Starting /dee2/code/volunteer_pipeline.sh SRR7166123 current disk space = 3111455002624 free memory = 1448856756 SRR7166123 SRAfilesize bb4e52216f6009adae33a6ec6dd9ac59 SRR7166123.sra SRR7166123.sra file validated SRR7166123 is paired end SRR7166123 is conventional basespace SRR7166123 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166123_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.0845 33.0 18.0 33.0 18.0 34.0 2 30.05475 31.0 28.0 33.0 25.0 34.0 3 31.9475 33.0 31.0 33.0 29.0 34.0 4 32.644 33.0 33.0 33.0 31.0 34.0 5 32.42225 33.0 33.0 33.0 31.0 34.0 6 36.3875 38.0 37.0 38.0 34.0 38.0 7 37.45075 38.0 38.0 38.0 37.0 38.0 8 37.45575 38.0 38.0 38.0 37.0 38.0 9 37.57975 38.0 38.0 38.0 37.0 38.0 10-14 37.5609 38.0 38.0 38.0 37.8 38.0 15-19 37.5944 38.0 38.0 38.0 38.0 38.0 20-24 37.602 38.0 38.0 38.0 38.0 38.0 25-29 37.592699999999994 38.0 38.0 38.0 38.0 38.0 30-34 37.566050000000004 38.0 38.0 38.0 38.0 38.0 35-39 37.54805 38.0 38.0 38.0 38.0 38.0 40-44 37.526399999999995 38.0 38.0 38.0 37.4 38.0 45-49 37.50654999999999 38.0 38.0 38.0 37.0 38.0 50-54 37.173899999999996 38.0 38.0 38.0 36.8 38.0 55-59 36.76890000000001 38.0 38.0 38.0 36.2 38.0 60-64 36.9639 38.0 38.0 38.0 36.0 38.0 65-69 37.165 38.0 38.0 38.0 36.0 38.0 70-74 37.1134 38.0 38.0 38.0 36.0 38.0 75-79 37.089650000000006 38.0 38.0 38.0 36.0 38.0 80-84 37.00335 38.0 38.0 38.0 36.0 38.0 85-89 36.880599999999994 38.0 38.0 38.0 35.6 38.0 90-94 36.81465 38.0 38.0 38.0 35.2 38.0 95-99 36.669 38.0 38.0 38.0 35.0 38.0 100-104 36.40565 38.0 38.0 38.0 34.0 38.0 105-109 36.145399999999995 38.0 37.8 38.0 33.8 38.0 110-114 36.2397 38.0 37.6 38.0 33.8 38.0 115-119 36.048950000000005 38.0 37.0 38.0 33.0 38.0 120-124 35.9223 38.0 37.0 38.0 32.6 38.0 125-129 35.727399999999996 38.0 36.4 38.0 31.4 38.0 130-134 35.5898 38.0 36.0 38.0 31.0 38.0 135-139 35.24714999999999 38.0 36.0 38.0 28.8 38.0 140-144 34.996249999999996 38.0 35.4 38.0 28.2 38.0 145-149 34.52015000000001 38.0 35.0 38.0 27.8 38.0 150-151 31.11475 36.5 31.5 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 1.0 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 3.0 18 2.0 19 3.0 20 4.0 21 3.0 22 1.0 23 5.0 24 3.0 25 8.0 26 9.0 27 16.0 28 22.0 29 28.0 30 40.0 31 50.0 32 70.0 33 98.0 34 153.0 35 281.0 36 726.0 37 2471.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.67622430855113 20.223293580309566 11.291550367926922 32.80893174321238 2 19.35 26.400000000000002 36.7 17.549999999999997 3 17.575 33.375 26.0 23.05 4 20.1 38.725 21.224999999999998 19.950000000000003 5 18.964223167375533 39.02927195396547 24.44333249937453 17.563172379284463 6 15.825 37.55 25.474999999999998 21.15 7 12.9 20.474999999999998 46.225 20.4 8 17.05 21.2 28.875 32.875 9 17.575 22.375 29.925 30.125 10-14 19.54 30.75 26.365 23.345 15-19 19.425 29.73 27.46 23.385 20-24 20.1 29.415000000000003 27.735 22.75 25-29 19.835 30.330000000000002 27.145000000000003 22.689999999999998 30-34 19.48 29.86 27.6 23.06 35-39 20.0 29.89 27.400000000000002 22.71 40-44 19.71 29.165000000000003 27.92 23.205000000000002 45-49 19.325 29.599999999999998 27.689999999999998 23.385 50-54 19.532940761991043 29.115707886657603 27.832301575318336 23.519049776033015 55-59 19.480651214687832 29.852411624486486 27.707054825784855 22.959882335040827 60-64 19.506185255958965 29.39253746354219 27.763250528009653 23.33802675248919 65-69 19.6 29.065 27.855 23.48 70-74 19.91296518607443 29.231692677070832 27.78111244497799 23.074229691876752 75-79 19.56 29.315 28.07 23.055 80-84 19.935 29.549999999999997 27.11 23.405 85-89 20.169999999999998 29.375 27.279999999999998 23.175 90-94 20.3 28.945 28.065 22.689999999999998 95-99 19.965998299914997 29.11645582279114 27.84639231961598 23.071153557677885 100-104 20.230403205609818 29.24618081642875 27.558226897069872 22.96518908089156 105-109 20.2981766898358 28.94127128034653 27.440314294348745 23.320237735468925 110-114 20.8 29.07 27.315 22.814999999999998 115-119 20.926621587778612 29.421487603305785 26.54144753318307 23.110443275732532 120-124 20.24702470247025 29.307930793079308 27.26772677267727 23.17731773177318 125-129 20.930349006058783 29.347553953232186 26.503429973461518 23.21866706724751 130-134 20.41602080104005 29.41647082354118 27.081354067703383 23.086154307715386 135-139 20.691034551727586 29.326466323316165 26.336316815840792 23.646182309115456 140-144 20.815 29.035 26.39 23.76 145-149 20.8020802080208 28.782878287828783 26.542654265426542 23.87238723872387 150-151 21.26674176993366 28.6393791463262 26.19852296908249 23.895356114657655 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 1.5 22 2.0 23 2.0 24 2.5 25 7.5 26 12.0 27 9.5 28 8.5 29 18.0 30 28.5 31 34.5 32 48.5 33 65.5 34 89.5 35 102.0 36 116.0 37 139.5 38 154.5 39 191.0 40 219.5 41 221.5 42 235.0 43 266.0 44 288.0 45 274.0 46 263.5 47 241.0 48 196.0 49 160.5 50 126.5 51 113.5 52 91.5 53 63.5 54 48.0 55 34.5 56 27.5 57 24.0 58 19.0 59 12.5 60 8.0 61 7.5 62 9.0 63 6.5 64 3.0 65 1.5 66 1.0 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4749999999999999 2 0.0 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.655 55-59 1.415 60-64 0.5700000000000001 65-69 0.0 70-74 0.04 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.005 100-104 0.17500000000000002 105-109 0.73 110-114 0.0 115-119 0.17500000000000002 120-124 0.01 125-129 0.145 130-134 0.005 135-139 0.005 140-144 0.0 145-149 0.01 150-151 0.13749999999999998 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.5375 0.0 0.0 0.0 0.0 98-99 0.6625 0.0 0.0 0.0 0.0 100-101 0.775 0.0 0.0 0.0 0.0 102-103 0.9625 0.0 0.0 0.0 0.0 104-105 1.1 0.0 0.0 0.0 0.0 106-107 1.45 0.0 0.0 0.0 0.0 108-109 1.8 0.0 0.0 0.0 0.0 110-111 2.025 0.0 0.0 0.0 0.0 112-113 2.3125 0.0 0.0 0.0 0.0 114-115 2.7875 0.0 0.0 0.0 0.0 116-117 3.1375 0.0 0.0 0.0 0.0 118-119 3.6 0.0 0.0 0.0 0.0 120-121 4.175000000000001 0.0 0.0 0.0 0.0 122-123 4.75 0.0 0.0 0.0 0.0 124-125 5.325 0.0 0.0 0.0 0.0 126-127 5.775 0.0 0.0 0.0 0.0 128-129 6.425000000000001 0.0 0.0 0.0 0.0 130-131 7.0 0.0 0.0 0.0 0.0 132-133 7.425 0.0 0.0 0.0 0.0 134-135 8.0125 0.0 0.0 0.0 0.0 136-137 8.8 0.0 0.0 0.0 0.0 138-139 9.475000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7166123 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166123_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.94575 33.0 33.0 34.0 32.0 34.0 2 32.9945 33.0 33.0 34.0 32.0 34.0 3 33.0895 34.0 33.0 34.0 32.0 34.0 4 33.085 34.0 33.0 34.0 33.0 34.0 5 33.07825 34.0 33.0 34.0 33.0 34.0 6 37.32175 38.0 38.0 38.0 37.0 38.0 7 37.3905 38.0 38.0 38.0 37.0 38.0 8 37.38675 38.0 38.0 38.0 37.0 38.0 9 37.3735 38.0 38.0 38.0 37.0 38.0 10-14 37.320100000000004 38.0 38.0 38.0 37.0 38.0 15-19 37.3065 38.0 38.0 38.0 37.0 38.0 20-24 37.27034999999999 38.0 38.0 38.0 37.0 38.0 25-29 37.20399999999999 38.0 38.0 38.0 36.6 38.0 30-34 37.1563 38.0 38.0 38.0 36.2 38.0 35-39 37.0696 38.0 38.0 38.0 36.0 38.0 40-44 37.0728 38.0 38.0 38.0 36.0 38.0 45-49 36.91845 38.0 38.0 38.0 35.6 38.0 50-54 36.7402 38.0 38.0 38.0 34.8 38.0 55-59 36.66475 38.0 38.0 38.0 34.4 38.0 60-64 36.55159999999999 38.0 38.0 38.0 34.2 38.0 65-69 36.4601 38.0 38.0 38.0 34.0 38.0 70-74 36.353699999999996 38.0 37.4 38.0 34.0 38.0 75-79 36.214150000000004 38.0 37.0 38.0 33.2 38.0 80-84 36.05475 38.0 37.0 38.0 33.0 38.0 85-89 35.813900000000004 38.0 37.0 38.0 31.4 38.0 90-94 35.6188 38.0 36.6 38.0 29.8 38.0 95-99 35.409349999999996 38.0 36.2 38.0 29.2 38.0 100-104 35.122699999999995 38.0 36.0 38.0 28.8 38.0 105-109 34.9067 38.0 35.6 38.0 27.4 38.0 110-114 34.4368 38.0 34.4 38.0 24.8 38.0 115-119 34.08075 38.0 34.0 38.0 23.0 38.0 120-124 33.588350000000005 38.0 34.0 38.0 20.2 38.0 125-129 33.3369 38.0 33.8 38.0 16.2 38.0 130-134 32.68885 37.4 32.8 38.0 15.0 38.0 135-139 31.956349999999997 36.2 31.8 38.0 14.4 38.0 140-144 30.763800000000003 35.8 29.2 38.0 13.4 38.0 145-149 29.359499999999997 34.6 26.0 38.0 4.2 38.0 150-151 24.505625000000002 32.0 11.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 1.0 7 1.0 8 2.0 9 0.0 10 2.0 11 0.0 12 4.0 13 2.0 14 1.0 15 1.0 16 4.0 17 3.0 18 2.0 19 7.0 20 8.0 21 13.0 22 14.0 23 11.0 24 16.0 25 23.0 26 31.0 27 37.0 28 50.0 29 68.0 30 79.0 31 111.0 32 122.0 33 193.0 34 312.0 35 560.0 36 1002.0 37 1318.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.900000000000006 15.35 13.925 30.825000000000003 2 24.25 23.75 35.5 16.5 3 19.925 26.200000000000003 32.625 21.25 4 23.875 34.849999999999994 22.2 19.075 5 21.925 38.550000000000004 21.875 17.65 6 16.775000000000002 39.2 23.825 20.200000000000003 7 17.4 14.975 46.225 21.4 8 20.925 22.025 27.025 30.025000000000002 9 22.125 23.7 28.499999999999996 25.674999999999997 10-14 22.425 28.15 27.944999999999997 21.48 15-19 22.855 27.584999999999997 28.595 20.965 20-24 21.925 28.444999999999997 28.470000000000002 21.16 25-29 22.525000000000002 28.205000000000002 28.71 20.560000000000002 30-34 22.634999999999998 28.249999999999996 28.615000000000002 20.5 35-39 23.445 28.395 28.12 20.04 40-44 22.705000000000002 28.23 28.825 20.24 45-49 23.06 28.189999999999998 28.26 20.49 50-54 22.795 27.73 29.134999999999998 20.34 55-59 23.06 27.955000000000002 28.565 20.419999999999998 60-64 22.845 27.67 29.244999999999997 20.24 65-69 23.189999999999998 27.79 29.09 19.93 70-74 23.225 27.66 29.125 19.99 75-79 23.385 27.284999999999997 29.104999999999997 20.225 80-84 23.625 27.634999999999998 29.03 19.71 85-89 23.315 27.79 28.78 20.115 90-94 23.369999999999997 27.815 28.875 19.939999999999998 95-99 23.28 27.915 28.560000000000002 20.244999999999997 100-104 23.69 27.250000000000004 29.2 19.86 105-109 23.849999999999998 27.51 28.865000000000002 19.775000000000002 110-114 23.96 27.334999999999997 29.310000000000002 19.395 115-119 23.580000000000002 27.800000000000004 28.904999999999998 19.715 120-124 24.0 28.4 27.875 19.725 125-129 23.69 28.075 28.689999999999998 19.545 130-134 24.595 28.194999999999997 27.705000000000002 19.505 135-139 24.79 27.51 28.37 19.33 140-144 25.72 27.68 27.715 18.884999999999998 145-149 25.580000000000002 28.050000000000004 27.42 18.95 150-151 26.297361510566464 27.84794297861698 27.19769913717644 18.656996373640116 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.0 20 0.5 21 0.0 22 0.0 23 1.5 24 3.5 25 5.5 26 6.0 27 6.5 28 7.5 29 10.5 30 21.0 31 33.0 32 36.0 33 40.0 34 58.5 35 75.5 36 98.5 37 127.5 38 147.5 39 184.5 40 210.0 41 231.5 42 257.5 43 274.5 44 287.5 45 280.0 46 259.5 47 225.5 48 204.5 49 193.0 50 169.0 51 138.5 52 105.0 53 77.0 54 57.0 55 41.0 56 32.0 57 22.5 58 14.0 59 13.0 60 10.5 61 8.5 62 7.0 63 5.0 64 2.5 65 0.0 66 0.5 67 1.0 68 2.0 69 2.0 70 1.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77426636568849 99.45 2 0.200652119388011 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.025081514923501375 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCCTATTTT 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.6375 0.0 0.0 0.0 0.0 100-101 0.725 0.0 0.0 0.0 0.0 102-103 0.9125 0.0 0.0 0.0 0.0 104-105 1.0625 0.0 0.0 0.0 0.0 106-107 1.425 0.0 0.0 0.0 0.0 108-109 1.775 0.0 0.0 0.0 0.0 110-111 2.0 0.0 0.0 0.0 0.0 112-113 2.2375 0.0 0.0 0.0 0.0 114-115 2.6625 0.0 0.0 0.0 0.0 116-117 2.9749999999999996 0.0 0.0 0.0 0.0 118-119 3.4124999999999996 0.0 0.0 0.0 0.0 120-121 3.9625 0.0 0.0 0.0 0.0 122-123 4.525 0.0 0.0 0.0 0.0 124-125 5.025 0.0 0.0 0.0 0.0 126-127 5.4 0.0 0.0 0.0 0.0 128-129 5.975 0.0 0.0 0.0 0.0 130-131 6.487500000000001 0.0 0.0 0.0 0.0 132-133 6.9 0.0 0.0 0.0 0.0 134-135 7.4375 0.0 0.0 0.0 0.0 136-137 8.175 0.0 0.0 0.0 0.0 138-139 8.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAATGT 10 0.006830828 145.0 3 >>END_MODULE Read 690553 spots for SRR7166123.sra Written 690553 spots for SRR7166123.sra Read 690553 spots for SRR7166123.sra Written 690553 spots for SRR7166123.sra Read 690553 spots for SRR7166123.sra Written 690553 spots for SRR7166123.sra Read 690553 spots for SRR7166123.sra Written 690553 spots for SRR7166123.sra Read 690553 spots for SRR7166123.sra Written 690553 spots for SRR7166123.sra Read 690553 spots for SRR7166123.sra Written 690553 spots for SRR7166123.sra Read 690553 spots for SRR7166123.sra Written 690553 spots for SRR7166123.sra Read 690553 spots for SRR7166123.sra Written 690553 spots for SRR7166123.sra Read 690553 spots for SRR7166123.sra Written 690553 spots for SRR7166123.sra Read 690557 spots for SRR7166123.sra Written 690557 spots for SRR7166123.sra Read 690553 spots for SRR7166123.sra Written 690553 spots for SRR7166123.sra Read 690553 spots for SRR7166123.sra Written 690553 spots for SRR7166123.sra Read 690553 spots for SRR7166123.sra Written 690553 spots for SRR7166123.sra Read 690553 spots for SRR7166123.sra Written 690553 spots for SRR7166123.sra Read 690553 spots for SRR7166123.sra Written 690553 spots for SRR7166123.sra Read 690553 spots for SRR7166123.sra Written 690553 spots for SRR7166123.sra Read 690553 spots for SRR7166123.sra Written 690553 spots for SRR7166123.sra Read 690553 spots for SRR7166123.sra Written 690553 spots for SRR7166123.sra Read 690553 spots for SRR7166123.sra Written 690553 spots for SRR7166123.sra Read 690553 spots for SRR7166123.sra Written 690553 spots for SRR7166123.sra SRR ids: ['SRR7166123.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_08006ty6 SRR7166123.sra spots: 13811064 blocks: [[1, 690553], [690554, 1381106], [1381107, 2071659], [2071660, 2762212], [2762213, 3452765], [3452766, 4143318], [4143319, 4833871], [4833872, 5524424], [5524425, 6214977], [6214978, 6905530], [6905531, 7596083], [7596084, 8286636], [8286637, 8977189], [8977190, 9667742], [9667743, 10358295], [10358296, 11048848], [11048849, 11739401], [11739402, 12429954], [12429955, 13120507], [13120508, 13811064]] SRR7166123 file size 4658416 SRR7166123 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166123 SRR7166123_1.fastq SRR7166123_2.fastq Input file: SRR7166123_1.fastq Paired file: SRR7166123_2.fastq trimmed: SRR7166123-trimmed-pair1.fastq, SRR7166123-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 12:30:44 2025 >> started Fri Feb 14 12:31:05 2025 >> done (21.465s) 13811064 read pairs processed; of these: 5816 ( 0.04%) short read pairs filtered out after trimming by size control 4258 ( 0.03%) empty read pairs filtered out after trimming by size control 13800990 (99.93%) read pairs available; of these: 6245140 (45.25%) trimmed read pairs available after processing 7555850 (54.75%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 1 0.00% 20 7 0.00% 21 6 0.00% 22 5 0.00% 23 6 0.00% 24 2 0.00% 25 4 0.00% 26 7 0.00% 27 6 0.00% 28 10 0.00% 29 4 0.00% 30 2 0.00% 31 3 0.00% 32 1 0.00% 33 4 0.00% 34 5 0.00% 35 6 0.00% 36 2 0.00% 37 9 0.00% 38 6 0.00% 39 8 0.00% 40 9 0.00% 41 10 0.00% 42 24 0.00% 43 13 0.00% 44 21 0.00% 45 21 0.00% 46 29 0.00% 47 34 0.00% 48 41 0.00% 49 41 0.00% 50 37 0.00% 51 56 0.00% 52 58 0.00% 53 76 0.00% 54 72 0.00% 55 72 0.00% 56 99 0.00% 57 125 0.00% 58 102 0.00% 59 172 0.00% 60 195 0.00% 61 227 0.00% 62 207 0.00% 63 281 0.00% 64 311 0.00% 65 332 0.00% 66 408 0.00% 67 487 0.00% 68 548 0.00% 69 628 0.00% 70 702 0.01% 71 795 0.01% 72 962 0.01% 73 1183 0.01% 74 1242 0.01% 75 1433 0.01% 76 1634 0.01% 77 1779 0.01% 78 1945 0.01% 79 2241 0.02% 80 2528 0.02% 81 2837 0.02% 82 3353 0.02% 83 3901 0.03% 84 4470 0.03% 85 5054 0.04% 86 5539 0.04% 87 5933 0.04% 88 6451 0.05% 89 6931 0.05% 90 7547 0.05% 91 8222 0.06% 92 9083 0.07% 93 10079 0.07% 94 10942 0.08% 95 11518 0.08% 96 12117 0.09% 97 13035 0.09% 98 13888 0.10% 99 14822 0.11% 100 15037 0.11% 101 16364 0.12% 102 17498 0.13% 103 18515 0.13% 104 19759 0.14% 105 20993 0.15% 106 21752 0.16% 107 22633 0.16% 108 23034 0.17% 109 24014 0.17% 110 25198 0.18% 111 26410 0.19% 112 28132 0.20% 113 29471 0.21% 114 31284 0.23% 115 32558 0.24% 116 33848 0.25% 117 34829 0.25% 118 35385 0.26% 119 36184 0.26% 120 37303 0.27% 121 38949 0.28% 122 40397 0.29% 123 42216 0.31% 124 44218 0.32% 125 45328 0.33% 126 47437 0.34% 127 48048 0.35% 128 48950 0.35% 129 51252 0.37% 130 51636 0.37% 131 53865 0.39% 132 56149 0.41% 133 58604 0.42% 134 61068 0.44% 135 64171 0.46% 136 66829 0.48% 137 69408 0.50% 138 72559 0.53% 139 75645 0.55% 140 79365 0.58% 141 85595 0.62% 142 93152 0.67% 143 100736 0.73% 144 114012 0.83% 145 132023 0.96% 146 158286 1.15% 147 204257 1.48% 148 295944 2.14% 149 545817 3.95% 150 2672013 19.36% 151 7555850 54.75% 13800990 reads passed initial QC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.78 fanout-score-rank=20 prefix-density=0.48 prefix-fanout=2.1 sequence=CATCTCAGACCTCTC criterion=fanout-score sequence-density=0.09 sequence-density-rank=19 fanout-score=11.94 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=3.1 sequence=TTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGT criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=2.32 fanout-score-rank=28 prefix-density=0.56 prefix-fanout=2.2 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=22.89 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=3.9 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCAC SRR7166123 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 12:32:07 Started mapping on | Feb 14 12:32:07 Finished on | Feb 14 12:34:23 Mapping speed, Million of reads per hour | 365.32 Number of input reads | 13800990 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 12802860 Uniquely mapped reads % | 92.77% Average mapped length | 292.09 Number of splices: Total | 12145678 Number of splices: Annotated (sjdb) | 11899532 Number of splices: GT/AG | 11941329 Number of splices: GC/AG | 156044 Number of splices: AT/AC | 9964 Number of splices: Non-canonical | 38341 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.04% Deletion average length | 2.27 Insertion rate per base | 0.02% Insertion average length | 2.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 366846 % of reads mapped to multiple loci | 2.66% Number of reads mapped to too many loci | 45660 % of reads mapped to too many loci | 0.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.14% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 637445 637445 637445 N_multimapping 366846 366846 366846 N_noFeature 454556 12634680 553255 N_ambiguous 138073 881 68016 UnstrandedReadsAssigned:12210231 PositiveStrandReadsAssigned:167299 NegativeStrandReadsAssigned:12181589 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7166123 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166123-trimmed-pair1.fastq SRR7166123-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,800,990 reads, 12,132,660 reads pseudoaligned [quant] estimated average fragment length: 226.013 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,083 rounds 52401 SRR7166123.ke.tsv 34699 SRR7166123.se.tsv 87100 total ==> SRR7166123.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1792.99 1291 61.7382 Potri.005G024800.1.v4.1 1035 809.987 218 23.0772 Potri.004G059700.1.v4.1 961 735.992 79 9.20362 Potri.007G009000.2.v4.1 1416 1190.99 0 0 Potri.003G141000.2.v4.1 2943 2717.99 468.539 14.781 Potri.016G087400.1.v4.1 270 89.68 692.575 662.18 Potri.015G069301.1.v4.1 564 343.265 0 0 Potri.010G195200.1.v4.1 1773 1547.99 551 30.5203 Potri.012G127500.1.v4.1 977 751.992 4436 505.805 ==> SRR7166123.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 16 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 404 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 552 SRR7166123 completed mapping pipeline successfully