Starting /dee2/code/volunteer_pipeline.sh SRR7166124 current disk space = 2823707574272 free memory = 1580559084 SRR7166124 SRAfilesize 724c212d659acec8242cbe5df10924d7 SRR7166124.sra SRR7166124.sra file validated SRR7166124 is paired end SRR7166124 is conventional basespace SRR7166124 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166124_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.913 33.0 32.0 34.0 30.0 34.0 2 32.255 33.0 33.0 34.0 29.0 34.0 3 32.24275 33.0 33.0 34.0 30.0 34.0 4 32.172 33.0 33.0 34.0 31.0 34.0 5 32.38875 33.0 33.0 34.0 31.0 34.0 6 36.279 38.0 37.0 38.0 33.0 38.0 7 36.76 38.0 37.0 38.0 35.0 38.0 8 36.871 38.0 38.0 38.0 35.0 38.0 9 36.921 38.0 38.0 38.0 35.0 38.0 10-14 37.0603 38.0 38.0 38.0 35.6 38.0 15-19 36.97095 38.0 38.0 38.0 35.4 38.0 20-24 36.9913 38.0 38.0 38.0 35.4 38.0 25-29 36.779450000000004 38.0 38.0 38.0 34.8 38.0 30-34 36.574400000000004 38.0 38.0 38.0 34.0 38.0 35-39 36.4279 38.0 37.4 38.0 33.8 38.0 40-44 36.27935000000001 38.0 37.0 38.0 33.4 38.0 45-49 36.254749999999994 38.0 37.0 38.0 33.2 38.0 50-54 36.068 38.0 37.0 38.0 32.4 38.0 55-59 35.7495 38.0 36.4 38.0 30.2 38.0 60-64 35.84394999999999 38.0 37.0 38.0 30.8 38.0 65-69 35.65715 38.0 36.2 38.0 30.0 38.0 70-74 35.769349999999996 38.0 36.6 38.0 30.6 38.0 75-79 35.0289 38.0 36.0 38.0 28.8 38.0 80-84 34.69135 38.0 35.6 38.0 27.4 38.0 85-89 34.89945 38.0 35.2 38.0 27.8 38.0 90-94 34.7385 38.0 34.8 38.0 26.8 38.0 95-99 34.43565 38.0 34.2 38.0 25.0 38.0 100-104 34.2404 38.0 34.0 38.0 24.6 38.0 105-109 33.5629 37.4 33.6 38.0 18.2 38.0 110-114 33.301199999999994 37.0 32.8 38.0 17.8 38.0 115-119 32.723349999999996 37.0 31.0 38.0 15.0 38.0 120-124 32.44025 36.8 30.6 38.0 15.0 38.0 125-129 31.794149999999995 36.4 30.4 38.0 14.8 38.0 130-134 29.961599999999997 34.2 25.2 38.0 13.4 38.0 135-139 28.744600000000002 33.0 22.2 38.0 12.4 38.0 140-144 27.896300000000004 33.0 20.4 38.0 3.8 38.0 145-149 25.315500000000004 33.0 9.6 38.0 2.0 38.0 150-151 19.481625 17.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 1.0 9 1.0 10 0.0 11 4.0 12 0.0 13 1.0 14 0.0 15 2.0 16 4.0 17 2.0 18 1.0 19 3.0 20 15.0 21 15.0 22 20.0 23 16.0 24 30.0 25 54.0 26 53.0 27 74.0 28 107.0 29 135.0 30 164.0 31 195.0 32 255.0 33 337.0 34 413.0 35 596.0 36 875.0 37 626.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.888635788408 18.83067577828398 8.85851683118198 32.42217160212604 2 18.2 25.25 36.9 19.650000000000002 3 17.599999999999998 31.424999999999997 26.8 24.175 4 21.7 38.15 20.474999999999998 19.675 5 18.475 38.975 23.95 18.6 6 15.375 36.6 25.25 22.775000000000002 7 13.900000000000002 20.025000000000002 44.574999999999996 21.5 8 17.625 21.175 28.999999999999996 32.2 9 18.3 21.675 29.775000000000002 30.25 10-14 18.84 29.92 27.065 24.175 15-19 18.88 29.099999999999998 27.715 24.305 20-24 19.425 29.67 27.655 23.25 25-29 19.009999999999998 29.330000000000002 28.455000000000002 23.205000000000002 30-34 20.175 29.07 27.46 23.294999999999998 35-39 19.794999999999998 29.615000000000002 27.74 22.85 40-44 19.545 29.395 27.555000000000003 23.505000000000003 45-49 19.775000000000002 30.070000000000004 26.915 23.24 50-54 19.685 29.404999999999998 27.425 23.485 55-59 19.71 29.154999999999998 27.62 23.515 60-64 20.02 28.99 27.42 23.57 65-69 19.825 29.39 28.005000000000003 22.78 70-74 20.039007801560313 29.370874174834967 27.515503100620126 23.074614922984598 75-79 19.44669639237941 28.79002837454398 28.02999594649372 23.733279286582896 80-84 19.79600121790318 28.90997665685578 28.143712574850298 23.150309550390745 85-89 20.015 28.575 28.185 23.225 90-94 19.98 28.99 27.805000000000003 23.225 95-99 19.91 28.925 27.715 23.45 100-104 20.24 28.660000000000004 27.805000000000003 23.294999999999998 105-109 20.04 29.189999999999998 27.810000000000002 22.96 110-114 20.724999999999998 29.115000000000002 27.125 23.035 115-119 20.849999999999998 29.235 26.979999999999997 22.935 120-124 20.300075018754686 29.03225806451613 27.56689172293073 23.10077519379845 125-129 20.56411282256451 28.195639127825565 27.845569113822766 23.39467893578716 130-134 20.82977118430978 28.68493839577571 26.98013578073925 23.505154639175256 135-139 20.731402271249184 28.820851468307566 27.38005903246786 23.067687227975387 140-144 21.2874506077127 28.269894463062073 27.499624868704046 22.94303006052118 145-149 21.289385362921404 28.172118419075286 26.73946801582928 23.79902820217402 150-151 21.778334376956792 26.399499060738883 27.08829054477145 24.733876017532875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.5 14 0.5 15 0.0 16 0.5 17 0.5 18 1.5 19 1.5 20 0.5 21 0.5 22 0.5 23 4.0 24 6.5 25 5.5 26 7.5 27 8.5 28 10.5 29 15.5 30 23.5 31 35.0 32 41.5 33 47.0 34 54.5 35 74.0 36 96.5 37 129.0 38 168.5 39 187.0 40 217.0 41 246.5 42 257.0 43 269.0 44 281.0 45 270.5 46 253.0 47 228.5 48 212.0 49 195.5 50 157.0 51 129.5 52 103.0 53 79.5 54 59.0 55 41.0 56 25.5 57 14.0 58 9.5 59 8.0 60 6.0 61 3.5 62 2.5 63 1.5 64 1.5 65 1.5 66 0.5 67 1.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.225 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.02 75-79 1.32 80-84 1.47 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.025 125-129 0.02 130-134 0.575 135-139 0.055 140-144 0.034999999999999996 145-149 0.185 150-151 0.1875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54762503141494 99.02499999999999 2 0.3769791404875597 0.75 3 0.07539582809751194 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.325 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.48750000000000004 0.0 0.0 0.0 0.0 100-101 0.65 0.0 0.0 0.0 0.0 102-103 0.75 0.0 0.0 0.0 0.0 104-105 0.9125 0.0 0.0 0.0 0.0 106-107 1.2125 0.0 0.0 0.0 0.0 108-109 1.4375 0.0 0.0 0.0 0.0 110-111 1.6625 0.0 0.0 0.0 0.0 112-113 1.9 0.0 0.0 0.0 0.0 114-115 2.0125 0.0 0.0 0.0 0.0 116-117 2.2375 0.0 0.0 0.0 0.0 118-119 2.6625 0.0 0.0 0.0 0.0 120-121 2.9875 0.0 0.0 0.0 0.0 122-123 3.4 0.0 0.0 0.0 0.0 124-125 3.8499999999999996 0.0 0.0 0.0 0.0 126-127 4.175 0.0 0.0 0.0 0.0 128-129 4.5625 0.0 0.0 0.0 0.0 130-131 5.075 0.0 0.0 0.0 0.0 132-133 5.775 0.0 0.0 0.0 0.0 134-135 6.425000000000001 0.0 0.0 0.0 0.0 136-137 7.0 0.0 0.0 0.0 0.0 138-139 7.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7166124 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166124_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.508 33.0 33.0 34.0 32.0 34.0 2 32.57075 33.0 33.0 34.0 31.0 34.0 3 32.66975 33.0 33.0 34.0 32.0 34.0 4 32.45975 33.0 33.0 34.0 31.0 34.0 5 32.49725 33.0 33.0 34.0 32.0 34.0 6 36.7025 38.0 38.0 38.0 35.0 38.0 7 36.6195 38.0 38.0 38.0 35.0 38.0 8 36.6245 38.0 38.0 38.0 35.0 38.0 9 36.5915 38.0 38.0 38.0 35.0 38.0 10-14 36.43505 38.0 38.0 38.0 34.0 38.0 15-19 36.388400000000004 38.0 38.0 38.0 33.8 38.0 20-24 36.1954 38.0 38.0 38.0 33.4 38.0 25-29 36.3147 38.0 38.0 38.0 34.0 38.0 30-34 36.26825000000001 38.0 38.0 38.0 34.0 38.0 35-39 36.072050000000004 38.0 38.0 38.0 32.8 38.0 40-44 35.97255 38.0 38.0 38.0 32.8 38.0 45-49 35.76425 38.0 37.2 38.0 31.4 38.0 50-54 35.775650000000006 38.0 37.2 38.0 30.8 38.0 55-59 35.79645 38.0 37.0 38.0 31.0 38.0 60-64 35.77910000000001 38.0 37.0 38.0 31.2 38.0 65-69 35.6172 38.0 37.0 38.0 29.8 38.0 70-74 35.42 38.0 37.0 38.0 29.0 38.0 75-79 35.29595 38.0 36.6 38.0 28.8 38.0 80-84 35.007600000000004 38.0 36.0 38.0 28.0 38.0 85-89 34.86995 38.0 36.0 38.0 26.8 38.0 90-94 34.610049999999994 38.0 35.6 38.0 25.4 38.0 95-99 34.53054999999999 38.0 35.4 38.0 25.4 38.0 100-104 34.190250000000006 38.0 34.6 38.0 22.2 38.0 105-109 33.9858 38.0 34.4 38.0 21.4 38.0 110-114 33.8075 38.0 34.0 38.0 21.4 38.0 115-119 33.20715 38.0 34.0 38.0 15.0 38.0 120-124 32.8387 38.0 32.2 38.0 15.0 38.0 125-129 32.14919999999999 37.4 31.6 38.0 15.0 38.0 130-134 31.3705 36.8 31.0 38.0 13.0 38.0 135-139 30.0649 36.0 27.4 38.0 10.4 38.0 140-144 28.91805 36.0 24.6 38.0 2.0 38.0 145-149 26.48985 33.2 12.8 38.0 2.0 38.0 150-151 20.847875000000002 26.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 15.0 3 9.0 4 4.0 5 4.0 6 2.0 7 1.0 8 2.0 9 1.0 10 3.0 11 1.0 12 6.0 13 3.0 14 9.0 15 2.0 16 8.0 17 4.0 18 10.0 19 13.0 20 20.0 21 25.0 22 20.0 23 44.0 24 31.0 25 42.0 26 61.0 27 65.0 28 64.0 29 93.0 30 128.0 31 132.0 32 163.0 33 210.0 34 287.0 35 489.0 36 757.0 37 1272.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.38609652413103 15.303825956489122 12.828207051762941 27.481870467616904 2 22.73068267066767 23.40585146286572 36.084021005251316 17.779444861215303 3 20.905226306576644 25.70642660665166 31.357839459864966 22.030507626906726 4 23.655913978494624 35.45886471617904 21.880470117529384 19.004751187796952 5 24.012006003001503 36.24312156078039 23.336668334167083 16.408204102051023 6 17.075000000000003 39.5 24.725 18.7 7 16.725 15.9 46.025 21.349999999999998 8 19.5 22.400000000000002 27.900000000000002 30.2 9 21.75 23.525 29.225 25.5 10-14 22.830000000000002 28.15 27.944999999999997 21.075 15-19 23.195 27.589999999999996 28.585 20.630000000000003 20-24 22.42 29.29 27.88 20.41 25-29 22.62 28.249999999999996 29.005 20.125 30-34 22.86 28.42 28.34 20.380000000000003 35-39 22.55225522552255 28.392839283928396 28.397839783978394 20.657065706570656 40-44 22.41 27.92 29.044999999999998 20.625 45-49 22.605 28.165000000000003 28.77 20.46 50-54 22.634999999999998 28.499999999999996 28.794999999999998 20.07 55-59 23.43617180859043 28.31641582079104 28.176408820441022 20.07100355017751 60-64 22.86 28.09 28.860000000000003 20.19 65-69 23.175 27.775 29.110000000000003 19.939999999999998 70-74 23.43 28.470000000000002 28.15 19.950000000000003 75-79 23.674999999999997 27.855 28.444999999999997 20.025000000000002 80-84 23.544999999999998 27.985 28.73 19.74 85-89 23.56 27.700000000000003 28.965000000000003 19.775000000000002 90-94 23.685000000000002 28.38 28.38 19.555 95-99 23.915 28.32 28.389999999999997 19.375 100-104 23.613542031304696 27.47912186828024 28.759313897084564 20.1480222033305 105-109 23.72093023255814 28.417104276069015 28.482120530132534 19.379844961240313 110-114 24.23605901475369 27.67691922980745 28.49212303075769 19.59489872468117 115-119 23.961198059902994 27.796389819490976 28.741437071853593 19.500975048752437 120-124 23.9 27.71 28.765 19.625 125-129 23.86 27.944999999999997 28.525 19.67 130-134 24.555 27.985 28.09 19.37 135-139 24.425 28.244999999999997 28.205000000000002 19.125 140-144 25.03 27.765 28.035 19.17 145-149 25.785000000000004 28.235 27.295 18.685 150-151 25.825 26.437500000000004 28.462500000000002 19.275000000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 1.0 19 1.0 20 0.0 21 1.5 22 3.0 23 1.5 24 4.5 25 6.5 26 3.5 27 5.5 28 10.0 29 13.0 30 13.5 31 17.5 32 27.0 33 42.0 34 56.5 35 77.0 36 100.0 37 120.0 38 156.5 39 181.5 40 200.0 41 240.5 42 262.0 43 271.0 44 282.5 45 294.0 46 288.5 47 265.0 48 229.5 49 184.0 50 148.5 51 119.5 52 103.5 53 88.0 54 58.0 55 34.5 56 24.0 57 16.0 58 13.5 59 10.0 60 6.0 61 3.5 62 3.0 63 2.0 64 0.5 65 1.0 66 1.0 67 1.5 68 1.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.025 4 0.025 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.01 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.005 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.015 105-109 0.025 110-114 0.025 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44500504540868 98.55000000000001 2 0.4288597376387487 0.8500000000000001 3 0.050454086781029264 0.15 4 0.025227043390514632 0.1 5 0.025227043390514632 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025227043390514632 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCCTATTT 9 0.22499999999999998 No Hit AGCAGATTCATTCGCCAACTAACCCTTTAATTTATCCTATTTTTCCTAAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.4625 0.0 0.0 0.0 0.0 100-101 0.625 0.0 0.0 0.0 0.0 102-103 0.725 0.0 0.0 0.0 0.0 104-105 0.8999999999999999 0.0 0.0 0.0 0.0 106-107 1.2125 0.0 0.0 0.0 0.0 108-109 1.425 0.0 0.0 0.0 0.0 110-111 1.65 0.0 0.0 0.0 0.0 112-113 1.8624999999999998 0.0 0.0 0.0 0.0 114-115 2.0250000000000004 0.0 0.0 0.0 0.0 116-117 2.2125 0.0 0.0 0.0 0.0 118-119 2.6125 0.0 0.0 0.0 0.0 120-121 2.9375 0.0 0.0 0.0 0.0 122-123 3.375 0.0 0.0 0.0 0.0 124-125 3.825 0.0 0.0 0.0 0.0 126-127 4.175 0.0 0.0 0.0 0.0 128-129 4.525 0.0 0.0 0.0 0.0 130-131 5.0875 0.0 0.0 0.0 0.0 132-133 5.8375 0.0 0.0 0.0 0.0 134-135 6.512499999999999 0.0 0.0 0.0 0.0 136-137 7.15 0.0 0.0 0.0 0.0 138-139 7.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAACAT 10 0.006830828 145.0 1 ATTGTTG 10 0.006830828 145.0 5 TAACACC 10 0.006830828 145.0 2 GCCATTT 10 0.006830828 145.0 1 >>END_MODULE Read 799181 spots for SRR7166124.sra Written 799181 spots for SRR7166124.sra Read 799181 spots for SRR7166124.sra Written 799181 spots for SRR7166124.sra Read 799181 spots for SRR7166124.sra Written 799181 spots for SRR7166124.sra Read 799181 spots for SRR7166124.sra Written 799181 spots for SRR7166124.sra Read 799184 spots for SRR7166124.sra Written 799184 spots for SRR7166124.sra Read 799181 spots for SRR7166124.sra Written 799181 spots for SRR7166124.sra Read 799181 spots for SRR7166124.sra Written 799181 spots for SRR7166124.sra Read 799181 spots for SRR7166124.sra Written 799181 spots for SRR7166124.sra Read 799181 spots for SRR7166124.sra Written 799181 spots for SRR7166124.sra Read 799181 spots for SRR7166124.sra Written 799181 spots for SRR7166124.sra Read 799181 spots for SRR7166124.sra Written 799181 spots for SRR7166124.sra Read 799181 spots for SRR7166124.sra Written 799181 spots for SRR7166124.sra Read 799181 spots for SRR7166124.sra Written 799181 spots for SRR7166124.sra Read 799181 spots for SRR7166124.sra Written 799181 spots for SRR7166124.sra Read 799181 spots for SRR7166124.sra Written 799181 spots for SRR7166124.sra Read 799181 spots for SRR7166124.sra Written 799181 spots for SRR7166124.sra Read 799181 spots for SRR7166124.sra Written 799181 spots for SRR7166124.sra Read 799181 spots for SRR7166124.sra Written 799181 spots for SRR7166124.sra Read 799181 spots for SRR7166124.sra Written 799181 spots for SRR7166124.sra Read 799181 spots for SRR7166124.sra Written 799181 spots for SRR7166124.sra SRR ids: ['SRR7166124.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_c5jbc1rn SRR7166124.sra spots: 15983623 blocks: [[1, 799181], [799182, 1598362], [1598363, 2397543], [2397544, 3196724], [3196725, 3995905], [3995906, 4795086], [4795087, 5594267], [5594268, 6393448], [6393449, 7192629], [7192630, 7991810], [7991811, 8790991], [8790992, 9590172], [9590173, 10389353], [10389354, 11188534], [11188535, 11987715], [11987716, 12786896], [12786897, 13586077], [13586078, 14385258], [14385259, 15184439], [15184440, 15983623]] SRR7166124 file size 5394624 SRR7166124 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166124 SRR7166124_1.fastq SRR7166124_2.fastq Input file: SRR7166124_1.fastq Paired file: SRR7166124_2.fastq trimmed: SRR7166124-trimmed-pair1.fastq, SRR7166124-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Apr 10 13:44:46 2025 >> started Thu Apr 10 13:45:04 2025 >> done (18.073s) 15983623 read pairs processed; of these: 22529 ( 0.14%) short read pairs filtered out after trimming by size control 17012 ( 0.11%) empty read pairs filtered out after trimming by size control 15944082 (99.75%) read pairs available; of these: 11224691 (70.40%) trimmed read pairs available after processing 4719391 (29.60%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 4 0.00% 20 5 0.00% 21 2 0.00% 22 5 0.00% 23 10 0.00% 24 9 0.00% 25 12 0.00% 26 12 0.00% 27 15 0.00% 28 1 0.00% 29 5 0.00% 30 9 0.00% 31 14 0.00% 32 17 0.00% 33 10 0.00% 34 9 0.00% 35 13 0.00% 36 19 0.00% 37 20 0.00% 38 15 0.00% 39 19 0.00% 40 23 0.00% 41 21 0.00% 42 14 0.00% 43 25 0.00% 44 27 0.00% 45 36 0.00% 46 41 0.00% 47 44 0.00% 48 44 0.00% 49 48 0.00% 50 64 0.00% 51 66 0.00% 52 69 0.00% 53 84 0.00% 54 103 0.00% 55 115 0.00% 56 119 0.00% 57 138 0.00% 58 185 0.00% 59 164 0.00% 60 219 0.00% 61 264 0.00% 62 282 0.00% 63 304 0.00% 64 377 0.00% 65 396 0.00% 66 448 0.00% 67 527 0.00% 68 631 0.00% 69 681 0.00% 70 814 0.01% 71 988 0.01% 72 1133 0.01% 73 1210 0.01% 74 1380 0.01% 75 1652 0.01% 76 1741 0.01% 77 1950 0.01% 78 2180 0.01% 79 2439 0.02% 80 2870 0.02% 81 3221 0.02% 82 3768 0.02% 83 4320 0.03% 84 5578 0.03% 85 6218 0.04% 86 6655 0.04% 87 7234 0.05% 88 7585 0.05% 89 8180 0.05% 90 8919 0.06% 91 9833 0.06% 92 10544 0.07% 93 11529 0.07% 94 12645 0.08% 95 13308 0.08% 96 13958 0.09% 97 14703 0.09% 98 15867 0.10% 99 16978 0.11% 100 18221 0.11% 101 19728 0.12% 102 20815 0.13% 103 22521 0.14% 104 23916 0.15% 105 25350 0.16% 106 26937 0.17% 107 27397 0.17% 108 29201 0.18% 109 30212 0.19% 110 32837 0.21% 111 34113 0.21% 112 36662 0.23% 113 38655 0.24% 114 41368 0.26% 115 43322 0.27% 116 45491 0.29% 117 47256 0.30% 118 50099 0.31% 119 52220 0.33% 120 54612 0.34% 121 57145 0.36% 122 60722 0.38% 123 64371 0.40% 124 68851 0.43% 125 72308 0.45% 126 76214 0.48% 127 80228 0.50% 128 83970 0.53% 129 89687 0.56% 130 95123 0.60% 131 101682 0.64% 132 109186 0.68% 133 117533 0.74% 134 127952 0.80% 135 139766 0.88% 136 145717 0.91% 137 152997 0.96% 138 164607 1.03% 139 179687 1.13% 140 199557 1.25% 141 202366 1.27% 142 223424 1.40% 143 249504 1.56% 144 284863 1.79% 145 339766 2.13% 146 418221 2.62% 147 544672 3.42% 148 760794 4.77% 149 1313877 8.24% 150 3773775 23.67% 151 4719391 29.60% 15944082 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=5.14 fanout-score-rank=20 prefix-density=0.71 prefix-fanout=2.0 sequence=TTCTCAGCACCA criterion=fanout-score sequence-density=0.08 sequence-density-rank=22 fanout-score=98.63 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=17.7 sequence=GCAGCAGCAGCATGCACGCATATGATACTGACCGATCATTCATGCCTGTGCTGTTGGTAGCTGGGTAAGGTGATGATCCTCAATGTCTTTGCTGCAATGGATGCAAAACTCAAGCAACGTTTGAGGATCTGGAACGTTCTCATTTAGCTTCTCATATTCAA criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=5.07 fanout-score-rank=19 prefix-density=0.34 prefix-fanout=4.1 sequence=GGTGCTGAGAATGGCTGCAAGTGTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=336.90 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=20.1 sequence=GATTTTGTTATCTCAAAGCTTACACTGTTTATAGTTTGATTACCTGCGCAACAAAATGACACTCTTTGGTAAGATGGAGGCTGAAGTAGAGATCAAAGTTTCTGCTGAAACATTTCATGATATCTTCAGCTGCAGACCACACCACGTTTCCAATATGAGCCCTGCCAAGATACAGAATGTTGATCTGCATGAAGGTGAATGGGGGAAGCCGGGCACTGTAATCTGCTGGAGTTATGTACATGATGGGGTTGCTAAGACTGC SRR7166124 testing PE reads STAR mapping to Ensembl genome Started job on | Apr 10 13:45:48 Started mapping on | Apr 10 13:45:48 Finished on | Apr 10 13:47:24 Mapping speed, Million of reads per hour | 597.90 Number of input reads | 15944082 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 15158054 Uniquely mapped reads % | 95.07% Average mapped length | 288.41 Number of splices: Total | 14015582 Number of splices: Annotated (sjdb) | 13722710 Number of splices: GT/AG | 13785105 Number of splices: GC/AG | 179902 Number of splices: AT/AC | 10411 Number of splices: Non-canonical | 40164 Mismatch rate per base, % | 0.47% Deletion rate per base | 0.03% Deletion average length | 2.40 Insertion rate per base | 0.02% Insertion average length | 2.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 402253 % of reads mapped to multiple loci | 2.52% Number of reads mapped to too many loci | 22017 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.20% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 406031 406031 406031 N_multimapping 402253 402253 402253 N_noFeature 586589 14942703 725375 N_ambiguous 157069 1101 79704 UnstrandedReadsAssigned:14414396 PositiveStrandReadsAssigned:214250 NegativeStrandReadsAssigned:14352975 Dataset is classified negative stranded MeadianReadLen=149 20thPercentileLength=138 echo kmer=133 SRR7166124 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166124-trimmed-pair1.fastq SRR7166124-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,944,082 reads, 14,278,511 reads pseudoaligned [quant] estimated average fragment length: 224.145 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,005 rounds 52401 SRR7166124.ke.tsv 34699 SRR7166124.se.tsv 87100 total ==> SRR7166124.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1794.85 1138 44.7408 Potri.005G024800.1.v4.1 1035 811.855 163 14.1677 Potri.004G059700.1.v4.1 961 737.876 14 1.33886 Potri.007G009000.2.v4.1 1416 1192.85 0 0 Potri.003G141000.2.v4.1 2943 2719.85 562.476 14.5931 Potri.016G087400.1.v4.1 270 87.6766 894 719.523 Potri.015G069301.1.v4.1 564 343.997 0 0 Potri.010G195200.1.v4.1 1773 1549.85 267 12.1566 Potri.012G127500.1.v4.1 977 753.855 7914 740.797 ==> SRR7166124.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 85 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 422 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 8 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 400 SRR7166124 completed mapping pipeline successfully