38.0 33.6 38.0 95-99 36.149100000000004 38.0 38.0 38.0 33.6 38.0 100-104 36.0221 38.0 37.4 38.0 33.2 38.0 105-109 35.74935 38.0 37.0 38.0 31.4 38.0 110-114 35.450450000000004 38.0 36.8 38.0 30.0 38.0 115-119 35.408 38.0 36.4 38.0 30.2 38.0 120-124 35.30845 38.0 36.2 38.0 29.6 38.0 125-129 34.89245 38.0 35.8 38.0 27.6 38.0 130-134 34.49765 38.0 35.0 38.0 25.2 38.0 135-139 34.2658 38.0 35.0 38.0 24.2 38.0 140-144 33.92305 38.0 35.0 38.0 23.2 38.0 145-149 33.257799999999996 38.0 34.2 38.0 18.2 38.0 150-151 29.24725 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 4.0 4 3.0 5 0.0 6 2.0 7 1.0 8 0.0 9 1.0 10 1.0 11 0.0 12 2.0 13 2.0 14 0.0 15 1.0 16 3.0 17 3.0 18 3.0 19 5.0 20 12.0 21 10.0 22 7.0 23 14.0 24 12.0 25 14.0 26 25.0 27 32.0 28 42.0 29 49.0 30 45.0 31 71.0 32 84.0 33 107.0 34 148.0 35 264.0 36 663.0 37 2364.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.849999999999994 21.25 14.05 29.849999999999998 2 27.215823735603408 25.913870806209317 29.06860290435653 17.801702553830744 3 20.045045045045047 29.004004004004003 30.305305305305307 20.645645645645647 4 22.102628285356694 34.16770963704631 24.505632040050063 19.22403003754693 5 24.575 35.375 22.425 17.625 6 20.170383362565772 39.01277875219243 21.999498872463043 18.817339012778753 7 21.017034068136272 22.344689378757515 37.675350701402806 18.962925851703407 8 21.532298447671508 25.463194792188283 28.818227341011514 24.18627941912869 9 21.957936905358036 24.336504757135703 29.04356534802203 24.661992989484226 10-14 23.371877659308204 29.629073434449616 25.123892476347798 21.87515642989438 15-19 22.5025025025025 28.173173173173172 27.392392392392395 21.93193193193193 20-24 22.80780780780781 28.843843843843842 26.616616616616618 21.73173173173173 25-29 23.003003003003002 28.263263263263262 27.002002002002 21.73173173173173 30-34 23.20820820820821 28.638638638638636 26.886886886886884 21.266266266266264 35-39 22.91187356206862 28.133440032009606 27.20816244873462 21.746523957187154 40-44 22.662266226622663 28.20782078207821 27.23272327232723 21.897189718971894 45-49 23.519991993194214 27.658509733273284 27.37827153080118 21.443226742731323 50-54 22.634239103237753 27.788620327278185 27.568433168192964 22.008707401291097 55-59 22.93793793793794 27.60760760760761 27.65765765765766 21.796796796796798 60-64 23.453453453453456 27.48748748748749 27.05205205205205 22.007007007007008 65-69 23.00800800800801 27.65765765765766 27.62262262262262 21.71171171171171 70-74 23.33833833833834 27.4974974974975 27.94794794794795 21.216216216216218 75-79 23.697251839615557 27.291385092856785 27.516644140761876 21.49471892676578 80-84 24.17538415336103 28.0044046248561 26.86320636668502 20.957004855097853 85-89 23.412559419564673 28.45634225669252 26.599949962471854 21.53114836127095 90-94 24.31931931931932 27.56756756756757 26.8018018018018 21.31131131131131 95-99 24.344344344344343 27.47247247247247 27.062062062062065 21.12112112112112 100-104 24.134134134134133 27.822822822822822 26.936936936936938 21.106106106106107 105-109 24.364364364364363 27.717717717717715 26.786786786786788 21.13113113113113 110-114 23.72872872872873 27.71271271271271 27.137137137137135 21.42142142142142 115-119 23.933933933933936 28.003003003003002 27.007007007007005 21.056056056056054 120-124 23.813813813813812 28.268268268268272 27.037037037037038 20.88088088088088 125-129 23.76876876876877 27.58258258258258 27.442442442442445 21.206206206206208 130-134 24.61961961961962 27.962962962962962 26.646646646646648 20.77077077077077 135-139 24.698463540363345 27.756368550122616 26.89555077323457 20.649617136279467 140-144 24.045438622829405 27.923735174898663 27.293199219336433 20.737626982935495 145-149 25.425425425425423 27.51751751751752 26.716716716716714 20.34034034034034 150-151 24.712356178089045 27.576288144072038 27.01350675337669 20.69784892446223 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.0 6 1.0 7 0.5 8 0.0 9 0.5 10 0.5 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.0 24 0.5 25 1.0 26 2.5 27 4.0 28 5.0 29 5.5 30 9.0 31 12.5 32 16.5 33 24.0 34 30.5 35 49.5 36 75.5 37 92.5 38 116.0 39 148.0 40 183.0 41 213.5 42 254.0 43 273.0 44 269.0 45 278.0 46 276.5 47 249.5 48 244.5 49 227.5 50 189.5 51 161.5 52 128.0 53 100.0 54 78.0 55 64.0 56 52.5 57 49.0 58 39.0 59 27.0 60 15.5 61 8.0 62 7.0 63 4.5 64 1.5 65 1.5 66 0.5 67 0.0 68 1.5 69 1.5 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.15 3 0.1 4 0.125 5 0.0 6 0.22499999999999998 7 0.2 8 0.15 9 0.15 10-14 0.11499999999999999 15-19 0.1 20-24 0.1 25-29 0.1 30-34 0.1 35-39 0.03 40-44 0.01 45-49 0.08499999999999999 50-54 0.08499999999999999 55-59 0.1 60-64 0.1 65-69 0.1 70-74 0.1 75-79 0.11499999999999999 80-84 0.105 85-89 0.075 90-94 0.1 95-99 0.1 100-104 0.1 105-109 0.1 110-114 0.1 115-119 0.1 120-124 0.1 125-129 0.1 130-134 0.1 135-139 0.095 140-144 0.08499999999999999 145-149 0.1 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14184755174155 98.2 2 0.7571933366986371 1.5 3 0.10095911155981827 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.2625 0.0 0.0 0.0 0.0 102-103 0.32499999999999996 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.4625 0.0 0.0 0.0 0.0 108-109 0.5375 0.0 0.0 0.0 0.0 110-111 0.575 0.0 0.0 0.0 0.0 112-113 0.7 0.0 0.0 0.0 0.0 114-115 0.825 0.0 0.0 0.0 0.0 116-117 0.9125 0.0 0.0 0.0 0.0 118-119 1.0875 0.0 0.0 0.0 0.0 120-121 1.2875 0.0 0.0 0.0 0.0 122-123 1.4249999999999998 0.0 0.0 0.0 0.0 124-125 1.6125 0.0 0.0 0.0 0.0 126-127 1.9 0.0 0.0 0.0 0.0 128-129 2.0625 0.0 0.0 0.0 0.0 130-131 2.2750000000000004 0.0 0.0 0.0 0.0 132-133 2.625 0.0 0.0 0.0 0.0 134-135 2.925 0.0 0.0 0.0 0.0 136-137 3.25 0.0 0.0 0.0 0.0 138-139 3.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1060548 spots for SRR7030829.sra Written 1060548 spots for SRR7030829.sra Read 1060548 spots for SRR7030829.sra Written 1060548 spots for SRR7030829.sra Read 1060548 spots for SRR7030829.sra Written 1060548 spots for SRR7030829.sra Read 1060560 spots for SRR7030829.sra Written 1060560 spots for SRR7030829.sra Read 1060548 spots for SRR7030829.sra Written 1060548 spots for SRR7030829.sra Read 1060548 spots for SRR7030829.sra Written 1060548 spots for SRR7030829.sra Read 1060548 spots for SRR7030829.sra Written 1060548 spots for SRR7030829.sra Read 1060548 spots for SRR7030829.sra Written 1060548 spots for SRR7030829.sra Read 1060548 spots for SRR7030829.sra Written 1060548 spots for SRR7030829.sra Read 1060548 spots for SRR7030829.sra Written 1060548 spots for SRR7030829.sra Read 1060548 spots for SRR7030829.sra Written 1060548 spots for SRR7030829.sra Read 1060548 spots for SRR7030829.sra Written 1060548 spots for SRR7030829.sra Read 1060548 spots for SRR7030829.sra Written 1060548 spots for SRR7030829.sra Read 1060548 spots for SRR7030829.sra Read 1060548 spots for SRR7030829.sra Written 1060548 spots for SRR7030829.sra Written 1060548 spots for SRR7030829.sra Read 1060548 spots for SRR7030829.sra Written 1060548 spots for SRR7030829.sra Read 1060548 spots for SRR7030829.sra Written 1060548 spots for SRR7030829.sra Read 1060548 spots for SRR7030829.sra Written 1060548 spots for SRR7030829.sra Read 1060548 spots for SRR7030829.sra Written 1060548 spots for SRR7030829.sra Read 1060548 spots for SRR7030829.sra Written 1060548 spots for SRR7030829.sra SRR ids: ['SRR7030829.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hor2laj7 SRR7030829.sra spots: 21210972 blocks: [[1, 1060548], [1060549, 2121096], [2121097, 3181644], [3181645, 4242192], [4242193, 5302740], [5302741, 6363288], [6363289, 7423836], [7423837, 8484384], [8484385, 9544932], [9544933, 10605480], [10605481, 11666028], [11666029, 12726576], [12726577, 13787124], [13787125, 14847672], [14847673, 15908220], [15908221, 16968768], [16968769, 18029316], [18029317, 19089864], [19089865, 20150412], [20150413, 21210972]] SRR7030829 file size 7166002 SRR7030829 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7030829 SRR7030829_1.fastq SRR7030829_2.fastq Input file: SRR7030829_1.fastq Paired file: SRR7030829_2.fastq trimmed: SRR7030829-trimmed-pair1.fastq, SRR7030829-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 21:49:11 2025 >> started Wed Feb 12 21:49:34 2025 >> done (23.148s) 21210972 read pairs processed; of these: 27148 ( 0.13%) short read pairs filtered out after trimming by size control 17201 ( 0.08%) empty read pairs filtered out after trimming by size control 21166623 (99.79%) read pairs available; of these: 8411870 (39.74%) trimmed read pairs available after processing 12754753 (60.26%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 3 0.00% 20 6 0.00% 21 1 0.00% 22 3 0.00% 23 5 0.00% 24 5 0.00% 25 3 0.00% 26 8 0.00% 27 7 0.00% 28 7 0.00% 29 7 0.00% 30 8 0.00% 31 4 0.00% 32 7 0.00% 33 2 0.00% 34 5 0.00% 35 10 0.00% 36 5 0.00% 37 8 0.00% 38 5 0.00% 39 13 0.00% 40 11 0.00% 41 4 0.00% 42 12 0.00% 43 13 0.00% 44 9 0.00% 45 10 0.00% 46 13 0.00% 47 12 0.00% 48 10 0.00% 49 22 0.00% 50 19 0.00% 51 26 0.00% 52 25 0.00% 53 35 0.00% 54 42 0.00% 55 39 0.00% 56 24 0.00% 57 56 0.00% 58 42 0.00% 59 64 0.00% 60 69 0.00% 61 89 0.00% 62 83 0.00% 63 86 0.00% 64 118 0.00% 65 115 0.00% 66 125 0.00% 67 119 0.00% 68 182 0.00% 69 183 0.00% 70 229 0.00% 71 255 0.00% 72 313 0.00% 73 351 0.00% 74 398 0.00% 75 462 0.00% 76 533 0.00% 77 593 0.00% 78 640 0.00% 79 756 0.00% 80 875 0.00% 81 941 0.00% 82 1148 0.01% 83 1353 0.01% 84 2213 0.01% 85 2904 0.01% 86 3148 0.01% 87 3540 0.02% 88 3874 0.02% 89 4034 0.02% 90 4160 0.02% 91 4552 0.02% 92 4856 0.02% 93 5026 0.02% 94 5283 0.02% 95 5841 0.03% 96 6225 0.03% 97 6588 0.03% 98 7098 0.03% 99 8183 0.04% 100 8264 0.04% 101 8512 0.04% 102 8853 0.04% 103 9646 0.05% 104 10286 0.05% 105 11080 0.05% 106 11955 0.06% 107 12649 0.06% 108 13578 0.06% 109 14365 0.07% 110 15309 0.07% 111 16127 0.08% 112 17091 0.08% 113 18160 0.09% 114 18878 0.09% 115 20316 0.10% 116 21991 0.10% 117 23306 0.11% 118 24563 0.12% 119 25562 0.12% 120 26682 0.13% 121 28238 0.13% 122 29357 0.14% 123 31005 0.15% 124 32683 0.15% 125 34021 0.16% 126 36375 0.17% 127 38468 0.18% 128 40555 0.19% 129 42779 0.20% 130 45621 0.22% 131 48062 0.23% 132 50169 0.24% 133 53170 0.25% 134 56704 0.27% 135 60104 0.28% 136 64779 0.31% 137 70156 0.33% 138 75902 0.36% 139 82656 0.39% 140 87978 0.42% 141 94905 0.45% 142 104857 0.50% 143 117824 0.56% 144 136812 0.65% 145 164141 0.78% 146 207256 0.98% 147 279442 1.32% 148 428054 2.02% 149 864815 4.09% 150 4579653 21.64% 151 12754753 60.26% 21166623 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=33 prefix-density=0.27 prefix-fanout=2.2 sequence=GTGGACTCCTTCTGGATGTTGTAGTCAGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=103.20 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=9.9 sequence=CTTCAAAAAACCAATAAAAAAAGGAAAAGCAACGATCTTTTTGCCAGAGCCCAGGTACAATTTGAACAAAGCAACCCTAACAGATAGCTAGGGACTCATCAAATCTTGGAACCTAGACACCCTTCGGCTTGGAGGCGATAAAACTGATGCACTGCACTTGACGAGTGTTGTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGGGACTGGTGGTGCTCGCGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTGTTGCGAAGAAGGTACTCAATTTCCTGGGCCAATTGCTCAGTAGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGGAGGCCACACCTGCATGCATTGAACTCTTCCGCCATTGCTTGC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.28 fanout-score-rank=33 prefix-density=0.43 prefix-fanout=2.2 sequence=GCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGCTAACAATGACATTACTTCCATTGCAAGCAATGGCGGAAGAGTTCAATGCATGCAGGTGTGGCCTCCAACTGGATTGAAGAAGTTCGAGACTCTTTCTTACCTTCCAGATCTCACTACTGAGCAATTGGCCCAGGAAATTGAGTACCTTCTTCGCAACAAGTGGGTTCCTTGCTTGGAATTCGAGTTGGAGAAAGGTTGGGTCTACCGCGAGCACCACCAGTCCCCAGGGTACTATGATGGACGCTACTGGACTATGTGGAAACTACCCATGTTTGGATGCACTGAGGCATCTCAGGTGCTGATTGAGCTCGAGGAGGCGAAGAAAGCTTACCCTAACTCCTTTATCCGTATCATTGGATTCGACAACACTCGTCAAGTGCAGTGCATCAGTTTTATCGCCTCCAAGCCGAAGGGTGTCTAGGTTCCAAGATTTGATGAGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=40.71 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=6.7 sequence=AGCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR7030829 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 21:50:15 Started mapping on | Feb 12 21:50:15 Finished on | Feb 12 21:52:15 Mapping speed, Million of reads per hour | 635.00 Number of input reads | 21166623 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 20042027 Uniquely mapped reads % | 94.69% Average mapped length | 296.55 Number of splices: Total | 19402679 Number of splices: Annotated (sjdb) | 19120437 Number of splices: GT/AG | 19084877 Number of splices: GC/AG | 256650 Number of splices: AT/AC | 15092 Number of splices: Non-canonical | 46060 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.78 Insertion rate per base | 0.02% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 652194 % of reads mapped to multiple loci | 3.08% Number of reads mapped to too many loci | 262362 % of reads mapped to too many loci | 1.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.84% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 491319 491319 491319 N_multimapping 652194 652194 652194 N_noFeature 310736 19812836 411081 N_ambiguous 240228 980 110790 UnstrandedReadsAssigned:19491063 PositiveStrandReadsAssigned:228211 NegativeStrandReadsAssigned:19520156 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7030829 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7030829-trimmed-pair1.fastq SRR7030829-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,166,623 reads, 19,701,398 reads pseudoaligned [quant] estimated average fragment length: 250.385 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,046 rounds 52401 SRR7030829.ke.tsv 34699 SRR7030829.se.tsv 87100 total ==> SRR7030829.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1768.61 1345 26.2988 Potri.005G024800.1.v4.1 1035 785.615 838 36.8877 Potri.004G059700.1.v4.1 961 711.643 17 0.826103 Potri.007G009000.2.v4.1 1416 1166.61 0 0 Potri.003G141000.2.v4.1 2943 2693.61 484 6.2138 Potri.016G087400.1.v4.1 270 71.7906 1656.49 797.939 Potri.015G069301.1.v4.1 564 318.913 0 0 Potri.010G195200.1.v4.1 1773 1523.61 18 0.40855 Potri.012G127500.1.v4.1 977 727.632 14695 698.402 ==> SRR7030829.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 13 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 436 Potri.001G212900.v4.1 109 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7030829 completed mapping pipeline successfully