Starting /dee2/code/volunteer_pipeline.sh SRR7166120 current disk space = 3110564200448 free memory = 1578108832 SRR7166120 SRAfilesize 7571fabb7b355e810836a4c26d259663 SRR7166120.sra SRR7166120.sra file validated SRR7166120 is paired end SRR7166120 is conventional basespace SRR7166120 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166120_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.3205 33.0 32.0 33.0 28.0 33.0 2 25.684 28.0 18.0 32.0 18.0 33.0 3 30.2515 32.0 30.0 32.0 25.0 33.0 4 29.8435 32.0 30.0 33.0 25.0 33.0 5 31.84975 33.0 32.0 33.0 30.0 33.0 6 36.3175 37.0 36.0 38.0 34.0 38.0 7 36.87975 38.0 37.0 38.0 35.0 38.0 8 37.49125 38.0 38.0 38.0 37.0 38.0 9 37.57725 38.0 38.0 38.0 37.0 38.0 10-14 37.562749999999994 38.0 38.0 38.0 38.0 38.0 15-19 37.62095 38.0 38.0 38.0 38.0 38.0 20-24 37.566050000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.5526 38.0 38.0 38.0 38.0 38.0 30-34 37.517450000000004 38.0 38.0 38.0 38.0 38.0 35-39 37.466049999999996 38.0 38.0 38.0 37.6 38.0 40-44 37.46095 38.0 38.0 38.0 37.6 38.0 45-49 37.46485 38.0 38.0 38.0 37.2 38.0 50-54 37.32645 38.0 38.0 38.0 37.2 38.0 55-59 36.8739 38.0 38.0 38.0 36.6 38.0 60-64 37.109049999999996 38.0 38.0 38.0 36.6 38.0 65-69 37.2658 38.0 38.0 38.0 37.0 38.0 70-74 37.2002 38.0 38.0 38.0 36.6 38.0 75-79 37.15560000000001 38.0 38.0 38.0 36.0 38.0 80-84 37.042649999999995 38.0 38.0 38.0 36.0 38.0 85-89 36.9587 38.0 38.0 38.0 36.0 38.0 90-94 36.8286 38.0 38.0 38.0 35.4 38.0 95-99 36.7465 38.0 38.0 38.0 35.0 38.0 100-104 36.6699 38.0 38.0 38.0 34.6 38.0 105-109 36.51725 38.0 38.0 38.0 34.2 38.0 110-114 36.47885000000001 38.0 38.0 38.0 34.0 38.0 115-119 36.381449999999994 38.0 38.0 38.0 34.2 38.0 120-124 36.1481 38.0 38.0 38.0 33.8 38.0 125-129 36.0321 38.0 37.4 38.0 33.2 38.0 130-134 35.87259999999999 38.0 37.0 38.0 32.6 38.0 135-139 35.68405 38.0 36.4 38.0 31.6 38.0 140-144 35.477250000000005 38.0 36.0 38.0 31.0 38.0 145-149 34.98975 38.0 36.0 38.0 30.4 38.0 150-151 32.183 36.5 33.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 2.0 14 0.0 15 2.0 16 1.0 17 0.0 18 1.0 19 2.0 20 3.0 21 3.0 22 4.0 23 7.0 24 4.0 25 8.0 26 16.0 27 21.0 28 14.0 29 32.0 30 30.0 31 42.0 32 60.0 33 81.0 34 121.0 35 240.0 36 627.0 37 2677.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.13775510204081 18.520408163265305 12.602040816326532 30.739795918367346 2 22.55 24.2 36.575 16.675 3 15.8 31.924999999999997 29.15 23.125 4 20.525 35.625 25.1 18.75 5 21.0 37.625 23.95 17.424999999999997 6 16.150000000000002 38.35 24.45 21.05 7 13.05 21.825 44.95 20.175 8 16.6 22.125 29.7 31.574999999999996 9 17.025000000000002 24.125 31.324999999999996 27.525 10-14 19.115 32.415 25.324999999999996 23.145 15-19 18.86 30.459999999999997 27.445000000000004 23.235 20-24 19.025 30.36 27.815 22.8 25-29 19.05 29.965000000000003 27.975 23.01 30-34 19.634999999999998 30.764999999999997 27.435 22.165000000000003 35-39 19.36 30.81 27.084999999999997 22.745 40-44 20.41 30.895 26.46 22.235 45-49 19.945 30.205 26.995 22.855 50-54 19.120152319871732 30.328690249523998 27.262250726525707 23.288906704078567 55-59 20.03743423715095 29.982800485633348 26.902063941724 23.077701335491703 60-64 19.275115299779426 30.083216362542608 27.68197313013836 22.959695207539603 65-69 19.62 29.815 27.46 23.105 70-74 19.475 29.64 27.66 23.225 75-79 19.580000000000002 30.305 27.445000000000004 22.67 80-84 20.195 29.53 27.115000000000002 23.16 85-89 19.81 29.24 27.500000000000004 23.45 90-94 20.635 29.630000000000003 27.265 22.470000000000002 95-99 20.115 30.11 26.825 22.95 100-104 19.925 30.240000000000002 26.465 23.369999999999997 105-109 20.35637419290255 28.87531908503929 27.67405776064868 23.09424896140948 110-114 20.76 29.385 26.91 22.945 115-119 20.125 29.244999999999997 27.51 23.119999999999997 120-124 20.87 29.154999999999998 26.61 23.365 125-129 20.724999999999998 29.78 26.700000000000003 22.795 130-134 21.14 29.515 25.590000000000003 23.755000000000003 135-139 21.015 29.12 26.384999999999998 23.48 140-144 21.665 29.099999999999998 25.474999999999998 23.76 145-149 20.91 29.360000000000003 25.855 23.875 150-151 21.837066700037543 28.519584532599175 25.203353772994618 24.439994994368664 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 2.0 22 3.5 23 2.5 24 2.0 25 6.0 26 11.0 27 18.0 28 24.0 29 32.5 30 40.0 31 47.5 32 66.5 33 90.0 34 112.0 35 131.0 36 159.0 37 172.5 38 183.0 39 195.0 40 191.5 41 187.5 42 201.0 43 211.5 44 223.0 45 230.5 46 216.5 47 192.0 48 170.5 49 154.5 50 132.5 51 115.5 52 102.0 53 83.5 54 61.5 55 47.5 56 31.0 57 24.5 58 22.5 59 20.5 60 19.0 61 16.0 62 12.5 63 7.5 64 5.0 65 4.0 66 2.5 67 1.5 68 2.5 69 2.5 70 1.0 71 1.0 72 2.0 73 1.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.21 55-59 1.16 60-64 0.26 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.105 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.11249999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.65 #Duplication Level Percentage of deduplicated Percentage of total 1 97.87894464562855 94.6 2 1.4226590791515779 2.75 3 0.3621314019658562 1.05 4 0.1810657009829281 0.7000000000000001 5 0.05173305742369374 0.25 6 0.0775995861355406 0.44999999999999996 7 0.0 0.0 8 0.02586652871184687 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGAAGCTATACTATATAGGTGGCTATCTATCCCTACCAAGGCTTATATTG 8 0.2 No Hit GTAGGGATGAGCATAAACCAACAACTCTCAAAGAAGATGGGAAGCTATAC 6 0.15 No Hit CTTTGATATTCTCTGCATCCTATTTAGGGCTATTGATATTTAACAAATAT 6 0.15 No Hit GCCTCTTTAAAATATCTAAGTGCTGGGGTTATGAGTAGGGATGAGCATAA 6 0.15 No Hit AAAATATCTAAGTGCTGGGGTTATGAGTAGGGATGAGCATAAACCAACAA 5 0.125 No Hit GTGGCTATCTATCCCTACCAAGGCTTATATTGAAGTATAAACCAATGAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.32499999999999996 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.4875 0.0 0.0 0.0 0.0 92-93 0.625 0.0 0.0 0.0 0.0 94-95 0.9125 0.0 0.0 0.0 0.0 96-97 1.125 0.0 0.0 0.0 0.0 98-99 1.2875 0.0 0.0 0.0 0.0 100-101 1.45 0.0 0.0 0.0 0.0 102-103 1.6124999999999998 0.0 0.0 0.0 0.0 104-105 1.875 0.0 0.0 0.0 0.0 106-107 2.175 0.0 0.0 0.0 0.0 108-109 2.4875 0.0 0.0 0.0 0.0 110-111 2.8125 0.0 0.0 0.0 0.0 112-113 3.3 0.0 0.0 0.0 0.0 114-115 3.975 0.0 0.0 0.0 0.0 116-117 4.35 0.0 0.0 0.0 0.0 118-119 5.0 0.0 0.0 0.0 0.0 120-121 5.5625 0.0 0.0 0.0 0.0 122-123 6.0125 0.0 0.0 0.0 0.0 124-125 6.7875 0.0 0.0 0.0 0.0 126-127 7.775 0.0 0.0 0.0 0.0 128-129 8.5125 0.0 0.0 0.0 0.0 130-131 9.425 0.0 0.0 0.0 0.0 132-133 10.1625 0.0 0.0 0.0 0.0 134-135 10.95 0.0 0.0 0.0 0.0 136-137 11.625 0.0 0.0 0.0 0.0 138-139 12.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACATCA 10 0.006846698 144.88751 7 GATCCGG 10 0.006846698 144.88751 5 >>END_MODULE SRR7166120 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166120_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0055 33.0 33.0 34.0 32.0 34.0 2 33.045 34.0 33.0 34.0 32.0 34.0 3 33.17875 34.0 33.0 34.0 32.0 34.0 4 33.12225 34.0 33.0 34.0 33.0 34.0 5 33.0465 34.0 33.0 34.0 32.0 34.0 6 37.33125 38.0 38.0 38.0 37.0 38.0 7 37.306 38.0 38.0 38.0 37.0 38.0 8 37.37 38.0 38.0 38.0 37.0 38.0 9 37.2615 38.0 38.0 38.0 37.0 38.0 10-14 37.28549999999999 38.0 38.0 38.0 37.0 38.0 15-19 37.3129 38.0 38.0 38.0 37.0 38.0 20-24 37.263999999999996 38.0 38.0 38.0 37.0 38.0 25-29 37.21035 38.0 38.0 38.0 37.0 38.0 30-34 37.15675 38.0 38.0 38.0 36.8 38.0 35-39 37.103950000000005 38.0 38.0 38.0 36.8 38.0 40-44 37.1657 38.0 38.0 38.0 37.0 38.0 45-49 37.05159999999999 38.0 38.0 38.0 36.6 38.0 50-54 36.94250000000001 38.0 38.0 38.0 36.0 38.0 55-59 36.85979999999999 38.0 38.0 38.0 36.0 38.0 60-64 36.88535 38.0 38.0 38.0 36.0 38.0 65-69 36.8053 38.0 38.0 38.0 36.0 38.0 70-74 36.763549999999995 38.0 38.0 38.0 35.8 38.0 75-79 36.737049999999996 38.0 38.0 38.0 35.2 38.0 80-84 36.5923 38.0 38.0 38.0 35.0 38.0 85-89 36.4417 38.0 38.0 38.0 34.2 38.0 90-94 36.32995 38.0 38.0 38.0 34.0 38.0 95-99 36.2118 38.0 38.0 38.0 34.0 38.0 100-104 36.093399999999995 38.0 38.0 38.0 33.6 38.0 105-109 35.9362 38.0 37.2 38.0 33.2 38.0 110-114 35.7379 38.0 37.0 38.0 31.6 38.0 115-119 35.5138 38.0 37.0 38.0 30.6 38.0 120-124 35.3382 38.0 36.0 38.0 30.2 38.0 125-129 35.0706 38.0 36.0 38.0 28.2 38.0 130-134 34.773849999999996 38.0 35.2 38.0 27.8 38.0 135-139 34.42725 38.0 35.0 38.0 26.6 38.0 140-144 33.698949999999996 38.0 34.8 38.0 21.8 38.0 145-149 32.72335 38.0 34.0 38.0 15.0 38.0 150-151 28.760125000000002 36.0 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 2.0 4 3.0 5 1.0 6 2.0 7 0.0 8 1.0 9 2.0 10 1.0 11 3.0 12 7.0 13 3.0 14 2.0 15 1.0 16 2.0 17 2.0 18 5.0 19 5.0 20 4.0 21 5.0 22 12.0 23 9.0 24 21.0 25 12.0 26 20.0 27 17.0 28 21.0 29 46.0 30 44.0 31 49.0 32 70.0 33 111.0 34 150.0 35 296.0 36 653.0 37 2415.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.25 15.725 15.125 28.9 2 24.375 21.65 37.0 16.975 3 20.225 26.525 33.300000000000004 19.950000000000003 4 23.5 36.05 22.15 18.3 5 24.775 36.6 21.8 16.825000000000003 6 18.575 37.724999999999994 22.425 21.275 7 18.25 15.024999999999999 45.525 21.2 8 20.7 22.625 27.500000000000004 29.175 9 23.200000000000003 22.675 30.0 24.125 10-14 23.195 28.155 26.66 21.990000000000002 15-19 23.625 27.24 28.07 21.065 20-24 24.265 27.61 27.87 20.255000000000003 25-29 23.94 27.534999999999997 27.865000000000002 20.66 30-34 23.16 27.52 28.634999999999998 20.685000000000002 35-39 23.9 27.505000000000003 28.275 20.32 40-44 23.34 27.815 28.58 20.265 45-49 23.165 27.200000000000003 29.160000000000004 20.474999999999998 50-54 22.985 27.595 28.849999999999998 20.57 55-59 23.23 27.35 29.23 20.19 60-64 22.93 27.845 29.025000000000002 20.200000000000003 65-69 23.25 27.52 28.89 20.34 70-74 23.015 28.105000000000004 28.560000000000002 20.32 75-79 22.96 27.894999999999996 28.744999999999997 20.4 80-84 22.900000000000002 27.894999999999996 28.985 20.22 85-89 23.765 27.805000000000003 29.015 19.415 90-94 23.695 27.389999999999997 29.189999999999998 19.725 95-99 23.455000000000002 27.894999999999996 28.67 19.98 100-104 23.330000000000002 27.450000000000003 29.080000000000002 20.14 105-109 23.369999999999997 27.96 28.65 20.02 110-114 23.294999999999998 28.360000000000003 28.58 19.765 115-119 23.655 28.084999999999997 28.744999999999997 19.515 120-124 23.965 28.449999999999996 28.155 19.43 125-129 24.060000000000002 27.76 28.735 19.445 130-134 24.905 27.465 28.294999999999998 19.335 135-139 25.305 27.91 27.91 18.875 140-144 25.415 27.355 28.215 19.015 145-149 25.75 27.91 27.71 18.63 150-151 25.853231653956744 27.465933241655204 27.82847855981998 18.85235654456807 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 1.5 15 1.0 16 0.0 17 1.5 18 2.5 19 1.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 2.5 26 5.0 27 5.5 28 8.5 29 11.5 30 15.5 31 27.5 32 41.0 33 49.0 34 68.0 35 94.0 36 108.0 37 130.0 38 174.0 39 193.5 40 178.5 41 186.5 42 234.5 43 251.0 44 244.0 45 243.0 46 238.0 47 226.5 48 204.0 49 189.0 50 165.0 51 142.0 52 122.0 53 105.5 54 80.0 55 50.0 56 36.5 57 32.0 58 29.5 59 21.5 60 15.5 61 14.5 62 11.0 63 10.5 64 10.5 65 4.5 66 2.0 67 2.0 68 0.5 69 0.0 70 1.0 71 1.0 72 1.0 73 1.0 74 0.5 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.25 #Duplication Level Percentage of deduplicated Percentage of total 1 98.02597402597402 94.35 2 1.2987012987012987 2.5 3 0.3116883116883117 0.8999999999999999 4 0.15584415584415584 0.6 5 0.05194805194805195 0.25 6 0.05194805194805195 0.3 7 0.0 0.0 8 0.025974025974025976 0.2 9 0.0 0.0 >10 0.07792207792207792 0.8999999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCTCC 14 0.35000000000000003 No Hit TGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCTC 11 0.27499999999999997 No Hit GGGAGGTATCCCAATAGGAGGTTTCCTCCTATGGTTTTCAAAACAATCAC 11 0.27499999999999997 No Hit CCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCTCCTATGGT 8 0.2 No Hit GCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCC 6 0.15 No Hit CTCTCATTGGTTTATACTTCAATATAAGCCTTGGTAGGGATAGATAGCCA 6 0.15 No Hit TGGGAGTATTTGCACTTGTGGTAACGGTATTTGCATTATTGATGGTTTTT 5 0.125 No Hit CTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0125 0.0 24-25 0.0 0.0 0.0 0.025 0.0 26-27 0.0 0.0 0.0 0.025 0.0 28-29 0.0 0.0 0.0 0.025 0.0 30-31 0.0 0.0 0.0 0.025 0.0 32-33 0.0 0.0 0.0 0.025 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.025 0.0 0.0 0.025 0.0 60-61 0.025 0.0 0.0 0.025 0.0 62-63 0.025 0.0 0.0 0.025 0.0 64-65 0.025 0.0 0.0 0.025 0.0 66-67 0.037500000000000006 0.0 0.0 0.025 0.0 68-69 0.05 0.0 0.0 0.025 0.0 70-71 0.05 0.0 0.0 0.025 0.0 72-73 0.05 0.0 0.0 0.025 0.0 74-75 0.1 0.0 0.0 0.025 0.0 76-77 0.125 0.0 0.0 0.025 0.0 78-79 0.125 0.0 0.0 0.025 0.0 80-81 0.1375 0.0 0.0 0.025 0.0 82-83 0.175 0.0 0.0 0.025 0.0 84-85 0.21250000000000002 0.0 0.0 0.025 0.0 86-87 0.32499999999999996 0.0 0.0 0.025 0.0 88-89 0.4 0.0 0.0 0.025 0.0 90-91 0.4875 0.0 0.0 0.025 0.0 92-93 0.625 0.0 0.0 0.025 0.0 94-95 0.9125 0.0 0.0 0.025 0.0 96-97 1.15 0.0 0.0 0.025 0.0 98-99 1.3375 0.0 0.0 0.025 0.0 100-101 1.525 0.0 0.0 0.025 0.0 102-103 1.7374999999999998 0.0 0.0 0.025 0.0 104-105 2.0 0.0 0.0 0.025 0.0 106-107 2.3 0.0 0.0 0.025 0.0 108-109 2.6125 0.0 0.0 0.025 0.0 110-111 2.9625 0.0 0.0 0.025 0.0 112-113 3.45 0.0 0.0 0.025 0.0 114-115 4.075 0.0 0.0 0.025 0.0 116-117 4.425 0.0 0.0 0.025 0.0 118-119 5.025 0.0 0.0 0.025 0.0 120-121 5.5875 0.0 0.0 0.025 0.0 122-123 6.05 0.0 0.0 0.025 0.0 124-125 6.8 0.0 0.0 0.025 0.0 126-127 7.775 0.0 0.0 0.025 0.0 128-129 8.5 0.0 0.0 0.025 0.0 130-131 9.337499999999999 0.0 0.0 0.025 0.0 132-133 10.0625 0.0 0.0 0.025 0.0 134-135 10.850000000000001 0.0 0.0 0.025 0.0 136-137 11.524999999999999 0.0 0.0 0.025 0.0 138-139 12.5125 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGAATT 10 0.006830828 145.0 2 GGAATTC 10 0.006830828 145.0 3 AGAGCGT 65 0.0076375785 13.384615 140-144 >>END_MODULE Read 676854 spots for SRR7166120.sra Written 676854 spots for SRR7166120.sra Read 676854 spots for SRR7166120.sra Written 676854 spots for SRR7166120.sra Read 676854 spots for SRR7166120.sra Written 676854 spots for SRR7166120.sra Read 676854 spots for SRR7166120.sra Written 676854 spots for SRR7166120.sra Read 676854 spots for SRR7166120.sra Written 676854 spots for SRR7166120.sra Read 676854 spots for SRR7166120.sra Written 676854 spots for SRR7166120.sra Read 676854 spots for SRR7166120.sra Written 676854 spots for SRR7166120.sra Read 676854 spots for SRR7166120.sra Written 676854 spots for SRR7166120.sra Read 676854 spots for SRR7166120.sra Written 676854 spots for SRR7166120.sra Read 676854 spots for SRR7166120.sra Written 676854 spots for SRR7166120.sra Read 676854 spots for SRR7166120.sra Written 676854 spots for SRR7166120.sra Read 676854 spots for SRR7166120.sra Written 676854 spots for SRR7166120.sra Read 676854 spots for SRR7166120.sra Written 676854 spots for SRR7166120.sra Read 676854 spots for SRR7166120.sra Written 676854 spots for SRR7166120.sra Read 676854 spots for SRR7166120.sra Written 676854 spots for SRR7166120.sra Read 676854 spots for SRR7166120.sra Written 676854 spots for SRR7166120.sra Read 676854 spots for SRR7166120.sra Written 676854 spots for SRR7166120.sra Read 676854 spots for SRR7166120.sra Written 676854 spots for SRR7166120.sra Read 676860 spots for SRR7166120.sra Written 676860 spots for SRR7166120.sra Read 676854 spots for SRR7166120.sra Written 676854 spots for SRR7166120.sra SRR ids: ['SRR7166120.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7oms31tn SRR7166120.sra spots: 13537086 blocks: [[1, 676854], [676855, 1353708], [1353709, 2030562], [2030563, 2707416], [2707417, 3384270], [3384271, 4061124], [4061125, 4737978], [4737979, 5414832], [5414833, 6091686], [6091687, 6768540], [6768541, 7445394], [7445395, 8122248], [8122249, 8799102], [8799103, 9475956], [9475957, 10152810], [10152811, 10829664], [10829665, 11506518], [11506519, 12183372], [12183373, 12860226], [12860227, 13537086]] SRR7166120 file size 4565573 SRR7166120 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166120 SRR7166120_1.fastq SRR7166120_2.fastq Input file: SRR7166120_1.fastq Paired file: SRR7166120_2.fastq trimmed: SRR7166120-trimmed-pair1.fastq, SRR7166120-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 13:11:39 2025 >> started Fri Feb 14 13:11:58 2025 >> done (18.838s) 13537086 read pairs processed; of these: 7593 ( 0.06%) short read pairs filtered out after trimming by size control 9398 ( 0.07%) empty read pairs filtered out after trimming by size control 13520095 (99.87%) read pairs available; of these: 6384019 (47.22%) trimmed read pairs available after processing 7136076 (52.78%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 3 0.00% 21 2 0.00% 22 5 0.00% 23 4 0.00% 24 10 0.00% 25 3 0.00% 26 8 0.00% 27 3 0.00% 28 5 0.00% 29 7 0.00% 30 4 0.00% 31 9 0.00% 32 8 0.00% 33 9 0.00% 34 3 0.00% 35 8 0.00% 36 15 0.00% 37 10 0.00% 38 14 0.00% 39 8 0.00% 40 11 0.00% 41 18 0.00% 42 14 0.00% 43 19 0.00% 44 32 0.00% 45 37 0.00% 46 44 0.00% 47 40 0.00% 48 40 0.00% 49 69 0.00% 50 77 0.00% 51 86 0.00% 52 98 0.00% 53 95 0.00% 54 121 0.00% 55 124 0.00% 56 144 0.00% 57 177 0.00% 58 209 0.00% 59 234 0.00% 60 285 0.00% 61 339 0.00% 62 405 0.00% 63 477 0.00% 64 497 0.00% 65 572 0.00% 66 649 0.00% 67 640 0.00% 68 801 0.01% 69 951 0.01% 70 1073 0.01% 71 1258 0.01% 72 1586 0.01% 73 1774 0.01% 74 1963 0.01% 75 2267 0.02% 76 2464 0.02% 77 2626 0.02% 78 2852 0.02% 79 3279 0.02% 80 3767 0.03% 81 4405 0.03% 82 5212 0.04% 83 5986 0.04% 84 6974 0.05% 85 7559 0.06% 86 8100 0.06% 87 8850 0.07% 88 9624 0.07% 89 10037 0.07% 90 11034 0.08% 91 11847 0.09% 92 13660 0.10% 93 14477 0.11% 94 16144 0.12% 95 16617 0.12% 96 17728 0.13% 97 17959 0.13% 98 18492 0.14% 99 20043 0.15% 100 20468 0.15% 101 22055 0.16% 102 23627 0.17% 103 25876 0.19% 104 27125 0.20% 105 28942 0.21% 106 29691 0.22% 107 30002 0.22% 108 30631 0.23% 109 31267 0.23% 110 31982 0.24% 111 33999 0.25% 112 36075 0.27% 113 40517 0.30% 114 40398 0.30% 115 42955 0.32% 116 43770 0.32% 117 43635 0.32% 118 44300 0.33% 119 44683 0.33% 120 45500 0.34% 121 47445 0.35% 122 49650 0.37% 123 52126 0.39% 124 54003 0.40% 125 56674 0.42% 126 58110 0.43% 127 57937 0.43% 128 57948 0.43% 129 59818 0.44% 130 60219 0.45% 131 61691 0.46% 132 63331 0.47% 133 66488 0.49% 134 69731 0.52% 135 73015 0.54% 136 75883 0.56% 137 78118 0.58% 138 79736 0.59% 139 81466 0.60% 140 83838 0.62% 141 88079 0.65% 142 94541 0.70% 143 100223 0.74% 144 112714 0.83% 145 130162 0.96% 146 153794 1.14% 147 191126 1.41% 148 269589 1.99% 149 498276 3.69% 150 2483684 18.37% 151 7136076 52.78% 13520095 reads passed initial QC criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=23 prefix-density=0.77 prefix-fanout=2.1 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=177.77 fanout-score-rank=1 prefix-density=0.57 prefix-fanout=2.7 sequence=TTTTTTTCTCGTTCTTTGGTCGCAATCCTGCGTAATCAACGCCGCAACTTTACGTCGGATTAGCTCTTCTTTGATTAGCATGAAACTCCAAGGTCCGGGGGGGTCACTTATCCTGGGCTTCATCCAATGGTGGGTGCTAACTCTTTAATAGCCTTCAGTGACTGTGAGATGCCGTCTACGAGTGGCACGAATCGCACGGATGTTTGGTTAAAGAACAGTCGCAGTTTTCCTCAAATCCCGCCACGAAACTAAGCGATTGAACTCTTGCCTGGTTACTGTATGCCCCTGTGTTATTGCAGCGTCTCGATTAGGGGGAAACCTTGTCACCGTCAGCTTATTCCCGAGGCATATGGCCCTACTTAACTGATCTGAAGTATTACGGTAACCGCGACGATAATAACCCGGACCAAATATAGCCTGATATGAGCGTGCCCGTCCATAGTCCCAGAGACGGGCGGAGGCTCTTAAC criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=2.65 fanout-score-rank=12 prefix-density=0.74 prefix-fanout=2.6 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.23 sequence-density-rank=19 fanout-score=13.55 fanout-score-rank=1 prefix-density=0.93 prefix-fanout=3.4 sequence=TGCAAGTGCGGATCAAACTG SRR7166120 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 13:13:09 Started mapping on | Feb 14 13:13:11 Finished on | Feb 14 13:18:28 Mapping speed, Million of reads per hour | 153.54 Number of input reads | 13520095 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 11016297 Uniquely mapped reads % | 81.48% Average mapped length | 289.28 Number of splices: Total | 8506894 Number of splices: Annotated (sjdb) | 8298671 Number of splices: GT/AG | 8365147 Number of splices: GC/AG | 100743 Number of splices: AT/AC | 7342 Number of splices: Non-canonical | 33662 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.05% Deletion average length | 2.67 Insertion rate per base | 0.03% Insertion average length | 2.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 280030 % of reads mapped to multiple loci | 2.07% Number of reads mapped to too many loci | 79852 % of reads mapped to too many loci | 0.59% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 15.70% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2230634 2230634 2230634 N_multimapping 280030 280030 280030 N_noFeature 407384 10856688 474242 N_ambiguous 146227 857 53068 UnstrandedReadsAssigned:10462686 PositiveStrandReadsAssigned:158752 NegativeStrandReadsAssigned:10488987 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7166120 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166120-trimmed-pair1.fastq SRR7166120-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,520,095 reads, 10,427,321 reads pseudoaligned [quant] estimated average fragment length: 209.761 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,116 rounds 52401 SRR7166120.ke.tsv 34699 SRR7166120.se.tsv 87100 total ==> SRR7166120.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1809.24 989 40.1412 Potri.005G024800.1.v4.1 1035 826.239 657 58.3915 Potri.004G059700.1.v4.1 961 752.239 13 1.26905 Potri.007G009000.2.v4.1 1416 1207.24 0 0 Potri.003G141000.2.v4.1 2943 2734.24 647 17.3763 Potri.016G087400.1.v4.1 270 94.2219 702 547.11 Potri.015G069301.1.v4.1 564 356.938 0 0 Potri.010G195200.1.v4.1 1773 1564.24 155 7.27643 Potri.012G127500.1.v4.1 977 768.239 8934 853.963 ==> SRR7166120.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 77 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 822 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 319 SRR7166120 completed mapping pipeline successfully