Starting /dee2/code/volunteer_pipeline.sh SRR7166121 current disk space = 3110367100928 free memory = 1577102820 SRR7166121 SRAfilesize 0712b175474136d2722e3d8f87b92510 SRR7166121.sra SRR7166121.sra file validated SRR7166121 is paired end SRR7166121 is conventional basespace SRR7166121 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166121_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.509 33.0 27.0 33.0 18.0 34.0 2 30.523 31.0 29.0 33.0 25.0 34.0 3 32.069 33.0 31.0 33.0 29.0 34.0 4 31.8755 33.0 31.0 33.0 29.0 34.0 5 32.652 33.0 33.0 33.0 32.0 34.0 6 36.34225 38.0 36.0 38.0 33.0 38.0 7 36.4685 38.0 36.0 38.0 34.0 38.0 8 37.37825 38.0 38.0 38.0 37.0 38.0 9 37.4855 38.0 38.0 38.0 37.0 38.0 10-14 37.51925 38.0 38.0 38.0 37.0 38.0 15-19 37.577000000000005 38.0 38.0 38.0 38.0 38.0 20-24 37.56275000000001 38.0 38.0 38.0 37.8 38.0 25-29 37.55454999999999 38.0 38.0 38.0 37.6 38.0 30-34 37.5467 38.0 38.0 38.0 38.0 38.0 35-39 37.544599999999996 38.0 38.0 38.0 37.8 38.0 40-44 37.505250000000004 38.0 38.0 38.0 37.2 38.0 45-49 37.4959 38.0 38.0 38.0 37.0 38.0 50-54 37.057300000000005 38.0 38.0 38.0 36.8 38.0 55-59 36.616 38.0 38.0 38.0 36.0 38.0 60-64 36.8548 38.0 38.0 38.0 36.0 38.0 65-69 37.2083 38.0 38.0 38.0 36.0 38.0 70-74 37.145700000000005 38.0 38.0 38.0 36.0 38.0 75-79 37.08135 38.0 38.0 38.0 36.0 38.0 80-84 36.998400000000004 38.0 38.0 38.0 35.8 38.0 85-89 36.9161 38.0 38.0 38.0 35.4 38.0 90-94 36.80915 38.0 38.0 38.0 35.0 38.0 95-99 36.6631 38.0 38.0 38.0 34.8 38.0 100-104 36.37705 38.0 38.0 38.0 34.0 38.0 105-109 35.98965 38.0 37.4 38.0 32.8 38.0 110-114 36.14735 38.0 37.0 38.0 33.2 38.0 115-119 35.976749999999996 38.0 37.0 38.0 33.0 38.0 120-124 35.86295 38.0 36.8 38.0 32.2 38.0 125-129 35.611850000000004 38.0 36.4 38.0 31.4 38.0 130-134 35.48565000000001 38.0 36.0 38.0 31.0 38.0 135-139 35.20555 38.0 36.0 38.0 29.2 38.0 140-144 34.94095 38.0 35.4 38.0 28.2 38.0 145-149 34.52185 38.0 35.0 38.0 27.8 38.0 150-151 30.898125 36.5 31.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 0.0 14 0.0 15 1.0 16 0.0 17 2.0 18 5.0 19 2.0 20 3.0 21 4.0 22 2.0 23 6.0 24 9.0 25 16.0 26 12.0 27 12.0 28 21.0 29 31.0 30 36.0 31 36.0 32 69.0 33 84.0 34 156.0 35 307.0 36 788.0 37 2396.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.203821656050955 18.19108280254777 12.968152866242038 36.63694267515923 2 18.275 26.775 36.5 18.45 3 17.5 30.9 25.275 26.325 4 20.424999999999997 38.550000000000004 21.075 19.950000000000003 5 20.45568352528793 39.05858788182273 21.907861792689033 18.5778668002003 6 16.475 38.2 23.75 21.575 7 12.4 18.775 47.9 20.925 8 18.025 21.45 29.225 31.3 9 19.325 21.275 29.799999999999997 29.599999999999998 10-14 19.99 30.380000000000003 25.865 23.765 15-19 19.875 28.749999999999996 27.185 24.19 20-24 19.73 29.29 27.529999999999998 23.45 25-29 19.66 29.255 27.875 23.21 30-34 19.54 28.82 28.155 23.485 35-39 19.755 29.054999999999996 27.805000000000003 23.385 40-44 19.915 29.435 27.150000000000002 23.5 45-49 19.67 28.910000000000004 27.615000000000002 23.805 50-54 19.630601534113847 29.05732741219217 27.57367783609205 23.73839321760194 55-59 20.523261732668228 28.687773592588822 28.010791000712615 22.778173674030334 60-64 19.302935539190962 28.906486431958033 27.690910925047916 24.09966710380309 65-69 20.07700770077008 29.262926292629267 27.38773877387739 23.27232723272327 70-74 20.05003752814611 29.02176632474356 27.980985739304476 22.947210407805855 75-79 19.950997549877496 28.756437821891094 27.546377318865943 23.746187309365467 80-84 19.650000000000002 28.4 28.365000000000002 23.585 85-89 20.05 29.110000000000003 27.694999999999997 23.145 90-94 19.830000000000002 28.884999999999998 27.82 23.465 95-99 20.08403781701766 28.56285328397779 27.787504376969636 23.565604522034917 100-104 20.158419812503134 28.395247405624907 27.40261693487743 24.043715846994534 105-109 20.44650974845944 28.997878573593294 27.543186180422264 23.012425497525 110-114 20.225 28.744999999999997 27.505000000000003 23.525 115-119 20.558451975135352 28.970322839382394 26.995187487467415 23.47603769801484 120-124 20.111033309992997 28.71361408422527 27.698309492847855 23.477043112933877 125-129 21.077154308617235 28.311623246492985 27.51503006012024 23.09619238476954 130-134 20.808121218182727 28.8293243986598 27.099064859728962 23.263489523428515 135-139 20.9481422213332 29.14937240586088 26.76401460219033 23.138470770615594 140-144 20.605 28.59 27.02 23.785 145-149 21.167408593007554 28.635022257790226 26.75936577802231 23.438203371179913 150-151 20.798898071625345 28.061607813673927 26.73428499874781 24.405209115952918 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 1.0 19 1.5 20 0.5 21 1.5 22 2.5 23 2.5 24 4.0 25 4.5 26 6.0 27 7.5 28 10.5 29 19.0 30 27.5 31 30.5 32 40.5 33 53.0 34 62.0 35 82.0 36 102.0 37 121.0 38 143.5 39 170.5 40 206.5 41 238.5 42 260.5 43 265.0 44 266.5 45 277.0 46 259.0 47 244.0 48 234.5 49 195.0 50 148.0 51 117.5 52 95.5 53 74.5 54 57.0 55 45.5 56 35.0 57 22.0 58 17.5 59 12.0 60 6.5 61 6.5 62 6.0 63 2.0 64 3.5 65 3.0 66 0.0 67 0.5 68 2.5 69 2.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.875 2 0.0 3 0.0 4 0.0 5 0.15 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.9199999999999999 55-59 1.77 60-64 0.8699999999999999 65-69 0.01 70-74 0.075 75-79 0.005 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.045 100-104 0.265 105-109 1.01 110-114 0.0 115-119 0.26 120-124 0.03 125-129 0.2 130-134 0.015 135-139 0.015 140-144 0.0 145-149 0.034999999999999996 150-151 0.17500000000000002 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49748743718592 99.0 2 0.5025125628140703 1.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.07500000000000001 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.7875 0.0 0.0 0.0 0.0 100-101 0.9375 0.0 0.0 0.0 0.0 102-103 1.0750000000000002 0.0 0.0 0.0 0.0 104-105 1.2125 0.0 0.0 0.0 0.0 106-107 1.3875 0.0 0.0 0.0 0.0 108-109 1.675 0.0 0.0 0.0 0.0 110-111 1.85 0.0 0.0 0.0 0.0 112-113 2.0875 0.0 0.0 0.0 0.0 114-115 2.3125 0.0 0.0 0.0 0.0 116-117 2.5875 0.0 0.0 0.0 0.0 118-119 2.9 0.0 0.0 0.0 0.0 120-121 3.1625 0.0 0.0 0.0 0.0 122-123 3.5625 0.0 0.0 0.0 0.0 124-125 4.0 0.0 0.0 0.0 0.0 126-127 4.2625 0.0 0.0 0.0 0.0 128-129 4.5875 0.0 0.0 0.0 0.0 130-131 5.050000000000001 0.0 0.0 0.0 0.0 132-133 5.475 0.0 0.0 0.0 0.0 134-135 5.975 0.0 0.0 0.0 0.0 136-137 6.3875 0.0 0.0 0.0 0.0 138-139 6.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAATAT 10 0.0064039123 148.11537 1 CTCATGT 10 0.0064039123 148.11537 1 >>END_MODULE SRR7166121 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166121_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.75925 33.0 33.0 34.0 32.0 34.0 2 32.8965 33.0 33.0 34.0 32.0 34.0 3 32.95475 33.0 33.0 34.0 32.0 34.0 4 32.93675 33.0 33.0 34.0 32.0 34.0 5 32.908 33.0 33.0 34.0 32.0 34.0 6 37.259 38.0 38.0 38.0 37.0 38.0 7 37.23525 38.0 38.0 38.0 37.0 38.0 8 37.2275 38.0 38.0 38.0 36.0 38.0 9 37.18475 38.0 38.0 38.0 37.0 38.0 10-14 37.1772 38.0 38.0 38.0 36.6 38.0 15-19 37.1617 38.0 38.0 38.0 36.0 38.0 20-24 37.12535 38.0 38.0 38.0 36.0 38.0 25-29 37.051300000000005 38.0 38.0 38.0 36.0 38.0 30-34 36.990199999999994 38.0 38.0 38.0 36.0 38.0 35-39 36.93915 38.0 38.0 38.0 35.8 38.0 40-44 36.877449999999996 38.0 38.0 38.0 35.4 38.0 45-49 36.75749999999999 38.0 38.0 38.0 34.6 38.0 50-54 36.56165 38.0 38.0 38.0 34.0 38.0 55-59 36.425599999999996 38.0 38.0 38.0 34.0 38.0 60-64 36.361000000000004 38.0 37.6 38.0 33.6 38.0 65-69 36.3043 38.0 37.2 38.0 33.4 38.0 70-74 36.1721 38.0 37.0 38.0 33.0 38.0 75-79 35.94425 38.0 37.0 38.0 31.8 38.0 80-84 35.842 38.0 37.0 38.0 31.4 38.0 85-89 35.6683 38.0 36.8 38.0 30.6 38.0 90-94 35.377649999999996 38.0 36.0 38.0 29.0 38.0 95-99 35.0178 38.0 35.8 38.0 28.2 38.0 100-104 34.791700000000006 38.0 35.0 38.0 26.8 38.0 105-109 34.607299999999995 38.0 35.0 38.0 26.4 38.0 110-114 34.18655 38.0 34.0 38.0 23.2 38.0 115-119 33.75935 38.0 34.0 38.0 21.0 38.0 120-124 33.287549999999996 38.0 33.8 38.0 15.0 38.0 125-129 32.83675000000001 37.6 33.2 38.0 15.0 38.0 130-134 32.108799999999995 36.6 31.8 38.0 14.6 38.0 135-139 31.428050000000002 36.0 30.6 38.0 14.0 38.0 140-144 30.253700000000002 35.4 27.0 38.0 10.8 38.0 145-149 28.5024 34.6 21.8 38.0 2.0 38.0 150-151 23.532249999999998 30.5 7.5 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 2.0 8 0.0 9 0.0 10 0.0 11 0.0 12 2.0 13 4.0 14 6.0 15 2.0 16 3.0 17 6.0 18 7.0 19 8.0 20 14.0 21 18.0 22 13.0 23 19.0 24 16.0 25 23.0 26 37.0 27 41.0 28 60.0 29 81.0 30 72.0 31 103.0 32 169.0 33 218.0 34 353.0 35 545.0 36 1040.0 37 1136.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.084521130282575 14.303575893973495 16.004001000250064 31.607901975493874 2 22.725 23.474999999999998 37.475 16.325 3 20.375 26.35 31.474999999999998 21.8 4 23.775 34.625 21.3 20.3 5 24.375 36.7 22.0 16.925 6 17.349999999999998 38.224999999999994 25.2 19.225 7 16.475 14.174999999999999 48.05 21.3 8 19.5 22.225 28.449999999999996 29.825000000000003 9 21.15 24.95 29.2 24.7 10-14 22.53 28.845 27.205000000000002 21.42 15-19 22.55 28.18 28.134999999999998 21.135 20-24 22.439999999999998 28.084999999999997 28.33 21.145 25-29 22.905 27.62 28.78 20.695 30-34 22.07 28.395 28.725 20.810000000000002 35-39 22.905 28.12 28.235 20.74 40-44 23.095 28.43 28.01 20.465 45-49 22.470000000000002 28.139999999999997 28.384999999999998 21.005 50-54 22.82 27.51 28.595 21.075 55-59 23.455000000000002 27.815 28.315 20.415 60-64 23.195 27.650000000000002 28.825 20.330000000000002 65-69 23.365 27.76 28.26 20.615 70-74 23.549999999999997 27.794999999999998 27.765 20.89 75-79 23.055 28.01 28.194999999999997 20.74 80-84 23.205000000000002 27.565 28.43 20.8 85-89 23.39 27.865000000000002 28.315 20.43 90-94 23.45 28.044999999999998 28.425 20.080000000000002 95-99 23.79 27.61 28.470000000000002 20.13 100-104 24.04 28.27 27.634999999999998 20.055 105-109 23.849999999999998 28.18 28.34 19.63 110-114 23.59 28.470000000000002 27.92 20.02 115-119 24.16 28.165000000000003 27.48 20.195 120-124 24.535 28.065 27.474999999999998 19.925 125-129 24.115000000000002 28.265 27.985 19.634999999999998 130-134 24.465 28.15 27.839999999999996 19.545 135-139 24.825 27.91 27.71 19.555 140-144 25.155 28.04 27.205000000000002 19.6 145-149 25.615 27.400000000000002 27.37 19.615 150-151 25.01876407305479 27.270452839629723 27.795846885163872 19.914936202151615 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 1.0 23 3.0 24 4.5 25 4.5 26 2.5 27 2.0 28 6.5 29 6.5 30 11.5 31 26.0 32 34.0 33 43.5 34 55.5 35 66.5 36 84.0 37 111.5 38 150.0 39 186.0 40 204.5 41 230.0 42 252.5 43 271.5 44 291.0 45 286.0 46 263.5 47 255.5 48 239.5 49 194.0 50 151.5 51 122.5 52 104.5 53 80.5 54 61.0 55 49.5 56 41.0 57 29.0 58 15.0 59 10.5 60 9.5 61 11.0 62 9.5 63 4.5 64 3.0 65 3.5 66 2.0 67 0.0 68 1.5 69 1.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49723479135244 98.95 2 0.4524886877828055 0.8999999999999999 3 0.050276520864756154 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.32499999999999996 0.0 0.0 0.0 0.0 94-95 0.42500000000000004 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.7375 0.0 0.0 0.0 0.0 100-101 0.8875 0.0 0.0 0.0 0.0 102-103 1.025 0.0 0.0 0.0 0.0 104-105 1.1625 0.0 0.0 0.0 0.0 106-107 1.325 0.0 0.0 0.0 0.0 108-109 1.6 0.0 0.0 0.0 0.0 110-111 1.75 0.0 0.0 0.0 0.0 112-113 1.9625 0.0 0.0 0.0 0.0 114-115 2.2125 0.0 0.0 0.0 0.0 116-117 2.5 0.0 0.0 0.0 0.0 118-119 2.825 0.0 0.0 0.0 0.0 120-121 3.0875 0.0 0.0 0.0 0.0 122-123 3.4125 0.0 0.0 0.0 0.0 124-125 3.8625000000000003 0.0 0.0 0.0 0.0 126-127 4.1375 0.0 0.0 0.0 0.0 128-129 4.5 0.0 0.0 0.0 0.0 130-131 4.9625 0.0 0.0 0.0 0.0 132-133 5.3875 0.0 0.0 0.0 0.0 134-135 5.9 0.0 0.0 0.0 0.0 136-137 6.275 0.0 0.0 0.0 0.0 138-139 6.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGTGCA 10 0.006830828 145.0 9 ACAACGC 10 0.006830828 145.0 6 >>END_MODULE Read 745648 spots for SRR7166121.sra Written 745648 spots for SRR7166121.sra Read 745648 spots for SRR7166121.sra Written 745648 spots for SRR7166121.sra Read 745648 spots for SRR7166121.sra Written 745648 spots for SRR7166121.sra Read 745648 spots for SRR7166121.sra Written 745648 spots for SRR7166121.sra Read 745648 spots for SRR7166121.sra Written 745648 spots for SRR7166121.sra Read 745648 spots for SRR7166121.sra Written 745648 spots for SRR7166121.sra Read 745648 spots for SRR7166121.sra Written 745648 spots for SRR7166121.sra Read 745648 spots for SRR7166121.sra Written 745648 spots for SRR7166121.sra Read 745648 spots for SRR7166121.sra Written 745648 spots for SRR7166121.sra Read 745648 spots for SRR7166121.sra Written 745648 spots for SRR7166121.sra Read 745648 spots for SRR7166121.sra Written 745648 spots for SRR7166121.sra Read 745648 spots for SRR7166121.sra Written 745648 spots for SRR7166121.sra Read 745648 spots for SRR7166121.sra Written 745648 spots for SRR7166121.sra Read 745648 spots for SRR7166121.sra Written 745648 spots for SRR7166121.sra Read 745648 spots for SRR7166121.sra Written 745648 spots for SRR7166121.sra Read 745648 spots for SRR7166121.sra Written 745648 spots for SRR7166121.sra Read 745648 spots for SRR7166121.sra Written 745648 spots for SRR7166121.sra Read 745648 spots for SRR7166121.sra Written 745648 spots for SRR7166121.sra Read 745661 spots for SRR7166121.sra Written 745661 spots for SRR7166121.sra Read 745648 spots for SRR7166121.sra Written 745648 spots for SRR7166121.sra SRR ids: ['SRR7166121.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_z0r2cuvc SRR7166121.sra spots: 14912973 blocks: [[1, 745648], [745649, 1491296], [1491297, 2236944], [2236945, 2982592], [2982593, 3728240], [3728241, 4473888], [4473889, 5219536], [5219537, 5965184], [5965185, 6710832], [6710833, 7456480], [7456481, 8202128], [8202129, 8947776], [8947777, 9693424], [9693425, 10439072], [10439073, 11184720], [11184721, 11930368], [11930369, 12676016], [12676017, 13421664], [13421665, 14167312], [14167313, 14912973]] SRR7166121 file size 5031816 SRR7166121 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166121 SRR7166121_1.fastq SRR7166121_2.fastq Input file: SRR7166121_1.fastq Paired file: SRR7166121_2.fastq trimmed: SRR7166121-trimmed-pair1.fastq, SRR7166121-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 13:26:29 2025 >> started Fri Feb 14 13:26:52 2025 >> done (22.848s) 14912973 read pairs processed; of these: 4727 ( 0.03%) short read pairs filtered out after trimming by size control 4917 ( 0.03%) empty read pairs filtered out after trimming by size control 14903329 (99.94%) read pairs available; of these: 6501289 (43.62%) trimmed read pairs available after processing 8402040 (56.38%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 5 0.00% 20 5 0.00% 21 6 0.00% 22 5 0.00% 23 5 0.00% 24 7 0.00% 25 3 0.00% 26 5 0.00% 27 6 0.00% 28 6 0.00% 29 6 0.00% 30 5 0.00% 31 6 0.00% 32 11 0.00% 33 6 0.00% 34 10 0.00% 35 11 0.00% 36 12 0.00% 37 14 0.00% 38 16 0.00% 39 14 0.00% 40 12 0.00% 41 14 0.00% 42 11 0.00% 43 17 0.00% 44 29 0.00% 45 20 0.00% 46 26 0.00% 47 34 0.00% 48 35 0.00% 49 50 0.00% 50 41 0.00% 51 53 0.00% 52 53 0.00% 53 67 0.00% 54 63 0.00% 55 72 0.00% 56 90 0.00% 57 81 0.00% 58 120 0.00% 59 131 0.00% 60 157 0.00% 61 162 0.00% 62 185 0.00% 63 220 0.00% 64 235 0.00% 65 287 0.00% 66 318 0.00% 67 360 0.00% 68 418 0.00% 69 496 0.00% 70 534 0.00% 71 608 0.00% 72 740 0.00% 73 847 0.01% 74 915 0.01% 75 1076 0.01% 76 1234 0.01% 77 1389 0.01% 78 1498 0.01% 79 1705 0.01% 80 1885 0.01% 81 2107 0.01% 82 2484 0.02% 83 2786 0.02% 84 3456 0.02% 85 3678 0.02% 86 4115 0.03% 87 4613 0.03% 88 5135 0.03% 89 5416 0.04% 90 5966 0.04% 91 6605 0.04% 92 6978 0.05% 93 7594 0.05% 94 8455 0.06% 95 8850 0.06% 96 9554 0.06% 97 10385 0.07% 98 11082 0.07% 99 12200 0.08% 100 12065 0.08% 101 12933 0.09% 102 13788 0.09% 103 14539 0.10% 104 15529 0.10% 105 16342 0.11% 106 17205 0.12% 107 18023 0.12% 108 18841 0.13% 109 19948 0.13% 110 20690 0.14% 111 22000 0.15% 112 23336 0.16% 113 24371 0.16% 114 25463 0.17% 115 26468 0.18% 116 27662 0.19% 117 28572 0.19% 118 29768 0.20% 119 30698 0.21% 120 32232 0.22% 121 33202 0.22% 122 34920 0.23% 123 36444 0.24% 124 37846 0.25% 125 39411 0.26% 126 40933 0.27% 127 42585 0.29% 128 43595 0.29% 129 45923 0.31% 130 47276 0.32% 131 49667 0.33% 132 52066 0.35% 133 55242 0.37% 134 57479 0.39% 135 59884 0.40% 136 63240 0.42% 137 66643 0.45% 138 71251 0.48% 139 74479 0.50% 140 80157 0.54% 141 86948 0.58% 142 95704 0.64% 143 105847 0.71% 144 119798 0.80% 145 140814 0.94% 146 171331 1.15% 147 224483 1.51% 148 331519 2.22% 149 617278 4.14% 150 2986938 20.04% 151 8402040 56.38% 14903329 reads passed initial QC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=2.45 fanout-score-rank=22 prefix-density=0.53 prefix-fanout=2.1 sequence=CATCTCAGACCTCTC criterion=fanout-score sequence-density=0.04 sequence-density-rank=28 fanout-score=20.40 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=4.5 sequence=TTGTCAATGGTATCAGAGCTCTCCACCTCCAAGGTGATGGTCTT criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=22 prefix-density=0.68 prefix-fanout=2.2 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=25 fanout-score=109.53 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=13.0 sequence=GATTTTGTTATCTCAAAGCTTACACTGTTTATAGTTTGATTACCTGCGCAACAAAATGACACTCTTTGGTAAGATGGAGGCTGAAGTAGAGATCAAAGTTTCTGCTGAAACATTTCATGATATCTTCAGCTGCAGACCACACCACGTTTCCAATATGAGCCCTGCCAAGATACAGAATGTTGATCTGCATGAAGGTGAATGGGGGAAG SRR7166121 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 13:27:58 Started mapping on | Feb 14 13:27:58 Finished on | Feb 14 13:29:51 Mapping speed, Million of reads per hour | 474.80 Number of input reads | 14903329 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 14070235 Uniquely mapped reads % | 94.41% Average mapped length | 293.85 Number of splices: Total | 13759068 Number of splices: Annotated (sjdb) | 13500478 Number of splices: GT/AG | 13538694 Number of splices: GC/AG | 173810 Number of splices: AT/AC | 10235 Number of splices: Non-canonical | 36329 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.04% Deletion average length | 2.37 Insertion rate per base | 0.02% Insertion average length | 2.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 402185 % of reads mapped to multiple loci | 2.70% Number of reads mapped to too many loci | 44932 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.52% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 436365 436365 436365 N_multimapping 402185 402185 402185 N_noFeature 422621 13881065 547104 N_ambiguous 135459 1035 70125 UnstrandedReadsAssigned:13512155 PositiveStrandReadsAssigned:188135 NegativeStrandReadsAssigned:13453006 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7166121 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166121-trimmed-pair1.fastq SRR7166121-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,903,329 reads, 13,334,870 reads pseudoaligned [quant] estimated average fragment length: 236.593 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,070 rounds 52401 SRR7166121.ke.tsv 34699 SRR7166121.se.tsv 87100 total ==> SRR7166121.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1782.41 1049 42.548 Potri.005G024800.1.v4.1 1035 799.407 233 21.0717 Potri.004G059700.1.v4.1 961 725.45 32 3.18899 Potri.007G009000.2.v4.1 1416 1180.41 0 0 Potri.003G141000.2.v4.1 2943 2707.41 560.197 14.9588 Potri.016G087400.1.v4.1 270 83.3858 701 607.766 Potri.015G069301.1.v4.1 564 333.218 0 0 Potri.010G195200.1.v4.1 1773 1537.41 407.886 19.1805 Potri.012G127500.1.v4.1 977 741.418 2807 273.71 ==> SRR7166121.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 14 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 476 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 139 SRR7166121 completed mapping pipeline successfully