Starting /dee2/code/volunteer_pipeline.sh SRR7166122 current disk space = 3110376624128 free memory = 1574831832 SRR7166122 SRAfilesize 645b1baf683765ec200136e9236c1584 SRR7166122.sra SRR7166122.sra file validated SRR7166122 is paired end SRR7166122 is conventional basespace SRR7166122 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166122_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.14475 33.0 33.0 34.0 32.0 34.0 2 32.9645 34.0 33.0 34.0 32.0 34.0 3 32.56425 33.0 33.0 34.0 31.0 34.0 4 32.47425 33.0 33.0 33.0 31.0 34.0 5 32.8505 33.0 33.0 34.0 32.0 34.0 6 36.95225 38.0 37.0 38.0 35.0 38.0 7 37.43125 38.0 38.0 38.0 37.0 38.0 8 37.48775 38.0 38.0 38.0 37.0 38.0 9 37.548 38.0 38.0 38.0 38.0 38.0 10-14 37.52575 38.0 38.0 38.0 37.8 38.0 15-19 37.53605 38.0 38.0 38.0 37.8 38.0 20-24 37.457800000000006 38.0 38.0 38.0 37.0 38.0 25-29 37.4766 38.0 38.0 38.0 37.6 38.0 30-34 37.423500000000004 38.0 38.0 38.0 37.0 38.0 35-39 37.4091 38.0 38.0 38.0 37.0 38.0 40-44 37.37545 38.0 38.0 38.0 37.0 38.0 45-49 37.329750000000004 38.0 38.0 38.0 37.0 38.0 50-54 37.22915 38.0 38.0 38.0 37.0 38.0 55-59 36.86755 38.0 38.0 38.0 36.0 38.0 60-64 37.0439 38.0 38.0 38.0 36.0 38.0 65-69 37.16805 38.0 38.0 38.0 36.2 38.0 70-74 37.055150000000005 38.0 38.0 38.0 36.0 38.0 75-79 37.025349999999996 38.0 38.0 38.0 36.0 38.0 80-84 36.894800000000004 38.0 38.0 38.0 35.4 38.0 85-89 36.84745 38.0 38.0 38.0 35.2 38.0 90-94 36.67274999999999 38.0 38.0 38.0 34.8 38.0 95-99 36.5997 38.0 38.0 38.0 34.0 38.0 100-104 36.5092 38.0 38.0 38.0 34.4 38.0 105-109 36.403 38.0 38.0 38.0 34.0 38.0 110-114 36.34965000000001 38.0 38.0 38.0 33.8 38.0 115-119 36.261100000000006 38.0 37.8 38.0 33.8 38.0 120-124 36.02965 38.0 37.0 38.0 33.2 38.0 125-129 35.787800000000004 38.0 36.8 38.0 32.0 38.0 130-134 35.6083 38.0 36.2 38.0 31.0 38.0 135-139 35.418549999999996 38.0 36.0 38.0 31.0 38.0 140-144 35.2047 38.0 36.0 38.0 30.6 38.0 145-149 34.62885 38.0 35.6 38.0 28.2 38.0 150-151 31.55975 36.5 31.5 38.0 13.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 1.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.0 16 4.0 17 1.0 18 1.0 19 1.0 20 6.0 21 3.0 22 4.0 23 3.0 24 8.0 25 16.0 26 13.0 27 20.0 28 17.0 29 29.0 30 32.0 31 48.0 32 56.0 33 91.0 34 156.0 35 263.0 36 558.0 37 2665.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.643204504735095 19.170719221909394 9.777322754031225 29.40875351932429 2 19.975 24.775 36.775000000000006 18.475 3 17.150000000000002 32.025 27.875 22.95 4 20.775 37.475 23.025000000000002 18.725 5 20.51025512756378 38.11905952976488 23.08654327163582 18.284142071035518 6 16.275000000000002 35.525 26.325 21.875 7 13.225000000000001 19.525000000000002 45.824999999999996 21.425 8 17.549999999999997 21.25 28.4 32.800000000000004 9 17.75 22.225 30.625000000000004 29.4 10-14 19.43 29.09 27.045 24.435000000000002 15-19 19.68 28.32 28.18 23.82 20-24 20.165 28.975 27.775 23.085 25-29 19.85 29.404999999999998 27.96 22.785 30-34 20.015 29.29 27.495000000000005 23.200000000000003 35-39 19.79 28.860000000000003 27.77 23.580000000000002 40-44 20.169999999999998 29.110000000000003 27.560000000000002 23.16 45-49 20.380000000000003 28.485 28.185 22.95 50-54 20.085170340681362 29.138276553106213 27.444889779559116 23.331663326653306 55-59 20.572929823675036 28.575759106754912 27.92906583135452 22.92224523821553 60-64 20.161330727992386 28.703842877899692 27.631644871987575 23.503181522120347 65-69 19.975 28.53 27.725 23.77 70-74 19.835 28.62 27.855 23.69 75-79 20.265 29.07 27.37 23.294999999999998 80-84 20.27 27.894999999999996 28.175 23.66 85-89 20.655 28.849999999999998 27.275 23.22 90-94 20.655 28.37 28.000000000000004 22.975 95-99 20.175 28.51 27.63 23.685000000000002 100-104 20.04 28.835 27.275 23.849999999999998 105-109 20.56144915932746 28.262610088070456 27.847277822257805 23.328662930344276 110-114 19.655 28.33 27.595 24.42 115-119 20.349999999999998 28.945 27.169999999999998 23.535 120-124 20.505000000000003 28.349999999999998 27.42 23.724999999999998 125-129 20.990000000000002 28.68 27.105 23.225 130-134 21.495 28.51 27.07 22.925 135-139 20.64 28.660000000000004 26.6 24.099999999999998 140-144 20.69 28.935 26.85 23.525 145-149 20.875 28.9 26.779999999999998 23.445 150-151 19.97496871088861 28.435544430538172 26.558197747183982 25.03128911138924 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 1.0 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 1.0 15 0.5 16 0.0 17 0.5 18 1.0 19 1.0 20 1.0 21 1.0 22 1.5 23 2.5 24 4.5 25 7.0 26 6.5 27 10.0 28 16.0 29 16.5 30 21.0 31 29.5 32 39.5 33 51.0 34 60.0 35 76.5 36 90.5 37 110.5 38 139.5 39 168.5 40 204.5 41 229.5 42 252.0 43 277.0 44 282.5 45 269.0 46 243.0 47 228.0 48 214.0 49 192.5 50 166.0 51 137.5 52 114.5 53 92.0 54 70.5 55 49.5 56 32.0 57 17.0 58 13.5 59 14.5 60 11.0 61 6.5 62 5.0 63 3.0 64 4.0 65 4.0 66 2.5 67 2.0 68 1.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.325 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.2 55-59 1.035 60-64 0.20500000000000002 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.08 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.325 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.45 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.675 0.0 0.0 0.0 0.0 100-101 0.8625 0.0 0.0 0.0 0.0 102-103 1.1 0.0 0.0 0.0 0.0 104-105 1.325 0.0 0.0 0.0 0.0 106-107 1.45 0.0 0.0 0.0 0.0 108-109 1.6625 0.0 0.0 0.0 0.0 110-111 1.8875000000000002 0.0 0.0 0.0 0.0 112-113 2.125 0.0 0.0 0.0 0.0 114-115 2.45 0.0 0.0 0.0 0.0 116-117 2.975 0.0 0.0 0.0 0.0 118-119 3.5375 0.0 0.0 0.0 0.0 120-121 4.0625 0.0 0.0 0.0 0.0 122-123 4.425 0.0 0.0 0.0 0.0 124-125 4.925 0.0 0.0 0.0 0.0 126-127 5.475 0.0 0.0 0.0 0.0 128-129 6.0375 0.0 0.0 0.0 0.0 130-131 6.6625 0.0 0.0 0.0 0.0 132-133 7.375 0.0 0.0 0.0 0.0 134-135 8.0875 0.0 0.0 0.0 0.0 136-137 8.575 0.0 0.0 0.0 0.0 138-139 9.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATCTCG 10 0.006899958 144.51251 145 >>END_MODULE SRR7166122 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166122_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9675 33.0 33.0 34.0 32.0 34.0 2 32.98375 33.0 33.0 34.0 32.0 34.0 3 33.1395 34.0 33.0 34.0 33.0 34.0 4 33.05025 34.0 33.0 34.0 32.0 34.0 5 33.00675 34.0 33.0 34.0 32.0 34.0 6 37.1885 38.0 38.0 38.0 37.0 38.0 7 37.2535 38.0 38.0 38.0 37.0 38.0 8 37.2265 38.0 38.0 38.0 37.0 38.0 9 37.26375 38.0 38.0 38.0 37.0 38.0 10-14 37.22505 38.0 38.0 38.0 37.0 38.0 15-19 37.18745 38.0 38.0 38.0 37.0 38.0 20-24 37.1332 38.0 38.0 38.0 37.0 38.0 25-29 37.1019 38.0 38.0 38.0 36.8 38.0 30-34 37.05475 38.0 38.0 38.0 36.4 38.0 35-39 36.9497 38.0 38.0 38.0 36.0 38.0 40-44 36.99825 38.0 38.0 38.0 36.0 38.0 45-49 36.85815 38.0 38.0 38.0 36.0 38.0 50-54 36.77905 38.0 38.0 38.0 35.6 38.0 55-59 36.679249999999996 38.0 38.0 38.0 35.2 38.0 60-64 36.7019 38.0 38.0 38.0 35.2 38.0 65-69 36.70035 38.0 38.0 38.0 35.0 38.0 70-74 36.536500000000004 38.0 38.0 38.0 34.2 38.0 75-79 36.51989999999999 38.0 38.0 38.0 34.4 38.0 80-84 36.4069 38.0 38.0 38.0 34.0 38.0 85-89 36.317150000000005 38.0 38.0 38.0 34.0 38.0 90-94 36.115249999999996 38.0 37.6 38.0 33.2 38.0 95-99 35.999649999999995 38.0 37.4 38.0 33.0 38.0 100-104 35.8489 38.0 37.0 38.0 31.6 38.0 105-109 35.705200000000005 38.0 37.0 38.0 31.8 38.0 110-114 35.55505 38.0 37.0 38.0 31.0 38.0 115-119 35.3245 38.0 36.2 38.0 29.2 38.0 120-124 35.12875 38.0 36.0 38.0 28.4 38.0 125-129 34.850049999999996 38.0 35.6 38.0 27.6 38.0 130-134 34.4898 38.0 35.0 38.0 26.0 38.0 135-139 34.15755 38.0 35.0 38.0 24.2 38.0 140-144 33.474900000000005 38.0 34.0 38.0 19.8 38.0 145-149 32.424099999999996 38.0 33.2 38.0 11.4 38.0 150-151 28.3595 36.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 5.0 4 2.0 5 1.0 6 1.0 7 4.0 8 0.0 9 0.0 10 1.0 11 1.0 12 3.0 13 3.0 14 2.0 15 5.0 16 5.0 17 7.0 18 2.0 19 9.0 20 6.0 21 6.0 22 12.0 23 11.0 24 18.0 25 17.0 26 12.0 27 31.0 28 25.0 29 36.0 30 54.0 31 63.0 32 79.0 33 122.0 34 186.0 35 309.0 36 703.0 37 2256.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.575 16.325 12.275 28.825 2 22.525000000000002 24.425 35.35 17.7 3 19.400000000000002 27.05 32.800000000000004 20.75 4 23.730932733183295 35.13378344586147 21.630407601900476 19.504876219054765 5 22.55563890972743 38.18454613653413 21.030257564391096 18.229557389347338 6 18.275 37.35 23.799999999999997 20.575 7 16.675 16.025 45.85 21.45 8 20.75 21.625 27.875 29.75 9 22.025 22.825 29.275000000000002 25.874999999999996 10-14 21.98 28.37 27.71 21.94 15-19 22.16 28.38 27.944999999999997 21.515 20-24 22.435 28.425 27.779999999999998 21.36 25-29 22.17 28.48 28.215 21.135 30-34 22.759999999999998 27.72 28.005000000000003 21.515 35-39 22.775000000000002 28.165000000000003 27.74 21.32 40-44 23.23 28.035 27.85 20.885 45-49 23.055 28.34 27.975 20.630000000000003 50-54 22.925 28.194999999999997 28.58 20.3 55-59 23.36 28.075 27.82 20.745 60-64 22.195 27.73 28.7 21.375 65-69 23.06 28.000000000000004 28.1 20.84 70-74 22.965 28.155 28.189999999999998 20.69 75-79 23.48 28.050000000000004 28.405 20.064999999999998 80-84 23.47 27.855 27.955000000000002 20.72 85-89 23.580000000000002 28.144999999999996 27.694999999999997 20.580000000000002 90-94 23.115 28.235 28.315 20.335 95-99 23.57 27.474999999999998 28.555000000000003 20.4 100-104 23.65 27.555000000000003 28.645 20.150000000000002 105-109 23.52 28.189999999999998 28.449999999999996 19.84 110-114 23.895 27.689999999999998 27.715 20.7 115-119 23.945 28.115000000000002 27.93 20.01 120-124 23.674999999999997 28.015 28.405 19.905 125-129 24.355 28.16 27.224999999999998 20.26 130-134 24.759999999999998 27.794999999999998 27.095000000000002 20.349999999999998 135-139 25.014999999999997 28.1 27.265 19.62 140-144 25.419999999999998 28.199999999999996 26.955000000000002 19.425 145-149 25.430000000000003 27.944999999999997 26.889999999999997 19.735 150-151 25.343835958989747 28.119529882470616 27.59439859964991 18.942235558889724 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 0.5 21 0.5 22 1.0 23 1.0 24 2.0 25 4.5 26 7.5 27 7.0 28 6.0 29 9.5 30 15.5 31 22.0 32 27.5 33 33.5 34 45.0 35 67.5 36 91.0 37 106.0 38 141.5 39 173.0 40 189.0 41 235.5 42 279.0 43 283.0 44 289.0 45 287.0 46 267.0 47 238.5 48 208.5 49 193.5 50 166.0 51 134.5 52 109.0 53 86.0 54 64.0 55 46.5 56 43.0 57 41.0 58 25.5 59 16.5 60 12.0 61 4.0 62 5.0 63 5.5 64 3.0 65 2.0 66 1.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.025 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74924774322969 99.45 2 0.22567703109327986 0.44999999999999996 3 0.0 0.0 4 0.025075225677031094 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.325 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.45 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.675 0.0 0.0 0.0 0.0 100-101 0.875 0.0 0.0 0.0 0.0 102-103 1.125 0.0 0.0 0.0 0.0 104-105 1.35 0.0 0.0 0.0 0.0 106-107 1.475 0.0 0.0 0.0 0.0 108-109 1.6875 0.0 0.0 0.0 0.0 110-111 1.9125 0.0 0.0 0.0 0.0 112-113 2.125 0.0 0.0 0.0 0.0 114-115 2.45 0.0 0.0 0.0 0.0 116-117 2.975 0.0 0.0 0.0 0.0 118-119 3.5375 0.0 0.0 0.0 0.0 120-121 4.0625 0.0 0.0 0.0 0.0 122-123 4.425 0.0 0.0 0.0 0.0 124-125 4.9625 0.0 0.0 0.0 0.0 126-127 5.5125 0.0 0.0 0.0 0.0 128-129 6.1 0.0 0.0 0.0 0.0 130-131 6.75 0.0 0.0 0.0 0.0 132-133 7.4875 0.0 0.0 0.0 0.0 134-135 8.225 0.0 0.0 0.0 0.0 136-137 8.7 0.0 0.0 0.0 0.0 138-139 9.337499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTCATA 10 0.006830828 145.0 8 GTGTAGA 10 0.006830828 145.0 145 ATTGCTT 10 0.006830828 145.0 1 GAATCAA 10 0.006830828 145.0 4 >>END_MODULE Read 796159 spots for SRR7166122.sra Written 796159 spots for SRR7166122.sra Read 796159 spots for SRR7166122.sra Written 796159 spots for SRR7166122.sra Read 796159 spots for SRR7166122.sra Written 796159 spots for SRR7166122.sra Read 796159 spots for SRR7166122.sra Written 796159 spots for SRR7166122.sra Read 796159 spots for SRR7166122.sra Written 796159 spots for SRR7166122.sra Read 796159 spots for SRR7166122.sra Written 796159 spots for SRR7166122.sra Read 796159 spots for SRR7166122.sra Written 796159 spots for SRR7166122.sra Read 796159 spots for SRR7166122.sra Written 796159 spots for SRR7166122.sra Read 796159 spots for SRR7166122.sra Written 796159 spots for SRR7166122.sra Read 796159 spots for SRR7166122.sra Written 796159 spots for SRR7166122.sra Read 796159 spots for SRR7166122.sra Written 796159 spots for SRR7166122.sra Read 796159 spots for SRR7166122.sra Written 796159 spots for SRR7166122.sra Read 796159 spots for SRR7166122.sra Written 796159 spots for SRR7166122.sra Read 796159 spots for SRR7166122.sra Written 796159 spots for SRR7166122.sra Read 796159 spots for SRR7166122.sra Written 796159 spots for SRR7166122.sra Read 796159 spots for SRR7166122.sra Written 796159 spots for SRR7166122.sra Read 796174 spots for SRR7166122.sra Written 796174 spots for SRR7166122.sra Read 796159 spots for SRR7166122.sra Written 796159 spots for SRR7166122.sra Read 796159 spots for SRR7166122.sra Written 796159 spots for SRR7166122.sra Read 796159 spots for SRR7166122.sra Written 796159 spots for SRR7166122.sra SRR ids: ['SRR7166122.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__0jngyv0 SRR7166122.sra spots: 15923195 blocks: [[1, 796159], [796160, 1592318], [1592319, 2388477], [2388478, 3184636], [3184637, 3980795], [3980796, 4776954], [4776955, 5573113], [5573114, 6369272], [6369273, 7165431], [7165432, 7961590], [7961591, 8757749], [8757750, 9553908], [9553909, 10350067], [10350068, 11146226], [11146227, 11942385], [11942386, 12738544], [12738545, 13534703], [13534704, 14330862], [14330863, 15127021], [15127022, 15923195]] SRR7166122 file size 5374147 SRR7166122 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166122 SRR7166122_1.fastq SRR7166122_2.fastq Input file: SRR7166122_1.fastq Paired file: SRR7166122_2.fastq trimmed: SRR7166122-trimmed-pair1.fastq, SRR7166122-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 13:23:10 2025 >> started Fri Feb 14 13:23:32 2025 >> done (21.919s) 15923195 read pairs processed; of these: 9599 ( 0.06%) short read pairs filtered out after trimming by size control 8342 ( 0.05%) empty read pairs filtered out after trimming by size control 15905254 (99.89%) read pairs available; of these: 7095555 (44.61%) trimmed read pairs available after processing 8809699 (55.39%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 7 0.00% 20 11 0.00% 21 7 0.00% 22 6 0.00% 23 2 0.00% 24 6 0.00% 25 8 0.00% 26 5 0.00% 27 4 0.00% 28 7 0.00% 29 9 0.00% 30 6 0.00% 31 10 0.00% 32 16 0.00% 33 13 0.00% 34 12 0.00% 35 20 0.00% 36 15 0.00% 37 7 0.00% 38 15 0.00% 39 15 0.00% 40 13 0.00% 41 19 0.00% 42 26 0.00% 43 26 0.00% 44 18 0.00% 45 25 0.00% 46 33 0.00% 47 51 0.00% 48 35 0.00% 49 58 0.00% 50 56 0.00% 51 63 0.00% 52 81 0.00% 53 80 0.00% 54 83 0.00% 55 102 0.00% 56 93 0.00% 57 143 0.00% 58 152 0.00% 59 180 0.00% 60 208 0.00% 61 249 0.00% 62 243 0.00% 63 287 0.00% 64 327 0.00% 65 383 0.00% 66 377 0.00% 67 478 0.00% 68 556 0.00% 69 587 0.00% 70 732 0.00% 71 860 0.01% 72 1017 0.01% 73 1145 0.01% 74 1248 0.01% 75 1389 0.01% 76 1561 0.01% 77 1831 0.01% 78 1944 0.01% 79 2226 0.01% 80 2531 0.02% 81 2962 0.02% 82 3460 0.02% 83 3997 0.03% 84 4683 0.03% 85 5384 0.03% 86 5738 0.04% 87 6194 0.04% 88 6675 0.04% 89 7119 0.04% 90 8061 0.05% 91 8614 0.05% 92 9580 0.06% 93 10585 0.07% 94 11731 0.07% 95 11950 0.08% 96 12622 0.08% 97 12942 0.08% 98 13767 0.09% 99 15366 0.10% 100 15693 0.10% 101 16680 0.10% 102 18019 0.11% 103 19655 0.12% 104 20720 0.13% 105 22007 0.14% 106 22960 0.14% 107 23210 0.15% 108 24137 0.15% 109 25067 0.16% 110 26083 0.16% 111 27408 0.17% 112 29417 0.18% 113 31651 0.20% 114 33270 0.21% 115 34941 0.22% 116 35340 0.22% 117 36638 0.23% 118 37241 0.23% 119 38326 0.24% 120 39410 0.25% 121 41322 0.26% 122 43377 0.27% 123 45499 0.29% 124 47763 0.30% 125 49631 0.31% 126 51987 0.33% 127 52354 0.33% 128 53405 0.34% 129 55321 0.35% 130 56010 0.35% 131 58643 0.37% 132 61215 0.38% 133 64793 0.41% 134 68314 0.43% 135 71363 0.45% 136 74661 0.47% 137 77633 0.49% 138 80606 0.51% 139 84449 0.53% 140 88746 0.56% 141 94978 0.60% 142 103388 0.65% 143 112289 0.71% 144 129014 0.81% 145 150953 0.95% 146 181725 1.14% 147 233503 1.47% 148 337169 2.12% 149 635332 3.99% 150 3129088 19.67% 151 8809699 55.39% 15905254 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.27 fanout-score-rank=23 prefix-density=0.31 prefix-fanout=2.1 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.09 sequence-density-rank=20 fanout-score=31.86 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=11.3 sequence=CAACACCAGCAA criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=4.59 fanout-score-rank=13 prefix-density=0.62 prefix-fanout=3.3 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.11 sequence-density-rank=21 fanout-score=23.86 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=9.0 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7166122 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 13:24:37 Started mapping on | Feb 14 13:24:38 Finished on | Feb 14 13:26:39 Mapping speed, Million of reads per hour | 473.21 Number of input reads | 15905254 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 14932091 Uniquely mapped reads % | 93.88% Average mapped length | 292.62 Number of splices: Total | 14528644 Number of splices: Annotated (sjdb) | 14266123 Number of splices: GT/AG | 14295253 Number of splices: GC/AG | 184109 Number of splices: AT/AC | 10928 Number of splices: Non-canonical | 38354 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.04% Deletion average length | 2.37 Insertion rate per base | 0.02% Insertion average length | 2.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 408269 % of reads mapped to multiple loci | 2.57% Number of reads mapped to too many loci | 37405 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.25% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 574612 574612 574612 N_multimapping 408269 408269 408269 N_noFeature 448255 14724580 581558 N_ambiguous 148572 1135 73501 UnstrandedReadsAssigned:14335264 PositiveStrandReadsAssigned:206376 NegativeStrandReadsAssigned:14277032 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7166122 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166122-trimmed-pair1.fastq SRR7166122-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,905,254 reads, 14,174,010 reads pseudoaligned [quant] estimated average fragment length: 230.377 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,107 rounds 52401 SRR7166122.ke.tsv 34699 SRR7166122.se.tsv 87100 total ==> SRR7166122.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1788.62 1014 40.7889 Potri.005G024800.1.v4.1 1035 805.623 222 19.8264 Potri.004G059700.1.v4.1 961 731.646 16 1.57341 Potri.007G009000.2.v4.1 1416 1186.62 0 0 Potri.003G141000.2.v4.1 2943 2713.62 571.722 15.1586 Potri.016G087400.1.v4.1 270 88.1724 798 651.168 Potri.015G069301.1.v4.1 564 340.011 0 0 Potri.010G195200.1.v4.1 1773 1543.62 255 11.8856 Potri.012G127500.1.v4.1 977 747.64 2273 218.741 ==> SRR7166122.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 52 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 406 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 149 SRR7166122 completed mapping pipeline successfully