Starting /dee2/code/volunteer_pipeline.sh SRR7166127 current disk space = 3110869950464 free memory = 1541092112 SRR7166127 SRAfilesize 030e043e2025f24f77f0618596daa6f3 SRR7166127.sra SRR7166127.sra file validated SRR7166127 is paired end SRR7166127 is conventional basespace SRR7166127 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166127_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.802 33.0 18.0 33.0 18.0 34.0 2 29.97775 31.0 27.0 33.0 25.0 34.0 3 31.75825 33.0 31.0 33.0 29.0 34.0 4 32.52375 33.0 33.0 33.0 31.0 34.0 5 32.67075 33.0 33.0 33.0 32.0 34.0 6 36.83275 38.0 37.0 38.0 35.0 38.0 7 37.2755 38.0 38.0 38.0 36.0 38.0 8 37.46825 38.0 38.0 38.0 37.0 38.0 9 37.69425 38.0 38.0 38.0 38.0 38.0 10-14 37.627700000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.6414 38.0 38.0 38.0 38.0 38.0 20-24 37.61305 38.0 38.0 38.0 38.0 38.0 25-29 37.6124 38.0 38.0 38.0 38.0 38.0 30-34 37.605199999999996 38.0 38.0 38.0 38.0 38.0 35-39 37.6017 38.0 38.0 38.0 38.0 38.0 40-44 37.54855 38.0 38.0 38.0 37.6 38.0 45-49 37.4585 38.0 38.0 38.0 37.0 38.0 50-54 37.0449 38.0 38.0 38.0 36.8 38.0 55-59 36.663799999999995 38.0 38.0 38.0 36.0 38.0 60-64 36.910700000000006 38.0 38.0 38.0 36.0 38.0 65-69 37.20835 38.0 38.0 38.0 36.2 38.0 70-74 37.0543 38.0 38.0 38.0 35.8 38.0 75-79 37.0387 38.0 38.0 38.0 36.0 38.0 80-84 36.95595 38.0 38.0 38.0 35.8 38.0 85-89 36.87525 38.0 38.0 38.0 35.4 38.0 90-94 36.81035 38.0 38.0 38.0 35.0 38.0 95-99 36.58839999999999 38.0 38.0 38.0 34.2 38.0 100-104 36.4206 38.0 38.0 38.0 34.0 38.0 105-109 35.97435 38.0 37.4 38.0 33.4 38.0 110-114 36.23545 38.0 37.2 38.0 33.8 38.0 115-119 36.0005 38.0 37.0 38.0 32.8 38.0 120-124 35.8429 38.0 37.0 38.0 32.0 38.0 125-129 35.627750000000006 38.0 36.2 38.0 31.0 38.0 130-134 35.434349999999995 38.0 36.2 38.0 30.6 38.0 135-139 35.1725 38.0 36.0 38.0 30.2 38.0 140-144 35.06825 38.0 35.8 38.0 29.6 38.0 145-149 34.4925 38.0 35.0 38.0 27.8 38.0 150-151 31.263375 36.5 31.5 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 1.0 15 2.0 16 2.0 17 3.0 18 4.0 19 0.0 20 2.0 21 2.0 22 2.0 23 4.0 24 4.0 25 6.0 26 15.0 27 25.0 28 25.0 29 37.0 30 41.0 31 37.0 32 56.0 33 98.0 34 162.0 35 295.0 36 699.0 37 2476.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.81063883939934 21.837617714431154 10.282514634767116 32.0692288114024 2 18.05 26.85 35.825 19.275000000000002 3 16.45 32.574999999999996 27.55 23.425 4 20.200000000000003 36.325 22.975 20.5 5 19.208615076383673 38.16679188580015 23.040320560981716 19.58427247683446 6 15.65 38.475 25.0 20.875 7 12.025 21.349999999999998 46.050000000000004 20.575 8 17.4 20.825 28.575 33.2 9 17.9 22.45 30.275000000000002 29.375 10-14 19.35 30.904999999999998 26.52 23.225 15-19 19.945 29.294999999999998 27.584999999999997 23.175 20-24 19.935 29.835 27.445000000000004 22.785 25-29 19.485 29.909999999999997 27.87 22.735 30-34 19.994999999999997 29.45 27.115000000000002 23.44 35-39 19.395 29.865000000000002 27.500000000000004 23.24 40-44 20.080000000000002 29.205 27.529999999999998 23.185 45-49 20.595 29.520000000000003 27.075 22.81 50-54 19.479340093839866 29.19126179304778 27.783663790928813 23.54573432218354 55-59 19.982698961937718 28.9639731325056 27.930999389375128 23.122328516181557 60-64 19.888110478302504 29.257597903331483 28.068141726727486 22.786149891638527 65-69 19.932989948492274 29.079361904285644 27.94919237885683 23.038455768365253 70-74 20.04103282626101 29.75880704563651 27.00160128102482 23.198558847077663 75-79 19.887983197479624 29.214382157323598 27.669150372555883 23.228484272640895 80-84 20.286014300715035 29.216460823041153 27.651382569128458 22.846142307115354 85-89 20.01600080004 29.11645582279114 27.681384069203457 23.186159307965397 90-94 19.845 28.925 28.265 22.965 95-99 20.758113717057558 29.349402410361552 27.279091863779563 22.61339200880132 100-104 20.654735047876873 29.30766531307966 27.322404371584703 22.715195267458764 105-109 20.49896469875259 29.60456542598859 26.993586182516033 22.90288369274279 110-114 20.78519629907477 29.21730432608152 27.176794198549636 22.820705176294073 115-119 21.29824561403509 29.24812030075188 27.052631578947366 22.401002506265662 120-124 20.553082962444368 29.014352152822926 27.589138370755613 22.843426513977096 125-129 20.784687077216013 29.693841759783535 26.78759332565015 22.733877837350303 130-134 20.914182836567313 29.280856171234248 26.930386077215445 22.874574914982997 135-139 20.912091209120913 28.86788678867887 26.407640764076408 23.812381238123812 140-144 20.937093709370938 29.122912291229124 26.532653265326534 23.407340734073408 145-149 20.514102820564112 29.12582516503301 26.04520904180836 24.31486297259452 150-151 20.95965923327487 29.140566274116765 25.74542721122526 24.154347281383114 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.5 20 3.5 21 3.0 22 3.0 23 5.0 24 4.5 25 7.0 26 7.5 27 9.5 28 17.0 29 23.0 30 26.0 31 34.0 32 48.0 33 61.0 34 72.5 35 103.0 36 123.0 37 122.0 38 141.0 39 178.5 40 208.0 41 247.0 42 262.0 43 256.0 44 265.0 45 262.5 46 248.5 47 216.0 48 192.5 49 176.5 50 156.0 51 127.0 52 95.5 53 82.0 54 61.0 55 39.0 56 31.5 57 23.0 58 20.0 59 13.0 60 5.0 61 3.5 62 3.0 63 2.5 64 3.0 65 2.0 66 1.5 67 1.0 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.775 2 0.0 3 0.0 4 0.0 5 0.17500000000000002 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.895 55-59 1.7399999999999998 60-64 0.795 65-69 0.015 70-74 0.08 75-79 0.015 80-84 0.005 85-89 0.005 90-94 0.0 95-99 0.015 100-104 0.265 105-109 0.9950000000000001 110-114 0.025 115-119 0.25 120-124 0.015 125-129 0.215 130-134 0.02 135-139 0.01 140-144 0.01 145-149 0.02 150-151 0.22499999999999998 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72417251755266 99.425 2 0.25075225677031093 0.5 3 0.025075225677031094 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.30000000000000004 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.525 0.0 0.0 0.0 0.0 96-97 0.7 0.0 0.0 0.0 0.0 98-99 0.8999999999999999 0.0 0.0 0.0 0.0 100-101 1.125 0.0 0.0 0.0 0.0 102-103 1.3125 0.0 0.0 0.0 0.0 104-105 1.5 0.0 0.0 0.0 0.0 106-107 1.7125 0.0 0.0 0.0 0.0 108-109 1.875 0.0 0.0 0.0 0.0 110-111 2.1624999999999996 0.0 0.0 0.0 0.0 112-113 2.5875 0.0 0.0 0.0 0.0 114-115 3.0 0.0 0.0 0.0 0.0 116-117 3.5375 0.0 0.0 0.0 0.0 118-119 3.925 0.0 0.0 0.0 0.0 120-121 4.3375 0.0 0.0 0.0 0.0 122-123 4.887499999999999 0.0 0.0 0.0 0.0 124-125 5.449999999999999 0.0 0.0 0.0 0.0 126-127 5.9375 0.0 0.0 0.0 0.0 128-129 6.35 0.0 0.0 0.0 0.0 130-131 6.9 0.0 0.0 0.0 0.0 132-133 7.387499999999999 0.0 0.0 0.0 0.0 134-135 7.9875 0.0 0.0 0.0 0.0 136-137 8.7125 0.0 0.0 0.0 0.0 138-139 9.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGAATA 10 0.0069573796 144.1125 145 >>END_MODULE SRR7166127 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166127_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.72675 33.0 33.0 34.0 32.0 34.0 2 32.8255 33.0 33.0 34.0 32.0 34.0 3 32.92025 33.0 33.0 34.0 32.0 34.0 4 32.95975 33.0 33.0 34.0 32.0 34.0 5 32.87975 33.0 33.0 34.0 32.0 34.0 6 37.1995 38.0 38.0 38.0 37.0 38.0 7 37.2545 38.0 38.0 38.0 37.0 38.0 8 37.18975 38.0 38.0 38.0 37.0 38.0 9 37.24325 38.0 38.0 38.0 37.0 38.0 10-14 37.157149999999994 38.0 38.0 38.0 36.6 38.0 15-19 37.11675 38.0 38.0 38.0 36.0 38.0 20-24 37.0774 38.0 38.0 38.0 36.0 38.0 25-29 37.06635 38.0 38.0 38.0 36.0 38.0 30-34 36.94415 38.0 38.0 38.0 36.0 38.0 35-39 36.90135 38.0 38.0 38.0 35.8 38.0 40-44 36.811800000000005 38.0 38.0 38.0 35.4 38.0 45-49 36.716049999999996 38.0 38.0 38.0 34.4 38.0 50-54 36.4815 38.0 38.0 38.0 34.0 38.0 55-59 36.3384 38.0 37.8 38.0 34.0 38.0 60-64 36.317750000000004 38.0 37.6 38.0 33.6 38.0 65-69 36.26675 38.0 37.0 38.0 33.4 38.0 70-74 36.09585 38.0 37.0 38.0 32.6 38.0 75-79 35.91895 38.0 37.0 38.0 31.4 38.0 80-84 35.749100000000006 38.0 37.0 38.0 30.6 38.0 85-89 35.5852 38.0 36.2 38.0 29.8 38.0 90-94 35.32125 38.0 36.0 38.0 29.0 38.0 95-99 35.1511 38.0 36.0 38.0 28.4 38.0 100-104 34.87140000000001 38.0 35.4 38.0 27.2 38.0 105-109 34.609 38.0 34.8 38.0 25.8 38.0 110-114 34.077200000000005 38.0 34.0 38.0 23.0 38.0 115-119 33.699000000000005 38.0 34.0 38.0 20.6 38.0 120-124 33.11935 38.0 33.8 38.0 15.0 38.0 125-129 32.80885000000001 37.6 32.6 38.0 15.0 38.0 130-134 32.004599999999996 36.6 31.0 38.0 14.4 38.0 135-139 31.374450000000003 36.0 30.4 38.0 14.0 38.0 140-144 30.151 35.4 27.0 38.0 10.8 38.0 145-149 28.334799999999994 34.6 21.4 38.0 2.0 38.0 150-151 23.283375 30.5 2.0 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 1.0 4 1.0 5 0.0 6 1.0 7 0.0 8 2.0 9 1.0 10 0.0 11 2.0 12 1.0 13 2.0 14 6.0 15 1.0 16 4.0 17 6.0 18 7.0 19 11.0 20 9.0 21 11.0 22 16.0 23 16.0 24 30.0 25 39.0 26 37.0 27 46.0 28 57.0 29 67.0 30 85.0 31 108.0 32 138.0 33 230.0 34 341.0 35 584.0 36 950.0 37 1188.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.525 15.725 13.100000000000001 29.65 2 22.650000000000002 21.95 36.449999999999996 18.95 3 20.424999999999997 26.1 33.95 19.525000000000002 4 23.9 34.075 22.175 19.85 5 22.0 38.574999999999996 21.2 18.224999999999998 6 18.025 39.15 24.0 18.825 7 17.175 15.25 46.675 20.9 8 19.725 22.175 28.675 29.425 9 22.75 23.525 27.125 26.6 10-14 22.285 28.425 27.51 21.78 15-19 22.915 27.634999999999998 28.955 20.495 20-24 22.42 28.265 28.655 20.66 25-29 22.305 28.235 28.535 20.925 30-34 22.470000000000002 27.794999999999998 28.994999999999997 20.74 35-39 23.135 27.965 28.84 20.06 40-44 22.255 28.18 28.985 20.580000000000002 45-49 22.66 27.99 28.775000000000002 20.575 50-54 22.85 28.044999999999998 29.110000000000003 19.994999999999997 55-59 23.025000000000002 27.465 28.88 20.630000000000003 60-64 23.44 28.015 28.465 20.080000000000002 65-69 22.770000000000003 28.025 28.754999999999995 20.45 70-74 22.99 28.084999999999997 28.165000000000003 20.76 75-79 22.91 27.66 28.825 20.605 80-84 23.055 27.935 28.560000000000002 20.45 85-89 23.015 27.785 28.675 20.525 90-94 23.14 28.075 28.42 20.365 95-99 22.73 27.825 28.98 20.465 100-104 22.82 28.744999999999997 28.425 20.01 105-109 23.43 27.325 29.01 20.235 110-114 23.369999999999997 27.96 28.475 20.195 115-119 23.115 27.91 28.615000000000002 20.36 120-124 23.895 27.935 28.63 19.54 125-129 23.66 27.705000000000002 28.22 20.415 130-134 24.84 27.575 28.125 19.46 135-139 24.445 27.400000000000002 28.425 19.73 140-144 24.93 27.785 27.900000000000002 19.384999999999998 145-149 24.915000000000003 27.93 27.96 19.195 150-151 25.00938321030902 27.348930314024773 27.236331790316527 20.405354685349682 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 1.0 21 1.0 22 1.0 23 1.5 24 3.0 25 5.5 26 5.0 27 7.0 28 12.5 29 19.5 30 21.0 31 20.0 32 26.0 33 46.5 34 73.5 35 85.0 36 90.5 37 119.5 38 145.0 39 171.0 40 218.5 41 238.5 42 245.5 43 246.5 44 257.0 45 281.0 46 281.5 47 267.0 48 240.5 49 191.0 50 142.0 51 125.5 52 107.5 53 77.5 54 61.5 55 44.0 56 30.0 57 22.0 58 15.5 59 13.5 60 10.0 61 8.5 62 6.0 63 4.0 64 2.5 65 1.5 66 2.5 67 2.0 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.30000000000000004 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.525 0.0 0.0 0.0 0.0 96-97 0.7 0.0 0.0 0.0 0.0 98-99 0.8875 0.0 0.0 0.0 0.0 100-101 1.125 0.0 0.0 0.0 0.0 102-103 1.3125 0.0 0.0 0.0 0.0 104-105 1.525 0.0 0.0 0.0 0.0 106-107 1.7125 0.0 0.0 0.0 0.0 108-109 1.875 0.0 0.0 0.0 0.0 110-111 2.1624999999999996 0.0 0.0 0.0 0.0 112-113 2.5875 0.0 0.0 0.0 0.0 114-115 2.9875 0.0 0.0 0.0 0.0 116-117 3.5375 0.0 0.0 0.0 0.0 118-119 3.925 0.0 0.0 0.0 0.0 120-121 4.3375 0.0 0.0 0.0 0.0 122-123 4.7625 0.0 0.0 0.0 0.0 124-125 5.25 0.0 0.0 0.0 0.0 126-127 5.7125 0.0 0.0 0.0 0.0 128-129 6.1 0.0 0.0 0.0 0.0 130-131 6.625 0.0 0.0 0.0 0.0 132-133 7.0875 0.0 0.0 0.0 0.0 134-135 7.6875 0.0 0.0 0.0 0.0 136-137 8.325 0.0 0.0 0.0 0.0 138-139 9.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCACTCC 10 0.006830828 145.0 3 >>END_MODULE Read 790081 spots for SRR7166127.sra Written 790081 spots for SRR7166127.sra Read 790081 spots for SRR7166127.sra Written 790081 spots for SRR7166127.sra Read 790081 spots for SRR7166127.sra Written 790081 spots for SRR7166127.sra Read 790081 spots for SRR7166127.sra Written 790081 spots for SRR7166127.sra Read 790081 spots for SRR7166127.sra Written 790081 spots for SRR7166127.sra Read 790081 spots for SRR7166127.sra Written 790081 spots for SRR7166127.sra Read 790081 spots for SRR7166127.sra Written 790081 spots for SRR7166127.sra Read 790081 spots for SRR7166127.sra Written 790081 spots for SRR7166127.sra Read 790081 spots for SRR7166127.sra Written 790081 spots for SRR7166127.sra Read 790081 spots for SRR7166127.sra Written 790081 spots for SRR7166127.sra Read 790081 spots for SRR7166127.sra Written 790081 spots for SRR7166127.sra Read 790081 spots for SRR7166127.sra Written 790081 spots for SRR7166127.sra Read 790081 spots for SRR7166127.sra Written 790081 spots for SRR7166127.sra Read 790099 spots for SRR7166127.sra Written 790099 spots for SRR7166127.sra Read 790081 spots for SRR7166127.sra Written 790081 spots for SRR7166127.sra Read 790081 spots for SRR7166127.sra Written 790081 spots for SRR7166127.sra Read 790081 spots for SRR7166127.sra Written 790081 spots for SRR7166127.sra Read 790081 spots for SRR7166127.sra Written 790081 spots for SRR7166127.sra Read 790081 spots for SRR7166127.sra Written 790081 spots for SRR7166127.sra Read 790081 spots for SRR7166127.sra Written 790081 spots for SRR7166127.sra SRR ids: ['SRR7166127.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jn8vvthk SRR7166127.sra spots: 15801638 blocks: [[1, 790081], [790082, 1580162], [1580163, 2370243], [2370244, 3160324], [3160325, 3950405], [3950406, 4740486], [4740487, 5530567], [5530568, 6320648], [6320649, 7110729], [7110730, 7900810], [7900811, 8690891], [8690892, 9480972], [9480973, 10271053], [10271054, 11061134], [11061135, 11851215], [11851216, 12641296], [12641297, 13431377], [13431378, 14221458], [14221459, 15011539], [15011540, 15801638]] SRR7166127 file size 5332956 SRR7166127 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166127 SRR7166127_1.fastq SRR7166127_2.fastq Input file: SRR7166127_1.fastq Paired file: SRR7166127_2.fastq trimmed: SRR7166127-trimmed-pair1.fastq, SRR7166127-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 14:03:46 2025 >> started Fri Feb 14 14:04:11 2025 >> done (24.881s) 15801638 read pairs processed; of these: 7668 ( 0.05%) short read pairs filtered out after trimming by size control 5966 ( 0.04%) empty read pairs filtered out after trimming by size control 15788004 (99.91%) read pairs available; of these: 7136864 (45.20%) trimmed read pairs available after processing 8651140 (54.80%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 9 0.00% 20 10 0.00% 21 7 0.00% 22 3 0.00% 23 7 0.00% 24 5 0.00% 25 12 0.00% 26 5 0.00% 27 10 0.00% 28 7 0.00% 29 3 0.00% 30 7 0.00% 31 13 0.00% 32 5 0.00% 33 3 0.00% 34 5 0.00% 35 5 0.00% 36 9 0.00% 37 10 0.00% 38 6 0.00% 39 9 0.00% 40 11 0.00% 41 12 0.00% 42 16 0.00% 43 16 0.00% 44 9 0.00% 45 26 0.00% 46 23 0.00% 47 37 0.00% 48 25 0.00% 49 28 0.00% 50 48 0.00% 51 54 0.00% 52 54 0.00% 53 52 0.00% 54 61 0.00% 55 90 0.00% 56 100 0.00% 57 95 0.00% 58 125 0.00% 59 139 0.00% 60 151 0.00% 61 205 0.00% 62 174 0.00% 63 222 0.00% 64 279 0.00% 65 294 0.00% 66 338 0.00% 67 383 0.00% 68 451 0.00% 69 514 0.00% 70 609 0.00% 71 759 0.00% 72 886 0.01% 73 1001 0.01% 74 1155 0.01% 75 1317 0.01% 76 1352 0.01% 77 1581 0.01% 78 1720 0.01% 79 1993 0.01% 80 2241 0.01% 81 2756 0.02% 82 3130 0.02% 83 3668 0.02% 84 4261 0.03% 85 4891 0.03% 86 5059 0.03% 87 5563 0.04% 88 6060 0.04% 89 6595 0.04% 90 7298 0.05% 91 7966 0.05% 92 8877 0.06% 93 9944 0.06% 94 10740 0.07% 95 11572 0.07% 96 12056 0.08% 97 13118 0.08% 98 13954 0.09% 99 15071 0.10% 100 15091 0.10% 101 16388 0.10% 102 17991 0.11% 103 18664 0.12% 104 20191 0.13% 105 21516 0.14% 106 22271 0.14% 107 22803 0.14% 108 23678 0.15% 109 24975 0.16% 110 25783 0.16% 111 27663 0.18% 112 29106 0.18% 113 30960 0.20% 114 33310 0.21% 115 34968 0.22% 116 35653 0.23% 117 37176 0.24% 118 37672 0.24% 119 38486 0.24% 120 39940 0.25% 121 41460 0.26% 122 43072 0.27% 123 46046 0.29% 124 48716 0.31% 125 49515 0.31% 126 52234 0.33% 127 53215 0.34% 128 54397 0.34% 129 56092 0.36% 130 57500 0.36% 131 59733 0.38% 132 62896 0.40% 133 66388 0.42% 134 70309 0.45% 135 72791 0.46% 136 76531 0.48% 137 79671 0.50% 138 83711 0.53% 139 87626 0.56% 140 91720 0.58% 141 99003 0.63% 142 107685 0.68% 143 118392 0.75% 144 133781 0.85% 145 155887 0.99% 146 189326 1.20% 147 243528 1.54% 148 351434 2.23% 149 644454 4.08% 150 3094085 19.60% 151 8651140 54.80% 15788004 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=3.30 fanout-score-rank=27 prefix-density=0.27 prefix-fanout=2.8 sequence=CCACACTTGCAG criterion=fanout-score sequence-density=0.08 sequence-density-rank=22 fanout-score=82.81 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=18.8 sequence=CATCACCAACAG criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=4.95 fanout-score-rank=23 prefix-density=0.27 prefix-fanout=3.6 sequence=TGCAAGTGCGGCAGTG criterion=fanout-score sequence-density=0.08 sequence-density-rank=23 fanout-score=102.93 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=20.2 sequence=TGATGAGGATGA SRR7166127 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 14:05:09 Started mapping on | Feb 14 14:05:09 Finished on | Feb 14 14:07:14 Mapping speed, Million of reads per hour | 454.69 Number of input reads | 15788004 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 14886860 Uniquely mapped reads % | 94.29% Average mapped length | 292.65 Number of splices: Total | 13823942 Number of splices: Annotated (sjdb) | 13531728 Number of splices: GT/AG | 13589482 Number of splices: GC/AG | 181458 Number of splices: AT/AC | 10841 Number of splices: Non-canonical | 42161 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.36 Insertion rate per base | 0.02% Insertion average length | 2.29 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 378069 % of reads mapped to multiple loci | 2.39% Number of reads mapped to too many loci | 57448 % of reads mapped to too many loci | 0.36% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.86% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 531108 531108 531108 N_multimapping 378069 378069 378069 N_noFeature 601307 14699218 723223 N_ambiguous 143581 1568 76543 UnstrandedReadsAssigned:14141972 PositiveStrandReadsAssigned:186074 NegativeStrandReadsAssigned:14087094 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7166127 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166127-trimmed-pair1.fastq SRR7166127-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,788,004 reads, 14,000,301 reads pseudoaligned [quant] estimated average fragment length: 227.242 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,115 rounds 52401 SRR7166127.ke.tsv 34699 SRR7166127.se.tsv 87100 total ==> SRR7166127.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1791.76 1313 54.854 Potri.005G024800.1.v4.1 1035 808.758 292 27.0263 Potri.004G059700.1.v4.1 961 734.768 12 1.22251 Potri.007G009000.2.v4.1 1416 1189.76 0 0 Potri.003G141000.2.v4.1 2943 2716.76 473.17 13.0373 Potri.016G087400.1.v4.1 270 87.4421 702.413 601.305 Potri.015G069301.1.v4.1 564 342.131 0 0 Potri.010G195200.1.v4.1 1773 1546.76 270 13.0666 Potri.012G127500.1.v4.1 977 750.763 7100 707.91 ==> SRR7166127.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 17 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 397 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 421 SRR7166127 completed mapping pipeline successfully