Starting /dee2/code/volunteer_pipeline.sh SRR7166128 current disk space = 3110793904128 free memory = 1414992892 SRR7166128 SRAfilesize 03f8ac6607cde914f93c3dc9a6add149 SRR7166128.sra SRR7166128.sra file validated SRR7166128 is paired end SRR7166128 is conventional basespace SRR7166128 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166128_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.2495 33.0 33.0 34.0 32.0 34.0 2 33.051 34.0 33.0 34.0 32.0 34.0 3 32.84125 34.0 33.0 34.0 32.0 34.0 4 33.08925 34.0 33.0 34.0 32.0 34.0 5 33.1205 34.0 33.0 34.0 32.0 34.0 6 36.23225 38.0 36.0 38.0 33.0 38.0 7 37.14025 38.0 38.0 38.0 36.0 38.0 8 37.18175 38.0 38.0 38.0 36.0 38.0 9 37.36575 38.0 38.0 38.0 37.0 38.0 10-14 37.47429999999999 38.0 38.0 38.0 37.0 38.0 15-19 37.52075 38.0 38.0 38.0 37.2 38.0 20-24 37.49365 38.0 38.0 38.0 37.2 38.0 25-29 37.531850000000006 38.0 38.0 38.0 37.4 38.0 30-34 37.461850000000005 38.0 38.0 38.0 37.0 38.0 35-39 37.404450000000004 38.0 38.0 38.0 37.0 38.0 40-44 37.41605 38.0 38.0 38.0 37.0 38.0 45-49 37.3814 38.0 38.0 38.0 37.0 38.0 50-54 37.244350000000004 38.0 38.0 38.0 37.0 38.0 55-59 36.83004999999999 38.0 38.0 38.0 36.0 38.0 60-64 37.03215 38.0 38.0 38.0 36.0 38.0 65-69 37.14925 38.0 38.0 38.0 36.0 38.0 70-74 37.05195 38.0 38.0 38.0 36.0 38.0 75-79 37.004900000000006 38.0 38.0 38.0 36.0 38.0 80-84 36.88265 38.0 38.0 38.0 35.4 38.0 85-89 36.80375 38.0 38.0 38.0 35.0 38.0 90-94 36.6945 38.0 38.0 38.0 34.4 38.0 95-99 36.63285 38.0 38.0 38.0 34.2 38.0 100-104 36.57059999999999 38.0 38.0 38.0 34.0 38.0 105-109 36.2856 38.0 38.0 38.0 33.8 38.0 110-114 36.26285 38.0 37.8 38.0 33.6 38.0 115-119 36.24195 38.0 37.6 38.0 33.6 38.0 120-124 35.939499999999995 38.0 37.0 38.0 32.6 38.0 125-129 35.7797 38.0 36.8 38.0 31.6 38.0 130-134 35.61095 38.0 36.0 38.0 31.2 38.0 135-139 35.37415 38.0 36.0 38.0 31.0 38.0 140-144 35.016949999999994 38.0 35.8 38.0 28.0 38.0 145-149 34.5702 38.0 35.0 38.0 27.6 38.0 150-151 31.4185 36.5 31.5 38.0 13.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 1.0 14 0.0 15 1.0 16 0.0 17 1.0 18 2.0 19 2.0 20 4.0 21 2.0 22 5.0 23 5.0 24 8.0 25 7.0 26 9.0 27 17.0 28 30.0 29 28.0 30 41.0 31 53.0 32 59.0 33 109.0 34 154.0 35 272.0 36 601.0 37 2588.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.13189633051065 18.732358224275085 11.80395175776238 31.331793687451885 2 19.3 24.975 37.9 17.825 3 16.75 32.574999999999996 27.525 23.150000000000002 4 21.775 37.675 21.224999999999998 19.325 5 19.78984238178634 38.1285964473355 22.61696272204153 19.46459844883663 6 16.5 36.6 25.75 21.15 7 13.100000000000001 19.775000000000002 45.925 21.2 8 18.525 18.675 28.175 34.625 9 16.8 22.175 30.2 30.825000000000003 10-14 19.49 30.15 26.595000000000002 23.765 15-19 20.035 28.57 28.02 23.375 20-24 19.82 29.28 27.544999999999998 23.355 25-29 19.31 29.635 27.295 23.76 30-34 20.05 29.025000000000002 27.744999999999997 23.18 35-39 19.615 28.93 28.28 23.175 40-44 20.05 29.054999999999996 27.560000000000002 23.335 45-49 20.555 28.804999999999996 27.389999999999997 23.25 50-54 19.950850092782986 29.339485430563215 26.881990069712625 23.82767440694117 55-59 20.039481676452723 28.781129783356956 27.718161571168253 23.46122696902207 60-64 20.128404474093394 29.332397050709737 27.06023975522897 23.4789587199679 65-69 20.285 28.51 27.855 23.35 70-74 20.02 28.28 28.13 23.57 75-79 20.34 27.994999999999997 28.355000000000004 23.31 80-84 20.560000000000002 28.384999999999998 27.744999999999997 23.31 85-89 20.21 28.38 27.625 23.785 90-94 20.23 28.999999999999996 27.415 23.355 95-99 20.465 28.64 27.605 23.29 100-104 20.23 28.875 27.76 23.135 105-109 20.874442830670606 27.941102819652425 27.35513597435769 23.82931837531928 110-114 20.825 28.485 27.555000000000003 23.135 115-119 21.04 28.189999999999998 27.794999999999998 22.975 120-124 21.025 27.865000000000002 27.765 23.345 125-129 21.025 27.834999999999997 27.67 23.47 130-134 20.990000000000002 28.46 27.339999999999996 23.21 135-139 20.78 28.970000000000002 26.77 23.48 140-144 21.05 28.225 26.99 23.735 145-149 21.395 28.09 26.314999999999998 24.2 150-151 20.927318295739347 28.358395989974937 26.79197994987469 23.92230576441103 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.0 16 0.5 17 0.5 18 0.0 19 1.0 20 1.0 21 0.0 22 0.5 23 2.5 24 4.0 25 4.0 26 8.5 27 11.0 28 11.0 29 14.5 30 22.0 31 38.0 32 48.0 33 42.5 34 62.0 35 86.5 36 104.0 37 136.5 38 147.0 39 155.5 40 191.5 41 234.5 42 245.5 43 259.0 44 273.5 45 257.0 46 252.0 47 231.5 48 197.0 49 188.5 50 178.0 51 146.0 52 112.0 53 87.5 54 57.5 55 39.5 56 35.5 57 23.0 58 21.0 59 19.0 60 10.5 61 7.0 62 7.0 63 7.5 64 5.0 65 3.0 66 2.0 67 2.0 68 1.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.5749999999999997 2 0.0 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.305 55-59 1.22 60-64 0.315 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.165 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.25 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77443609022556 99.52499999999999 2 0.20050125313283207 0.4 3 0.02506265664160401 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.45 0.0 0.0 0.0 0.0 96-97 0.575 0.0 0.0 0.0 0.0 98-99 0.7 0.0 0.0 0.0 0.0 100-101 0.9 0.0 0.0 0.0 0.0 102-103 1.025 0.0 0.0 0.0 0.0 104-105 1.1375000000000002 0.0 0.0 0.0 0.0 106-107 1.35 0.0 0.0 0.0 0.0 108-109 1.5499999999999998 0.0 0.0 0.0 0.0 110-111 1.725 0.0 0.0 0.0 0.0 112-113 1.975 0.0 0.0 0.0 0.0 114-115 2.2125 0.0 0.0 0.0 0.0 116-117 2.55 0.0 0.0 0.0 0.0 118-119 2.825 0.0 0.0 0.0 0.0 120-121 3.075 0.0 0.0 0.0 0.0 122-123 3.4 0.0 0.0 0.0 0.0 124-125 3.7625 0.0 0.0 0.0 0.0 126-127 4.275 0.0 0.0 0.0 0.0 128-129 4.7625 0.0 0.0 0.0 0.0 130-131 5.175 0.0 0.0 0.0 0.0 132-133 5.5625 0.0 0.0 0.0 0.0 134-135 6.1 0.0 0.0 0.0 0.0 136-137 6.4875 0.0 0.0 0.0 0.0 138-139 7.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTCAAT 10 0.0068892627 144.5875 5 ACCATAC 10 0.0068892627 144.5875 7 >>END_MODULE SRR7166128 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166128_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.99375 33.0 33.0 34.0 32.0 34.0 2 33.065 34.0 33.0 34.0 32.0 34.0 3 33.14025 34.0 33.0 34.0 33.0 34.0 4 33.04575 34.0 33.0 34.0 33.0 34.0 5 33.0835 34.0 33.0 34.0 33.0 34.0 6 37.27175 38.0 38.0 38.0 37.0 38.0 7 37.359 38.0 38.0 38.0 37.0 38.0 8 37.29875 38.0 38.0 38.0 37.0 38.0 9 37.3115 38.0 38.0 38.0 37.0 38.0 10-14 37.330349999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.258799999999994 38.0 38.0 38.0 37.0 38.0 20-24 37.21554999999999 38.0 38.0 38.0 37.0 38.0 25-29 37.168600000000005 38.0 38.0 38.0 37.0 38.0 30-34 37.150349999999996 38.0 38.0 38.0 37.0 38.0 35-39 37.0756 38.0 38.0 38.0 36.6 38.0 40-44 37.093149999999994 38.0 38.0 38.0 36.6 38.0 45-49 36.9427 38.0 38.0 38.0 36.0 38.0 50-54 36.830549999999995 38.0 38.0 38.0 36.0 38.0 55-59 36.79285 38.0 38.0 38.0 35.6 38.0 60-64 36.7861 38.0 38.0 38.0 35.8 38.0 65-69 36.76635 38.0 38.0 38.0 35.4 38.0 70-74 36.6621 38.0 38.0 38.0 34.8 38.0 75-79 36.51895 38.0 38.0 38.0 34.4 38.0 80-84 36.524249999999995 38.0 38.0 38.0 34.6 38.0 85-89 36.42845 38.0 38.0 38.0 34.0 38.0 90-94 36.24215 38.0 37.8 38.0 33.8 38.0 95-99 35.988 38.0 37.6 38.0 33.2 38.0 100-104 35.910450000000004 38.0 37.2 38.0 32.8 38.0 105-109 35.76625 38.0 37.0 38.0 31.6 38.0 110-114 35.54905000000001 38.0 37.0 38.0 31.2 38.0 115-119 35.281099999999995 38.0 36.4 38.0 29.2 38.0 120-124 35.027100000000004 38.0 36.0 38.0 28.0 38.0 125-129 34.91885 38.0 36.0 38.0 28.0 38.0 130-134 34.5044 38.0 35.0 38.0 26.6 38.0 135-139 34.19605 38.0 35.0 38.0 24.4 38.0 140-144 33.616249999999994 38.0 34.8 38.0 21.0 38.0 145-149 32.733349999999994 38.0 34.0 38.0 13.8 38.0 150-151 28.910125 36.0 24.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 2.0 4 3.0 5 1.0 6 0.0 7 0.0 8 1.0 9 2.0 10 1.0 11 3.0 12 1.0 13 1.0 14 4.0 15 4.0 16 9.0 17 4.0 18 7.0 19 6.0 20 4.0 21 7.0 22 8.0 23 11.0 24 22.0 25 15.0 26 25.0 27 22.0 28 29.0 29 30.0 30 49.0 31 64.0 32 73.0 33 97.0 34 148.0 35 312.0 36 699.0 37 2330.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.05 15.675 13.525 29.75 2 24.375 22.575 35.55 17.5 3 20.674999999999997 27.1 30.725 21.5 4 24.875 35.475 20.625 19.025 5 23.0 39.45 20.225 17.325 6 17.9 37.275000000000006 23.3 21.525 7 16.85 15.425 45.5 22.225 8 19.925 21.75 28.575 29.75 9 22.325 24.525 26.75 26.400000000000002 10-14 22.78 28.955 26.584999999999997 21.68 15-19 22.91 27.975 27.905 21.21 20-24 22.900000000000002 28.58 27.685 20.835 25-29 22.915 28.485 27.99 20.61 30-34 22.605 28.265 27.83 21.3 35-39 23.265 27.839999999999996 28.044999999999998 20.849999999999998 40-44 23.055 28.044999999999998 28.075 20.825 45-49 23.32 28.275 27.67 20.735 50-54 23.445 27.625 28.139999999999997 20.79 55-59 23.625 28.43 27.625 20.32 60-64 23.28 27.685 28.225 20.810000000000002 65-69 22.689999999999998 27.865000000000002 28.625 20.82 70-74 22.985 28.325 28.134999999999998 20.555 75-79 23.145 27.85 27.775 21.23 80-84 22.965 28.73 27.810000000000002 20.495 85-89 23.419999999999998 28.015 27.694999999999997 20.87 90-94 23.415 28.000000000000004 28.389999999999997 20.195 95-99 23.549999999999997 27.445000000000004 28.095 20.91 100-104 23.39 28.405 27.685 20.52 105-109 23.635 28.07 28.005000000000003 20.29 110-114 24.099999999999998 27.99 27.725 20.185 115-119 23.724999999999998 27.644999999999996 28.09 20.54 120-124 23.76 28.110000000000003 27.915 20.215 125-129 23.835 27.935 27.58 20.65 130-134 24.275 27.735 27.57 20.419999999999998 135-139 24.779999999999998 28.165000000000003 27.279999999999998 19.775000000000002 140-144 24.45 28.549999999999997 27.634999999999998 19.365 145-149 25.255 27.74 27.315 19.689999999999998 150-151 25.706780085063798 27.633224918689013 27.120340255191394 19.53965474105579 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.0 22 1.0 23 3.0 24 3.5 25 3.5 26 3.5 27 6.0 28 7.5 29 9.0 30 13.5 31 19.0 32 31.5 33 42.0 34 49.0 35 64.5 36 86.0 37 111.0 38 146.5 39 172.0 40 176.0 41 204.5 42 260.0 43 268.5 44 269.5 45 285.0 46 270.5 47 245.0 48 219.5 49 205.5 50 175.5 51 143.0 52 117.0 53 91.0 54 75.5 55 53.0 56 40.5 57 32.0 58 20.5 59 19.0 60 16.5 61 7.0 62 4.0 63 6.0 64 4.5 65 4.5 66 4.0 67 3.0 68 1.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77420973406925 99.425 2 0.17561465127947817 0.35000000000000003 3 0.0 0.0 4 0.025087807325639738 0.1 5 0.025087807325639738 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.45 0.0 0.0 0.0 0.0 96-97 0.575 0.0 0.0 0.0 0.0 98-99 0.7 0.0 0.0 0.0 0.0 100-101 0.8875 0.0 0.0 0.0 0.0 102-103 1.0 0.0 0.0 0.0 0.0 104-105 1.1124999999999998 0.0 0.0 0.0 0.0 106-107 1.35 0.0 0.0 0.0 0.0 108-109 1.525 0.0 0.0 0.0 0.0 110-111 1.7000000000000002 0.0 0.0 0.0 0.0 112-113 1.95 0.0 0.0 0.0 0.0 114-115 2.1875 0.0 0.0 0.0 0.0 116-117 2.5250000000000004 0.0 0.0 0.0 0.0 118-119 2.8 0.0 0.0 0.0 0.0 120-121 3.05 0.0 0.0 0.0 0.0 122-123 3.375 0.0 0.0 0.0 0.0 124-125 3.7125 0.0 0.0 0.0 0.0 126-127 4.225 0.0 0.0 0.0 0.0 128-129 4.675000000000001 0.0 0.0 0.0 0.0 130-131 5.075 0.0 0.0 0.0 0.0 132-133 5.4125 0.0 0.0 0.0 0.0 134-135 5.925 0.0 0.0 0.0 0.0 136-137 6.325 0.0 0.0 0.0 0.0 138-139 6.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 800446 spots for SRR7166128.sra Written 800446 spots for SRR7166128.sra Read 800446 spots for SRR7166128.sra Written 800446 spots for SRR7166128.sra Read 800446 spots for SRR7166128.sra Written 800446 spots for SRR7166128.sra Read 800446 spots for SRR7166128.sra Written 800446 spots for SRR7166128.sra Read 800446 spots for SRR7166128.sra Written 800446 spots for SRR7166128.sra Read 800446 spots for SRR7166128.sra Written 800446 spots for SRR7166128.sra Read 800446 spots for SRR7166128.sra Written 800446 spots for SRR7166128.sra Read 800446 spots for SRR7166128.sra Written 800446 spots for SRR7166128.sra Read 800446 spots for SRR7166128.sra Written 800446 spots for SRR7166128.sra Read 800446 spots for SRR7166128.sra Written 800446 spots for SRR7166128.sra Read 800446 spots for SRR7166128.sra Written 800446 spots for SRR7166128.sra Read 800459 spots for SRR7166128.sra Written 800459 spots for SRR7166128.sra Read 800446 spots for SRR7166128.sra Written 800446 spots for SRR7166128.sra Read 800446 spots for SRR7166128.sra Written 800446 spots for SRR7166128.sra Read 800446 spots for SRR7166128.sra Written 800446 spots for SRR7166128.sra Read 800446 spots for SRR7166128.sra Written 800446 spots for SRR7166128.sra Read 800446 spots for SRR7166128.sra Written 800446 spots for SRR7166128.sra Read 800446 spots for SRR7166128.sra Written 800446 spots for SRR7166128.sra Read 800446 spots for SRR7166128.sra Written 800446 spots for SRR7166128.sra Read 800446 spots for SRR7166128.sra Written 800446 spots for SRR7166128.sra SRR ids: ['SRR7166128.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_e50x1nnh SRR7166128.sra spots: 16008933 blocks: [[1, 800446], [800447, 1600892], [1600893, 2401338], [2401339, 3201784], [3201785, 4002230], [4002231, 4802676], [4802677, 5603122], [5603123, 6403568], [6403569, 7204014], [7204015, 8004460], [8004461, 8804906], [8804907, 9605352], [9605353, 10405798], [10405799, 11206244], [11206245, 12006690], [12006691, 12807136], [12807137, 13607582], [13607583, 14408028], [14408029, 15208474], [15208475, 16008933]] SRR7166128 file size 5403201 SRR7166128 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166128 SRR7166128_1.fastq SRR7166128_2.fastq Input file: SRR7166128_1.fastq Paired file: SRR7166128_2.fastq trimmed: SRR7166128-trimmed-pair1.fastq, SRR7166128-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 12:59:49 2025 >> started Fri Feb 14 13:00:09 2025 >> done (19.971s) 16008933 read pairs processed; of these: 8333 ( 0.05%) short read pairs filtered out after trimming by size control 6512 ( 0.04%) empty read pairs filtered out after trimming by size control 15994088 (99.91%) read pairs available; of these: 6958165 (43.50%) trimmed read pairs available after processing 9035923 (56.50%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 4 0.00% 20 5 0.00% 21 8 0.00% 22 7 0.00% 23 2 0.00% 24 7 0.00% 25 4 0.00% 26 11 0.00% 27 10 0.00% 28 6 0.00% 29 4 0.00% 30 3 0.00% 31 5 0.00% 32 5 0.00% 33 8 0.00% 34 10 0.00% 35 9 0.00% 36 12 0.00% 37 8 0.00% 38 13 0.00% 39 5 0.00% 40 7 0.00% 41 14 0.00% 42 8 0.00% 43 12 0.00% 44 16 0.00% 45 11 0.00% 46 35 0.00% 47 27 0.00% 48 32 0.00% 49 41 0.00% 50 42 0.00% 51 56 0.00% 52 63 0.00% 53 54 0.00% 54 62 0.00% 55 81 0.00% 56 73 0.00% 57 113 0.00% 58 129 0.00% 59 141 0.00% 60 136 0.00% 61 162 0.00% 62 203 0.00% 63 234 0.00% 64 246 0.00% 65 306 0.00% 66 273 0.00% 67 367 0.00% 68 436 0.00% 69 467 0.00% 70 566 0.00% 71 683 0.00% 72 799 0.00% 73 904 0.01% 74 978 0.01% 75 1114 0.01% 76 1326 0.01% 77 1398 0.01% 78 1602 0.01% 79 1780 0.01% 80 2013 0.01% 81 2376 0.01% 82 2772 0.02% 83 3200 0.02% 84 3756 0.02% 85 4461 0.03% 86 4814 0.03% 87 5157 0.03% 88 5570 0.03% 89 5661 0.04% 90 6581 0.04% 91 7175 0.04% 92 7917 0.05% 93 8679 0.05% 94 9443 0.06% 95 9851 0.06% 96 10412 0.07% 97 11024 0.07% 98 11598 0.07% 99 13071 0.08% 100 13082 0.08% 101 14097 0.09% 102 15492 0.10% 103 16638 0.10% 104 17386 0.11% 105 18916 0.12% 106 19186 0.12% 107 19715 0.12% 108 20405 0.13% 109 21236 0.13% 110 22474 0.14% 111 23981 0.15% 112 25536 0.16% 113 27179 0.17% 114 28336 0.18% 115 30212 0.19% 116 31261 0.20% 117 32021 0.20% 118 33106 0.21% 119 33957 0.21% 120 34583 0.22% 121 36784 0.23% 122 38091 0.24% 123 40190 0.25% 124 42048 0.26% 125 44700 0.28% 126 46186 0.29% 127 47062 0.29% 128 48119 0.30% 129 49921 0.31% 130 51658 0.32% 131 53069 0.33% 132 55936 0.35% 133 58987 0.37% 134 62971 0.39% 135 65677 0.41% 136 69171 0.43% 137 72742 0.45% 138 75240 0.47% 139 79792 0.50% 140 84098 0.53% 141 90662 0.57% 142 98941 0.62% 143 109257 0.68% 144 125312 0.78% 145 148229 0.93% 146 179619 1.12% 147 234721 1.47% 148 342331 2.14% 149 652203 4.08% 150 3204971 20.04% 151 9035923 56.50% 15994088 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=3.10 fanout-score-rank=27 prefix-density=0.37 prefix-fanout=2.9 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=17.20 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=3.5 sequence=TTTTGGATTTTTTCCGCTTTGATATTCTCTGCATCCTATTTAGGGCTATTGATATTTAACAAATATCCAGCAAAGGTTTTTCCAGGAGATGTTGGAACTCTACCAATTGGAGCTTTCTTAGCTGTCTTAGCAGTAGTTTATAAGGAATATATCCCATTTTTAGTTATAATGATGCCTTATGTGATAGATGCCTCTTTAAAATATCTAAGTGCTGGGGTTATGAGTAGGGATGAGCATAAACCAACAACTCTCAAAGAAGATGGGAAGCTATACTATATAGGTGGCTATCTATCCCTACCAAGGCTTATATTGAAGTATAAACCAATGAGAGAGCCTCACTTAGTTACAGTTTTATGGATAATTGGGATATTCTTTGGTATAGTTGGGATTTTAATATCATTAATAGCATGATGGTGATTGTTTTGAAAACCATAGGAGGAAACCTCC criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=32 prefix-density=0.57 prefix-fanout=2.1 sequence=GGCAGTGGCTGCAAATGTGGCATGTACCCTGACTTAGGTTTCTCAGAGAACACCACAACTGAGACAATCATTGCAGGTGTTGCACCAGTTAAGATGTTCTATGAGAGGTCTGAGATGGACTTCGGTGCTGAGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=83.02 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=7.5 sequence=CTTCCATTTCCGCCCAAGCTGCTCACAGTATACGGGCGTCGGCATCCAGACCGTCGGCTGATCGTGGTTTTACTAGGCTAGACTAGCGTACGAGCACTATGGTCAGTAATTCCTGGAGGAATAGGTACCAAGAAAAAAACGAACCTTTGGGTTCCAGAGCTGTACGGTCGCACTGAACTCGGATAGGTCTCAGAAAAACGAAATATAGGCTTACGGTAGGTCCGAATGGCACAAAGCTTGTTCCGTTAGCTGGCATAAGATTCCATGCCTAGATGTGATACACGTTTCTGGAAACTGCCTCGTCATGCGACTGTTCCCCGGGGTCAGGGCCGCTGGTATTTGCTGT SRR7166128 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 13:01:26 Started mapping on | Feb 14 13:01:26 Finished on | Feb 14 13:04:11 Mapping speed, Million of reads per hour | 348.96 Number of input reads | 15994088 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 14742097 Uniquely mapped reads % | 92.17% Average mapped length | 293.64 Number of splices: Total | 14317410 Number of splices: Annotated (sjdb) | 14039966 Number of splices: GT/AG | 14082692 Number of splices: GC/AG | 183218 Number of splices: AT/AC | 10859 Number of splices: Non-canonical | 40641 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.04% Deletion average length | 2.22 Insertion rate per base | 0.02% Insertion average length | 2.28 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 433939 % of reads mapped to multiple loci | 2.71% Number of reads mapped to too many loci | 38650 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.80% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 826805 826805 826805 N_multimapping 433939 433939 433939 N_noFeature 467027 14573417 558087 N_ambiguous 150117 785 72073 UnstrandedReadsAssigned:14124953 PositiveStrandReadsAssigned:167895 NegativeStrandReadsAssigned:14111937 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7166128 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166128-trimmed-pair1.fastq SRR7166128-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,994,088 reads, 14,030,165 reads pseudoaligned [quant] estimated average fragment length: 235.122 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,130 rounds 52401 SRR7166128.ke.tsv 34699 SRR7166128.se.tsv 87100 total ==> SRR7166128.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1783.88 1295 49.2024 Potri.005G024800.1.v4.1 1035 800.878 282 23.8652 Potri.004G059700.1.v4.1 961 726.913 61 5.6876 Potri.007G009000.2.v4.1 1416 1181.88 0 0 Potri.003G141000.2.v4.1 2943 2708.88 529.176 13.2401 Potri.016G087400.1.v4.1 270 84.6607 1118.59 895.512 Potri.015G069301.1.v4.1 564 334.835 0 0 Potri.010G195200.1.v4.1 1773 1538.88 517 22.7703 Potri.012G127500.1.v4.1 977 742.893 5099 465.201 ==> SRR7166128.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 12 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 416 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 337 SRR7166128 completed mapping pipeline successfully