Starting /dee2/code/volunteer_pipeline.sh SRR7166125 current disk space = 3110821097472 free memory = 1570659572 SRR7166125 SRAfilesize 9520321320bfd92827a52b5c86d6719d SRR7166125.sra SRR7166125.sra file validated SRR7166125 is paired end SRR7166125 is conventional basespace SRR7166125 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166125_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.732 25.0 18.0 31.0 18.0 33.0 2 30.97675 32.0 31.0 33.0 27.0 33.0 3 31.73625 33.0 31.0 33.0 29.0 33.0 4 31.692 33.0 31.0 33.0 29.0 33.0 5 32.59075 33.0 33.0 33.0 32.0 34.0 6 36.02025 38.0 36.0 38.0 33.0 38.0 7 37.13475 38.0 38.0 38.0 36.0 38.0 8 37.36225 38.0 38.0 38.0 37.0 38.0 9 37.475 38.0 38.0 38.0 37.0 38.0 10-14 37.4939 38.0 38.0 38.0 37.2 38.0 15-19 37.506400000000006 38.0 38.0 38.0 37.0 38.0 20-24 37.49595 38.0 38.0 38.0 37.6 38.0 25-29 37.4465 38.0 38.0 38.0 37.0 38.0 30-34 37.4393 38.0 38.0 38.0 37.0 38.0 35-39 37.3657 38.0 38.0 38.0 37.0 38.0 40-44 37.3717 38.0 38.0 38.0 37.0 38.0 45-49 37.4108 38.0 38.0 38.0 37.0 38.0 50-54 37.160999999999994 38.0 38.0 38.0 37.0 38.0 55-59 36.515049999999995 38.0 38.0 38.0 35.8 38.0 60-64 36.8347 38.0 38.0 38.0 36.0 38.0 65-69 37.0681 38.0 38.0 38.0 36.0 38.0 70-74 37.05135 38.0 38.0 38.0 36.0 38.0 75-79 37.0424 38.0 38.0 38.0 36.0 38.0 80-84 36.93185 38.0 38.0 38.0 35.4 38.0 85-89 36.822649999999996 38.0 38.0 38.0 35.2 38.0 90-94 36.7341 38.0 38.0 38.0 35.0 38.0 95-99 36.647800000000004 38.0 38.0 38.0 34.4 38.0 100-104 36.5851 38.0 38.0 38.0 34.2 38.0 105-109 36.257600000000004 38.0 38.0 38.0 34.0 38.0 110-114 36.31705000000001 38.0 38.0 38.0 34.0 38.0 115-119 36.04565 38.0 37.2 38.0 33.2 38.0 120-124 35.929199999999994 38.0 37.0 38.0 32.2 38.0 125-129 35.789049999999996 38.0 36.8 38.0 31.4 38.0 130-134 35.5374 38.0 36.0 38.0 31.0 38.0 135-139 35.28255 38.0 36.0 38.0 30.0 38.0 140-144 35.0087 38.0 36.0 38.0 28.8 38.0 145-149 34.6127 38.0 35.4 38.0 27.8 38.0 150-151 31.598875 36.5 31.5 38.0 14.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 2.0 19 2.0 20 6.0 21 2.0 22 2.0 23 6.0 24 11.0 25 9.0 26 16.0 27 18.0 28 20.0 29 27.0 30 44.0 31 65.0 32 70.0 33 104.0 34 150.0 35 299.0 36 661.0 37 2481.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.980269989615785 18.302180685358255 12.22741433021807 31.490134994807896 2 21.05 24.825 36.225 17.9 3 16.55 31.075000000000003 27.275 25.1 4 20.849999999999998 36.875 21.95 20.325 5 20.8 36.075 23.599999999999998 19.525000000000002 6 17.025000000000002 37.025000000000006 25.0 20.95 7 13.275 18.35 46.5 21.875 8 16.425 20.625 29.349999999999998 33.6 9 18.025 21.275 30.975 29.725 10-14 19.580000000000002 28.970000000000002 27.115000000000002 24.335 15-19 20.119999999999997 28.449999999999996 28.055000000000003 23.375 20-24 20.345 28.720000000000002 27.54 23.395 25-29 19.314999999999998 28.349999999999998 28.470000000000002 23.865 30-34 19.39290893634045 28.809321398209732 28.52427864179627 23.27349102365355 35-39 19.571957195719573 29.252925292529252 28.232823282328233 22.94229422942294 40-44 19.77 28.33 28.38 23.52 45-49 19.595000000000002 28.910000000000004 27.33 24.165 50-54 19.70245275432248 28.513268998793727 27.74929634097306 24.034981905910733 55-59 20.15005359056806 28.454039708059 27.683356300719648 23.712550400653296 60-64 19.96880660092574 27.3847856711612 28.451398671764945 24.195009056148116 65-69 19.620506658656254 28.50705917693001 27.71603084009212 24.15640332432162 70-74 19.919999999999998 28.860000000000003 27.83 23.39 75-79 19.855 29.28 27.435 23.43 80-84 20.135 28.625 28.075 23.165 85-89 19.98 28.03 28.27 23.72 90-94 19.939999999999998 28.92 27.744999999999997 23.395 95-99 20.445 28.48 27.93 23.145 100-104 20.149104373061142 28.314820374261984 27.519263484439104 24.016811768237766 105-109 20.425403529944184 28.953587770905614 27.495348720269526 23.125659978880677 110-114 20.529370559391573 28.805163614530173 27.394175923146204 23.27128990293205 115-119 20.915785782275435 28.400380742447773 27.328290165823354 23.355543309453434 120-124 20.765191297824455 28.557139284821204 27.046761690422606 23.63090772693173 125-129 20.445 28.52 27.62 23.415 130-134 20.815 28.34 27.500000000000004 23.345 135-139 20.9 28.485 26.634999999999998 23.98 140-144 20.735 28.705000000000002 26.755000000000003 23.805 145-149 21.12 28.27 26.72 23.89 150-151 20.91772943235809 28.40710177544386 26.506626656664167 24.168542135533883 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 2.0 20 1.5 21 0.5 22 2.0 23 3.5 24 4.0 25 4.5 26 5.0 27 8.5 28 10.5 29 14.5 30 24.5 31 29.5 32 37.0 33 50.0 34 61.5 35 70.5 36 91.0 37 130.0 38 147.5 39 168.0 40 203.0 41 237.0 42 266.5 43 261.5 44 274.0 45 274.0 46 235.5 47 241.5 48 228.5 49 184.0 50 163.0 51 145.0 52 108.0 53 71.0 54 54.0 55 45.0 56 43.0 57 30.5 58 19.5 59 11.5 60 7.0 61 7.0 62 3.0 63 3.0 64 3.5 65 2.0 66 2.0 67 2.0 68 2.0 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.6999999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.015 35-39 0.01 40-44 0.0 45-49 0.0 50-54 0.52 55-59 2.035 60-64 0.62 65-69 0.13 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.06999999999999999 105-109 0.565 110-114 0.06999999999999999 115-119 0.19499999999999998 120-124 0.025 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49660206393153 98.825 2 0.4027183488547697 0.8 3 0.07550969041026932 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.025169896803423106 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCATTCTCAGCACCGAAGTCCATCTCAGACCTCTCATAGAACATCTTAA 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.45 0.0 0.0 0.0 0.0 96-97 0.5375 0.0 0.0 0.0 0.0 98-99 0.625 0.0 0.0 0.0 0.0 100-101 0.725 0.0 0.0 0.0 0.0 102-103 0.8500000000000001 0.0 0.0 0.0 0.0 104-105 1.05 0.0 0.0 0.0 0.0 106-107 1.2125 0.0 0.0 0.0 0.0 108-109 1.325 0.0 0.0 0.0 0.0 110-111 1.6125 0.0 0.0 0.0 0.0 112-113 1.9 0.0 0.0 0.0 0.0 114-115 2.325 0.0 0.0 0.0 0.0 116-117 2.625 0.0 0.0 0.0 0.0 118-119 2.9375 0.0 0.0 0.0 0.0 120-121 3.3 0.0 0.0 0.0 0.0 122-123 3.6375 0.0 0.0 0.0 0.0 124-125 4.0375 0.0 0.0 0.0 0.0 126-127 4.4625 0.0 0.0 0.0 0.0 128-129 4.8375 0.0 0.0 0.0 0.0 130-131 5.375 0.0 0.0 0.0 0.0 132-133 5.7875 0.0 0.0 0.0 0.0 134-135 6.125 0.0 0.0 0.0 0.0 136-137 6.699999999999999 0.0 0.0 0.0 0.0 138-139 7.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATCCGG 10 0.006846698 144.88751 5 ACACCAA 10 0.006846698 144.88751 4 TGAAGTC 10 0.006846698 144.88751 3 TTGAAGT 10 0.006846698 144.88751 2 TCGGAAG 65 0.0076769036 13.37423 140-144 >>END_MODULE SRR7166125 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166125_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9775 33.0 33.0 34.0 32.0 34.0 2 33.0275 34.0 33.0 34.0 32.0 34.0 3 33.068 34.0 33.0 34.0 32.0 34.0 4 33.02725 34.0 33.0 34.0 32.0 34.0 5 33.01925 34.0 33.0 34.0 32.0 34.0 6 37.17775 38.0 38.0 38.0 37.0 38.0 7 37.215 38.0 38.0 38.0 37.0 38.0 8 37.16375 38.0 38.0 38.0 37.0 38.0 9 37.155 38.0 38.0 38.0 37.0 38.0 10-14 37.175349999999995 38.0 38.0 38.0 37.0 38.0 15-19 37.15644999999999 38.0 38.0 38.0 37.0 38.0 20-24 37.08715 38.0 38.0 38.0 36.8 38.0 25-29 37.07805 38.0 38.0 38.0 36.6 38.0 30-34 37.066 38.0 38.0 38.0 36.2 38.0 35-39 36.97495 38.0 38.0 38.0 36.0 38.0 40-44 36.9199 38.0 38.0 38.0 36.0 38.0 45-49 36.82655 38.0 38.0 38.0 35.8 38.0 50-54 36.646300000000004 38.0 38.0 38.0 35.0 38.0 55-59 36.6023 38.0 38.0 38.0 34.8 38.0 60-64 36.726400000000005 38.0 38.0 38.0 35.4 38.0 65-69 36.614 38.0 38.0 38.0 34.8 38.0 70-74 36.549150000000004 38.0 38.0 38.0 35.0 38.0 75-79 36.42725 38.0 38.0 38.0 34.0 38.0 80-84 36.37195 38.0 38.0 38.0 34.0 38.0 85-89 36.21525 38.0 38.0 38.0 33.6 38.0 90-94 36.1241 38.0 38.0 38.0 33.4 38.0 95-99 35.8387 38.0 37.2 38.0 31.8 38.0 100-104 35.801 38.0 37.0 38.0 31.6 38.0 105-109 35.70575 38.0 37.0 38.0 31.0 38.0 110-114 35.5235 38.0 37.0 38.0 30.6 38.0 115-119 35.236599999999996 38.0 36.4 38.0 29.4 38.0 120-124 34.9896 38.0 36.0 38.0 28.0 38.0 125-129 34.7415 38.0 35.2 38.0 27.6 38.0 130-134 34.36645 38.0 35.0 38.0 24.2 38.0 135-139 34.09155 38.0 35.0 38.0 23.2 38.0 140-144 33.589400000000005 38.0 34.6 38.0 20.2 38.0 145-149 32.79665 38.0 34.0 38.0 13.8 38.0 150-151 28.308625 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 3.0 4 0.0 5 0.0 6 2.0 7 2.0 8 1.0 9 2.0 10 1.0 11 1.0 12 3.0 13 3.0 14 2.0 15 3.0 16 1.0 17 9.0 18 4.0 19 6.0 20 6.0 21 5.0 22 12.0 23 9.0 24 11.0 25 15.0 26 28.0 27 35.0 28 29.0 29 41.0 30 49.0 31 55.0 32 104.0 33 116.0 34 177.0 35 313.0 36 693.0 37 2249.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.475 16.1 13.3 28.125 2 24.075 24.15 34.55 17.224999999999998 3 20.200000000000003 27.0 31.2 21.6 4 24.125 33.925 21.65 20.3 5 22.900000000000002 37.15 22.575 17.375 6 18.072590738423028 38.1226533166458 24.680851063829788 19.123904881101378 7 16.270337922403 15.66958698372966 45.85732165206508 22.202753441802255 8 20.27027027027027 22.3973973973974 25.900900900900904 31.431431431431434 9 21.546546546546548 23.6986986986987 28.953953953953953 25.8008008008008 10-14 22.77049344409969 28.550695626063455 27.309578620758685 21.36923230907817 15-19 23.006856513688003 27.431059506531202 28.57714829087633 20.98493568890446 20-24 23.433433433433436 28.443443443443446 27.51751751751752 20.605605605605607 25-29 23.11235730022031 28.85039054676547 27.698778289605446 20.338473863408773 30-34 22.50425553219185 28.48703314308601 28.05647341544007 20.95223790928207 35-39 22.8647241413838 27.826174026234103 28.341844397717033 20.967257434665065 40-44 23.14777733279936 28.123748498197838 27.90348418101722 20.82498998798558 45-49 22.656719407170037 27.8840376527138 28.900460644902864 20.558782295213298 50-54 22.498748122183272 28.12719078617927 28.753129694541812 20.620931397095642 55-59 23.207490486681355 27.308231524133785 28.519927899058683 20.964350090126178 60-64 22.83354192740926 28.16520650813517 28.605757196495617 20.395494367959948 65-69 23.327993592310772 28.05867040448538 27.913496195434522 20.699839807769322 70-74 23.745618427641464 27.836755132699047 28.28242363545318 20.13520280420631 75-79 23.695543314972458 28.02704056084126 27.916875312969452 20.360540811216826 80-84 23.72558838257386 28.207310966449672 27.901852779168753 20.16524787180771 85-89 23.353863101497172 28.36112362926243 27.8754193580692 20.409593911171196 90-94 23.328826798858344 28.270992939762657 28.0056081317911 20.3945721295879 95-99 23.55032548823235 28.447671507260893 27.67651477215824 20.325488232348523 100-104 23.71056584877316 27.806710065097644 27.846770155232846 20.635953930896346 105-109 23.41160566765133 27.762479347118614 28.853952836329043 19.971962148901014 110-114 24.031046569854784 27.88683024536805 27.651477215823732 20.43064596895343 115-119 24.39158738107161 28.14221331997997 27.88683024536805 19.57936905358037 120-124 24.236354531797698 27.98197295943916 27.94191286930396 19.83975963945919 125-129 24.74211316975463 27.66149223835754 28.212318477716575 19.384076114171258 130-134 24.687093221187546 28.146590567738063 27.8361870431561 19.330129167918294 135-139 24.988734791969158 27.587242777749964 28.313222850848646 19.110799579432232 140-144 24.769723668402083 28.278934721665998 27.422907488986787 19.528434120945136 145-149 25.60700876095119 28.260325406758447 27.028785982478098 19.103879849812266 150-151 25.178236397748595 28.005003126954346 26.95434646654159 19.862414008755472 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 1.0 3 1.0 4 0.5 5 0.5 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 1.0 12 1.5 13 0.5 14 0.5 15 0.5 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 1.5 22 2.0 23 0.5 24 0.5 25 4.0 26 5.0 27 4.0 28 7.5 29 14.5 30 18.0 31 19.5 32 26.0 33 36.0 34 55.0 35 67.0 36 75.5 37 103.0 38 140.0 39 184.5 40 205.0 41 221.0 42 251.5 43 256.0 44 268.0 45 316.0 46 289.5 47 234.0 48 229.0 49 201.5 50 166.5 51 139.0 52 112.5 53 86.0 54 65.0 55 46.5 56 37.0 57 28.5 58 15.5 59 10.5 60 9.0 61 10.0 62 7.0 63 4.5 64 4.5 65 2.0 66 1.0 67 2.5 68 3.0 69 1.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.125 7 0.125 8 0.1 9 0.1 10-14 0.09 15-19 0.095 20-24 0.1 25-29 0.13999999999999999 30-34 0.13 35-39 0.13 40-44 0.12 45-49 0.13999999999999999 50-54 0.15 55-59 0.13999999999999999 60-64 0.125 65-69 0.12 70-74 0.15 75-79 0.15 80-84 0.15 85-89 0.145 90-94 0.145 95-99 0.15 100-104 0.15 105-109 0.135 110-114 0.15 115-119 0.15 120-124 0.15 125-129 0.15 130-134 0.13 135-139 0.135 140-144 0.12 145-149 0.125 150-151 0.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59677419354838 98.8 2 0.25201612903225806 0.5 3 0.07560483870967742 0.22499999999999998 4 0.025201612903225805 0.1 5 0.0 0.0 6 0.025201612903225805 0.15 7 0.0 0.0 8 0.0 0.0 9 0.025201612903225805 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCCTATTTT 9 0.22499999999999998 No Hit GCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCC 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.45 0.0 0.0 0.0 0.0 96-97 0.5375 0.0 0.0 0.0 0.0 98-99 0.625 0.0 0.0 0.0 0.0 100-101 0.725 0.0 0.0 0.0 0.0 102-103 0.8500000000000001 0.0 0.0 0.0 0.0 104-105 1.05 0.0 0.0 0.0 0.0 106-107 1.225 0.0 0.0 0.0 0.0 108-109 1.3375 0.0 0.0 0.0 0.0 110-111 1.6375 0.0 0.0 0.0 0.0 112-113 1.925 0.0 0.0 0.0 0.0 114-115 2.3125 0.0 0.0 0.0 0.0 116-117 2.6 0.0 0.0 0.0 0.0 118-119 2.925 0.0 0.0 0.0 0.0 120-121 3.3 0.0 0.0 0.0 0.0 122-123 3.6375 0.0 0.0 0.0 0.0 124-125 4.0375 0.0 0.0 0.0 0.0 126-127 4.425 0.0 0.0 0.0 0.0 128-129 4.775 0.0 0.0 0.0 0.0 130-131 5.300000000000001 0.0 0.0 0.0 0.0 132-133 5.7125 0.0 0.0 0.0 0.0 134-135 6.0375 0.0 0.0 0.0 0.0 136-137 6.6 0.0 0.0 0.0 0.0 138-139 7.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAATCCA 10 0.006830828 145.0 4 CAGGAAT 10 0.006830828 145.0 1 TCGGAAG 65 0.0076375785 13.384615 140-144 >>END_MODULE Read 907393 spots for SRR7166125.sra Written 907393 spots for SRR7166125.sra Read 907393 spots for SRR7166125.sra Written 907393 spots for SRR7166125.sra Read 907393 spots for SRR7166125.sra Written 907393 spots for SRR7166125.sra Read 907393 spots for SRR7166125.sra Written 907393 spots for SRR7166125.sra Read 907393 spots for SRR7166125.sra Written 907393 spots for SRR7166125.sra Read 907393 spots for SRR7166125.sra Written 907393 spots for SRR7166125.sra Read 907393 spots for SRR7166125.sra Written 907393 spots for SRR7166125.sra Read 907393 spots for SRR7166125.sra Written 907393 spots for SRR7166125.sra Read 907393 spots for SRR7166125.sra Written 907393 spots for SRR7166125.sra Read 907393 spots for SRR7166125.sra Written 907393 spots for SRR7166125.sra Read 907393 spots for SRR7166125.sra Written 907393 spots for SRR7166125.sra Read 907393 spots for SRR7166125.sra Written 907393 spots for SRR7166125.sra Read 907393 spots for SRR7166125.sra Written 907393 spots for SRR7166125.sra Read 907393 spots for SRR7166125.sra Read 907393 spots for SRR7166125.sra Written 907393 spots for SRR7166125.sra Written 907393 spots for SRR7166125.sra Read 907407 spots for SRR7166125.sra Written 907407 spots for SRR7166125.sra Read 907393 spots for SRR7166125.sra Written 907393 spots for SRR7166125.sra Read 907393 spots for SRR7166125.sra Written 907393 spots for SRR7166125.sra Read 907393 spots for SRR7166125.sra Written 907393 spots for SRR7166125.sra Read 907393 spots for SRR7166125.sra Written 907393 spots for SRR7166125.sra SRR ids: ['SRR7166125.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1lcy8hv0 SRR7166125.sra spots: 18147874 blocks: [[1, 907393], [907394, 1814786], [1814787, 2722179], [2722180, 3629572], [3629573, 4536965], [4536966, 5444358], [5444359, 6351751], [6351752, 7259144], [7259145, 8166537], [8166538, 9073930], [9073931, 9981323], [9981324, 10888716], [10888717, 11796109], [11796110, 12703502], [12703503, 13610895], [13610896, 14518288], [14518289, 15425681], [15425682, 16333074], [16333075, 17240467], [17240468, 18147874]] SRR7166125 file size 6128018 SRR7166125 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166125 SRR7166125_1.fastq SRR7166125_2.fastq Input file: SRR7166125_1.fastq Paired file: SRR7166125_2.fastq trimmed: SRR7166125-trimmed-pair1.fastq, SRR7166125-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 14:05:57 2025 >> started Fri Feb 14 14:06:28 2025 >> done (31.369s) 18147874 read pairs processed; of these: 16549 ( 0.09%) short read pairs filtered out after trimming by size control 8026 ( 0.04%) empty read pairs filtered out after trimming by size control 18123299 (99.86%) read pairs available; of these: 8230757 (45.42%) trimmed read pairs available after processing 9892542 (54.58%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 11 0.00% 20 6 0.00% 21 9 0.00% 22 7 0.00% 23 6 0.00% 24 9 0.00% 25 11 0.00% 26 10 0.00% 27 8 0.00% 28 11 0.00% 29 11 0.00% 30 5 0.00% 31 11 0.00% 32 11 0.00% 33 12 0.00% 34 14 0.00% 35 6 0.00% 36 7 0.00% 37 7 0.00% 38 17 0.00% 39 10 0.00% 40 18 0.00% 41 16 0.00% 42 27 0.00% 43 20 0.00% 44 18 0.00% 45 16 0.00% 46 36 0.00% 47 32 0.00% 48 59 0.00% 49 40 0.00% 50 47 0.00% 51 59 0.00% 52 75 0.00% 53 64 0.00% 54 78 0.00% 55 92 0.00% 56 96 0.00% 57 105 0.00% 58 126 0.00% 59 149 0.00% 60 183 0.00% 61 202 0.00% 62 215 0.00% 63 241 0.00% 64 269 0.00% 65 305 0.00% 66 382 0.00% 67 425 0.00% 68 511 0.00% 69 571 0.00% 70 598 0.00% 71 711 0.00% 72 864 0.00% 73 963 0.01% 74 1151 0.01% 75 1229 0.01% 76 1401 0.01% 77 1558 0.01% 78 1785 0.01% 79 1951 0.01% 80 2326 0.01% 81 2670 0.01% 82 3216 0.02% 83 3780 0.02% 84 5163 0.03% 85 5264 0.03% 86 5561 0.03% 87 5913 0.03% 88 6475 0.04% 89 6880 0.04% 90 7629 0.04% 91 8278 0.05% 92 9023 0.05% 93 9952 0.05% 94 10823 0.06% 95 11356 0.06% 96 12283 0.07% 97 12837 0.07% 98 13524 0.07% 99 14914 0.08% 100 15330 0.08% 101 16340 0.09% 102 17630 0.10% 103 19132 0.11% 104 20363 0.11% 105 21654 0.12% 106 22503 0.12% 107 23342 0.13% 108 24428 0.13% 109 25264 0.14% 110 26585 0.15% 111 28408 0.16% 112 30091 0.17% 113 32401 0.18% 114 33705 0.19% 115 35727 0.20% 116 37281 0.21% 117 38568 0.21% 118 39657 0.22% 119 41107 0.23% 120 42184 0.23% 121 44028 0.24% 122 46339 0.26% 123 48464 0.27% 124 51335 0.28% 125 53386 0.29% 126 55909 0.31% 127 57203 0.32% 128 58914 0.33% 129 61215 0.34% 130 62885 0.35% 131 65440 0.36% 132 69117 0.38% 133 72932 0.40% 134 76162 0.42% 135 80880 0.45% 136 84890 0.47% 137 88569 0.49% 138 93693 0.52% 139 98875 0.55% 140 104229 0.58% 141 113547 0.63% 142 123868 0.68% 143 135278 0.75% 144 154717 0.85% 145 180967 1.00% 146 220877 1.22% 147 286299 1.58% 148 421435 2.33% 149 780693 4.31% 150 3672150 20.26% 151 9892542 54.58% 18123299 reads passed initial QC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=2.80 fanout-score-rank=25 prefix-density=0.56 prefix-fanout=2.6 sequence=CCACATTTGCAGCCACTGCCACACTTGCA criterion=fanout-score sequence-density=0.15 sequence-density-rank=15 fanout-score=22.03 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=8.8 sequence=ACACCAGCAATGATTGT criterion=sequence-density sequence-density=0.76 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=36 prefix-density=0.77 prefix-fanout=2.0 sequence=GGCAGTGGCTGCAAATGTGGCATGTACCCTGACTTAGGTTTCTCAGAGAACACCACAACTGAGACAATCATTGCAGGT criterion=fanout-score sequence-density=0.10 sequence-density-rank=27 fanout-score=29.06 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=10.0 sequence=GAGGTTGAGTACAGGTGCTTTGTTGG SRR7166125 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 14:07:39 Started mapping on | Feb 14 14:07:39 Finished on | Feb 14 14:10:20 Mapping speed, Million of reads per hour | 405.24 Number of input reads | 18123299 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 16786191 Uniquely mapped reads % | 92.62% Average mapped length | 293.17 Number of splices: Total | 16414762 Number of splices: Annotated (sjdb) | 16092197 Number of splices: GT/AG | 16145660 Number of splices: GC/AG | 210581 Number of splices: AT/AC | 12507 Number of splices: Non-canonical | 46014 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.04% Deletion average length | 2.31 Insertion rate per base | 0.02% Insertion average length | 2.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 473002 % of reads mapped to multiple loci | 2.61% Number of reads mapped to too many loci | 47423 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.43% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 878353 878353 878353 N_multimapping 473002 473002 473002 N_noFeature 561695 16555783 706609 N_ambiguous 176168 1130 90038 UnstrandedReadsAssigned:16048328 PositiveStrandReadsAssigned:229278 NegativeStrandReadsAssigned:15989544 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7166125 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166125-trimmed-pair1.fastq SRR7166125-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,123,299 reads, 15,896,995 reads pseudoaligned [quant] estimated average fragment length: 236.347 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,070 rounds 52401 SRR7166125.ke.tsv 34699 SRR7166125.se.tsv 87100 total ==> SRR7166125.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1782.65 1331 44.7241 Potri.005G024800.1.v4.1 1035 799.653 426 31.9108 Potri.004G059700.1.v4.1 961 725.699 31 2.5588 Potri.007G009000.2.v4.1 1416 1180.65 0 0 Potri.003G141000.2.v4.1 2943 2707.65 693.401 15.3399 Potri.016G087400.1.v4.1 270 85.1528 897.511 631.352 Potri.015G069301.1.v4.1 564 335.7 0 0 Potri.010G195200.1.v4.1 1773 1537.65 360.859 14.0575 Potri.012G127500.1.v4.1 977 741.669 8157 658.796 ==> SRR7166125.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 56 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 637 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 288 SRR7166125 completed mapping pipeline successfully