Starting /dee2/code/volunteer_pipeline.sh SRR7166129 current disk space = 3110673879040 free memory = 1443975852 SRR7166129 SRAfilesize c5108c36a74321ea08ad82d09bd46131 SRR7166129.sra SRR7166129.sra file validated SRR7166129 is paired end SRR7166129 is conventional basespace SRR7166129 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166129_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.861 33.0 32.0 34.0 30.0 34.0 2 32.17875 33.0 33.0 34.0 29.0 34.0 3 32.187 33.0 32.0 34.0 30.0 34.0 4 32.0005 33.0 32.0 34.0 30.0 34.0 5 32.308 33.0 33.0 34.0 31.0 34.0 6 36.12075 38.0 37.0 38.0 33.0 38.0 7 36.63325 38.0 37.0 38.0 34.0 38.0 8 36.70775 38.0 38.0 38.0 34.0 38.0 9 36.90025 38.0 38.0 38.0 35.0 38.0 10-14 36.94835 38.0 38.0 38.0 35.4 38.0 15-19 36.8675 38.0 38.0 38.0 35.0 38.0 20-24 36.90024999999999 38.0 38.0 38.0 35.0 38.0 25-29 36.74419999999999 38.0 38.0 38.0 34.4 38.0 30-34 36.50805 38.0 37.6 38.0 34.0 38.0 35-39 36.3163 38.0 37.2 38.0 33.0 38.0 40-44 36.2491 38.0 37.0 38.0 33.0 38.0 45-49 36.1569 38.0 37.0 38.0 33.0 38.0 50-54 35.97 38.0 37.0 38.0 31.6 38.0 55-59 35.712599999999995 38.0 36.2 38.0 30.2 38.0 60-64 35.81525 38.0 36.8 38.0 30.6 38.0 65-69 35.569050000000004 38.0 36.0 38.0 29.0 38.0 70-74 35.574200000000005 38.0 36.0 38.0 29.0 38.0 75-79 34.96319999999999 38.0 36.0 38.0 28.0 38.0 80-84 34.696299999999994 38.0 35.2 38.0 27.0 38.0 85-89 34.90975000000001 38.0 35.2 38.0 27.6 38.0 90-94 34.618950000000005 38.0 34.8 38.0 25.8 38.0 95-99 34.353849999999994 38.0 34.0 38.0 25.0 38.0 100-104 34.19375 38.0 34.0 38.0 24.0 38.0 105-109 33.40925 37.0 33.4 38.0 16.6 38.0 110-114 33.23355 37.0 32.2 38.0 15.0 38.0 115-119 32.730399999999996 37.0 31.0 38.0 15.0 38.0 120-124 32.1588 36.8 30.4 38.0 15.0 38.0 125-129 31.43505 36.0 30.0 38.0 14.6 38.0 130-134 29.590749999999996 33.8 24.4 38.0 13.2 38.0 135-139 28.18705 33.0 21.0 38.0 12.2 38.0 140-144 27.3798 33.0 18.2 38.0 2.0 38.0 145-149 25.1586 33.0 9.6 38.0 2.0 38.0 150-151 18.84375 16.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 1.0 16 1.0 17 3.0 18 4.0 19 14.0 20 15.0 21 19.0 22 20.0 23 26.0 24 35.0 25 66.0 26 62.0 27 75.0 28 105.0 29 129.0 30 143.0 31 220.0 32 244.0 33 327.0 34 449.0 35 636.0 36 865.0 37 540.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.83059418457648 19.443742098609356 10.897597977243995 35.828065739570164 2 20.3 26.924999999999997 36.375 16.400000000000002 3 16.375 31.775 27.375 24.474999999999998 4 21.2 36.25 22.05 20.5 5 20.724999999999998 37.875 23.825 17.575 6 15.4 36.3 25.85 22.45 7 12.375 20.150000000000002 45.175 22.3 8 17.0 21.675 28.249999999999996 33.074999999999996 9 17.375 21.2 31.874999999999996 29.549999999999997 10-14 18.855 29.805 27.145000000000003 24.195 15-19 19.3 29.09 27.689999999999998 23.919999999999998 20-24 19.064999999999998 29.220000000000002 28.449999999999996 23.265 25-29 18.915000000000003 28.720000000000002 28.305000000000003 24.060000000000002 30-34 19.17 29.220000000000002 27.815 23.794999999999998 35-39 19.08 29.349999999999998 28.38 23.189999999999998 40-44 19.245 29.4 27.88 23.474999999999998 45-49 19.595000000000002 29.26 27.495000000000005 23.65 50-54 19.665 28.7 28.52 23.115 55-59 19.650000000000002 28.810000000000002 28.62 22.919999999999998 60-64 19.509999999999998 29.104999999999997 28.1 23.285 65-69 19.325 28.705000000000002 28.199999999999996 23.77 70-74 19.746974697469746 28.917891789178917 27.707770777077705 23.62736273627363 75-79 18.80787329858827 28.887314678945504 28.937914284268583 23.366897738197643 80-84 19.449513381995136 29.014598540145986 27.651054339010546 23.88483373884834 85-89 19.650000000000002 29.409999999999997 27.694999999999997 23.244999999999997 90-94 19.78 29.330000000000002 27.82 23.07 95-99 19.27 28.865000000000002 28.415000000000003 23.45 100-104 19.875 29.005 28.345 22.775000000000002 105-109 20.085 28.76 28.144999999999996 23.01 110-114 19.759999999999998 28.765 28.225 23.25 115-119 19.88 29.095 27.605 23.419999999999998 120-124 20.57808671300695 28.634295144271643 27.744161624243635 23.04345651847777 125-129 20.26303945591839 28.98934840226034 27.659148872330853 23.088463269490422 130-134 20.424056674873135 28.80470280862182 27.34261166658293 23.428628849922124 135-139 20.083033213285315 28.551420568227293 27.67607042817127 23.689475790316123 140-144 21.02025506376594 29.207301825456366 26.991747936984247 22.780695173793447 145-149 20.863993592631527 28.317565199979978 27.35645992891826 23.46198127847024 150-151 21.076345431789736 26.68335419274093 27.50938673341677 24.730913642052567 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 2.0 22 2.5 23 3.0 24 5.0 25 4.5 26 5.0 27 8.0 28 10.5 29 12.5 30 18.5 31 35.0 32 45.5 33 52.5 34 64.5 35 80.5 36 122.5 37 149.0 38 169.0 39 198.5 40 218.5 41 239.5 42 256.5 43 277.5 44 297.0 45 282.0 46 245.0 47 218.5 48 206.5 49 185.5 50 152.5 51 110.5 52 79.5 53 63.5 54 44.5 55 37.0 56 29.5 57 22.5 58 12.5 59 8.5 60 6.5 61 4.5 62 4.0 63 3.0 64 2.0 65 0.5 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.01 75-79 1.185 80-84 1.3599999999999999 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.015 125-129 0.015 130-134 0.485 135-139 0.04 140-144 0.025 145-149 0.11499999999999999 150-151 0.125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.48750000000000004 0.0 0.0 0.0 0.0 100-101 0.6 0.0 0.0 0.0 0.0 102-103 0.675 0.0 0.0 0.0 0.0 104-105 0.85 0.0 0.0 0.0 0.0 106-107 0.9874999999999999 0.0 0.0 0.0 0.0 108-109 1.1875 0.0 0.0 0.0 0.0 110-111 1.4 0.0 0.0 0.0 0.0 112-113 1.6875 0.0 0.0 0.0 0.0 114-115 1.85 0.0 0.0 0.0 0.0 116-117 2.0875 0.0 0.0 0.0 0.0 118-119 2.4124999999999996 0.0 0.0 0.0 0.0 120-121 2.7375 0.0 0.0 0.0 0.0 122-123 2.925 0.0 0.0 0.0 0.0 124-125 3.1875 0.0 0.0 0.0 0.0 126-127 3.5625 0.0 0.0 0.0 0.0 128-129 3.7625 0.0 0.0 0.0 0.0 130-131 4.05 0.0 0.0 0.0 0.0 132-133 4.550000000000001 0.0 0.0 0.0 0.0 134-135 5.012499999999999 0.0 0.0 0.0 0.0 136-137 5.375 0.0 0.0 0.0 0.0 138-139 5.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGTCTTC 10 0.006862618 144.77501 9 AACTTCT 10 0.006862618 144.77501 3 AATGGCT 10 0.006862618 144.77501 8 >>END_MODULE SRR7166129 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166129_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.461 33.0 33.0 34.0 32.0 34.0 2 32.5335 33.0 33.0 34.0 32.0 34.0 3 32.63125 33.0 33.0 34.0 32.0 34.0 4 32.50775 33.0 33.0 34.0 31.0 34.0 5 32.535 33.0 33.0 34.0 31.0 34.0 6 36.6355 38.0 38.0 38.0 35.0 38.0 7 36.6515 38.0 38.0 38.0 35.0 38.0 8 36.677 38.0 38.0 38.0 35.0 38.0 9 36.6685 38.0 38.0 38.0 35.0 38.0 10-14 36.4571 38.0 38.0 38.0 34.0 38.0 15-19 36.34685 38.0 38.0 38.0 33.8 38.0 20-24 36.18135 38.0 37.8 38.0 32.8 38.0 25-29 36.3509 38.0 38.0 38.0 34.0 38.0 30-34 36.33305 38.0 38.0 38.0 33.6 38.0 35-39 36.1766 38.0 38.0 38.0 33.4 38.0 40-44 36.07385 38.0 38.0 38.0 32.4 38.0 45-49 35.8839 38.0 37.2 38.0 31.4 38.0 50-54 35.8441 38.0 37.0 38.0 31.0 38.0 55-59 35.781099999999995 38.0 37.0 38.0 31.0 38.0 60-64 35.7618 38.0 37.0 38.0 30.8 38.0 65-69 35.5929 38.0 37.0 38.0 30.0 38.0 70-74 35.5512 38.0 37.0 38.0 29.4 38.0 75-79 35.3815 38.0 36.6 38.0 30.0 38.0 80-84 35.08625 38.0 36.0 38.0 28.2 38.0 85-89 34.98035 38.0 36.0 38.0 27.8 38.0 90-94 34.713649999999994 38.0 35.6 38.0 25.8 38.0 95-99 34.655950000000004 38.0 35.6 38.0 25.8 38.0 100-104 34.20910000000001 38.0 34.6 38.0 22.2 38.0 105-109 34.2128 38.0 34.4 38.0 23.4 38.0 110-114 33.8911 38.0 34.0 38.0 21.4 38.0 115-119 33.2386 38.0 34.0 38.0 15.0 38.0 120-124 32.96385 38.0 32.8 38.0 15.0 38.0 125-129 32.20230000000001 37.4 31.8 38.0 15.0 38.0 130-134 31.432899999999997 36.8 31.0 38.0 13.4 38.0 135-139 30.227749999999997 36.0 27.6 38.0 12.6 38.0 140-144 29.13775 36.0 25.6 38.0 2.0 38.0 145-149 26.77165 33.2 14.2 38.0 2.0 38.0 150-151 21.324125000000002 26.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 7.0 4 2.0 5 2.0 6 3.0 7 0.0 8 2.0 9 6.0 10 1.0 11 5.0 12 4.0 13 3.0 14 7.0 15 7.0 16 5.0 17 11.0 18 16.0 19 19.0 20 13.0 21 9.0 22 18.0 23 19.0 24 40.0 25 43.0 26 51.0 27 68.0 28 84.0 29 111.0 30 122.0 31 128.0 32 170.0 33 204.0 34 287.0 35 477.0 36 821.0 37 1227.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.0 15.6 15.024999999999999 32.375 2 23.13078269567392 23.705926481620406 36.959239809952486 16.204051012753187 3 19.229807451862964 27.93198299574894 31.732933233308323 21.10527631907977 4 23.36168084042021 36.21810905452726 21.260630315157577 19.15957978989495 5 23.23661830915458 37.368684342171086 21.885942971485743 17.508754377188595 6 16.7 39.975 24.5 18.825 7 16.1 15.775 47.325 20.8 8 19.775000000000002 19.825 29.2 31.2 9 21.7 25.05 28.549999999999997 24.7 10-14 21.795 29.205 27.295 21.705 15-19 22.869999999999997 27.97 28.15 21.01 20-24 22.91 28.725 28.255000000000003 20.11 25-29 22.35 28.485 28.155 21.01 30-34 22.395 28.925 28.189999999999998 20.49 35-39 22.56612830641532 28.126406320316015 28.95144757237862 20.356017800890044 40-44 22.865 27.685 29.049999999999997 20.4 45-49 22.91 27.88 29.07 20.14 50-54 22.8 28.22 28.605000000000004 20.375 55-59 23.235 28.33 28.685 19.75 60-64 22.785 28.4 28.09 20.724999999999998 65-69 22.515 28.599999999999998 28.449999999999996 20.435 70-74 23.165 28.555000000000003 28.689999999999998 19.59 75-79 23.244999999999997 28.4 28.139999999999997 20.215 80-84 23.02 28.665000000000003 28.1 20.215 85-89 23.105 28.49 28.43 19.975 90-94 22.689999999999998 28.205000000000002 28.910000000000004 20.195 95-99 23.03 28.785 28.384999999999998 19.8 100-104 23.276163808190407 28.181409070453523 28.55642782139107 19.985999299965 105-109 23.005751437859466 27.671917979494875 28.93223305826457 20.390097524381094 110-114 23.682368236823685 28.032803280328032 28.942894289428946 19.34193419341934 115-119 23.21 28.060000000000002 28.804999999999996 19.925 120-124 23.16 29.015 27.860000000000003 19.965 125-129 24.154999999999998 28.71 27.845 19.29 130-134 23.935000000000002 27.915 28.810000000000002 19.34 135-139 24.66 27.91 28.465 18.965 140-144 24.995 27.98 27.93 19.095000000000002 145-149 24.305 28.48 27.805000000000003 19.41 150-151 25.35 27.3125 27.700000000000003 19.6375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.0 20 1.5 21 1.5 22 1.0 23 2.0 24 3.5 25 5.5 26 6.0 27 7.5 28 9.0 29 10.0 30 15.0 31 20.0 32 29.0 33 42.0 34 55.0 35 74.5 36 96.0 37 120.5 38 156.5 39 194.0 40 225.0 41 250.0 42 261.0 43 280.0 44 304.0 45 305.0 46 289.0 47 247.0 48 210.0 49 185.5 50 148.0 51 111.5 52 79.5 53 64.5 54 55.0 55 41.5 56 32.5 57 23.5 58 14.0 59 5.5 60 3.0 61 3.0 62 2.0 63 2.0 64 1.5 65 0.0 66 1.0 67 2.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.025 4 0.05 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.005 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.005 105-109 0.025 110-114 0.01 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54762503141494 99.02499999999999 2 0.4021110831867303 0.8 3 0.025131942699170642 0.075 4 0.025131942699170642 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.3125 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.625 0.0 0.0 0.0 0.0 102-103 0.7 0.0 0.0 0.0 0.0 104-105 0.875 0.0 0.0 0.0 0.0 106-107 1.0125 0.0 0.0 0.0 0.0 108-109 1.2125 0.0 0.0 0.0 0.0 110-111 1.4125 0.0 0.0 0.0 0.0 112-113 1.725 0.0 0.0 0.0 0.0 114-115 1.9 0.0 0.0 0.0 0.0 116-117 2.1625 0.0 0.0 0.0 0.0 118-119 2.5374999999999996 0.0 0.0 0.0 0.0 120-121 2.9749999999999996 0.0 0.0 0.0 0.0 122-123 3.175 0.0 0.0 0.0 0.0 124-125 3.4125 0.0 0.0 0.0 0.0 126-127 3.7249999999999996 0.0 0.0 0.0 0.0 128-129 3.95 0.0 0.0 0.0 0.0 130-131 4.25 0.0 0.0 0.0 0.0 132-133 4.7625 0.0 0.0 0.0 0.0 134-135 5.25 0.0 0.0 0.0 0.0 136-137 5.65 0.0 0.0 0.0 0.0 138-139 6.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATTGTT 10 0.006830828 145.0 7 >>END_MODULE Read 763952 spots for SRR7166129.sra Written 763952 spots for SRR7166129.sra Read 763952 spots for SRR7166129.sra Written 763952 spots for SRR7166129.sra Read 763952 spots for SRR7166129.sra Written 763952 spots for SRR7166129.sra Read 763952 spots for SRR7166129.sra Written 763952 spots for SRR7166129.sra Read 763956 spots for SRR7166129.sra Written 763956 spots for SRR7166129.sra Read 763952 spots for SRR7166129.sra Written 763952 spots for SRR7166129.sra Read 763952 spots for SRR7166129.sra Written 763952 spots for SRR7166129.sra Read 763952 spots for SRR7166129.sra Written 763952 spots for SRR7166129.sra Read 763952 spots for SRR7166129.sra Written 763952 spots for SRR7166129.sra Read 763952 spots for SRR7166129.sra Written 763952 spots for SRR7166129.sra Read 763952 spots for SRR7166129.sra Written 763952 spots for SRR7166129.sra Read 763952 spots for SRR7166129.sra Written 763952 spots for SRR7166129.sra Read 763952 spots for SRR7166129.sra Written 763952 spots for SRR7166129.sra Read 763952 spots for SRR7166129.sra Written 763952 spots for SRR7166129.sra Read 763952 spots for SRR7166129.sra Written 763952 spots for SRR7166129.sra Read 763952 spots for SRR7166129.sra Written 763952 spots for SRR7166129.sra Read 763952 spots for SRR7166129.sra Written 763952 spots for SRR7166129.sra Read 763952 spots for SRR7166129.sra Written 763952 spots for SRR7166129.sra Read 763952 spots for SRR7166129.sra Written 763952 spots for SRR7166129.sra Read 763952 spots for SRR7166129.sra Written 763952 spots for SRR7166129.sra SRR ids: ['SRR7166129.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1r6rcm5d SRR7166129.sra spots: 15279044 blocks: [[1, 763952], [763953, 1527904], [1527905, 2291856], [2291857, 3055808], [3055809, 3819760], [3819761, 4583712], [4583713, 5347664], [5347665, 6111616], [6111617, 6875568], [6875569, 7639520], [7639521, 8403472], [8403473, 9167424], [9167425, 9931376], [9931377, 10695328], [10695329, 11459280], [11459281, 12223232], [12223233, 12987184], [12987185, 13751136], [13751137, 14515088], [14515089, 15279044]] SRR7166129 file size 5155866 SRR7166129 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166129 SRR7166129_1.fastq SRR7166129_2.fastq Input file: SRR7166129_1.fastq Paired file: SRR7166129_2.fastq trimmed: SRR7166129-trimmed-pair1.fastq, SRR7166129-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 13:06:53 2025 >> started Fri Feb 14 13:07:17 2025 >> done (24.162s) 15279044 read pairs processed; of these: 15686 ( 0.10%) short read pairs filtered out after trimming by size control 13634 ( 0.09%) empty read pairs filtered out after trimming by size control 15249724 (99.81%) read pairs available; of these: 10641533 (69.78%) trimmed read pairs available after processing 4608191 (30.22%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 3 0.00% 21 3 0.00% 22 4 0.00% 23 4 0.00% 24 7 0.00% 25 4 0.00% 26 6 0.00% 27 1 0.00% 28 9 0.00% 29 7 0.00% 30 6 0.00% 31 6 0.00% 32 11 0.00% 33 6 0.00% 34 12 0.00% 35 11 0.00% 36 8 0.00% 37 15 0.00% 38 7 0.00% 39 19 0.00% 40 13 0.00% 41 16 0.00% 42 13 0.00% 43 15 0.00% 44 27 0.00% 45 29 0.00% 46 20 0.00% 47 42 0.00% 48 40 0.00% 49 42 0.00% 50 55 0.00% 51 60 0.00% 52 74 0.00% 53 76 0.00% 54 78 0.00% 55 77 0.00% 56 104 0.00% 57 114 0.00% 58 148 0.00% 59 161 0.00% 60 194 0.00% 61 204 0.00% 62 250 0.00% 63 247 0.00% 64 321 0.00% 65 367 0.00% 66 357 0.00% 67 423 0.00% 68 491 0.00% 69 575 0.00% 70 746 0.00% 71 810 0.01% 72 926 0.01% 73 991 0.01% 74 1103 0.01% 75 1308 0.01% 76 1476 0.01% 77 1604 0.01% 78 1820 0.01% 79 2048 0.01% 80 2218 0.01% 81 2580 0.02% 82 3003 0.02% 83 3445 0.02% 84 4263 0.03% 85 4721 0.03% 86 5242 0.03% 87 5722 0.04% 88 6011 0.04% 89 6351 0.04% 90 7107 0.05% 91 7658 0.05% 92 8428 0.06% 93 8929 0.06% 94 9742 0.06% 95 10262 0.07% 96 11037 0.07% 97 11731 0.08% 98 12469 0.08% 99 13413 0.09% 100 14098 0.09% 101 15342 0.10% 102 16346 0.11% 103 17636 0.12% 104 18665 0.12% 105 20290 0.13% 106 20936 0.14% 107 21982 0.14% 108 23394 0.15% 109 24660 0.16% 110 26242 0.17% 111 27377 0.18% 112 29424 0.19% 113 31414 0.21% 114 33369 0.22% 115 35587 0.23% 116 36943 0.24% 117 38668 0.25% 118 41127 0.27% 119 43198 0.28% 120 45581 0.30% 121 48267 0.32% 122 51430 0.34% 123 54589 0.36% 124 58672 0.38% 125 62167 0.41% 126 65836 0.43% 127 69812 0.46% 128 73774 0.48% 129 79585 0.52% 130 84796 0.56% 131 91216 0.60% 132 98572 0.65% 133 105902 0.69% 134 116894 0.77% 135 127901 0.84% 136 135436 0.89% 137 141667 0.93% 138 153703 1.01% 139 168645 1.11% 140 189326 1.24% 141 192338 1.26% 142 212466 1.39% 143 237592 1.56% 144 275555 1.81% 145 328545 2.15% 146 407487 2.67% 147 533243 3.50% 148 746611 4.90% 149 1294556 8.49% 150 3690720 24.20% 151 4608191 30.22% 15249724 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=28 prefix-density=0.36 prefix-fanout=1.9 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.03 sequence-density-rank=30 fanout-score=15.01 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=3.8 sequence=TTGTCAATGGTATCAGAGCTCTCCACCTCCAAGGTGATGGTCT criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.27 fanout-score-rank=23 prefix-density=0.46 prefix-fanout=2.2 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=31.58 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=2.7 sequence=CTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCC SRR7166129 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 13:08:20 Started mapping on | Feb 14 13:08:20 Finished on | Feb 14 13:10:52 Mapping speed, Million of reads per hour | 361.18 Number of input reads | 15249724 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 14339046 Uniquely mapped reads % | 94.03% Average mapped length | 289.63 Number of splices: Total | 13791061 Number of splices: Annotated (sjdb) | 13521994 Number of splices: GT/AG | 13568176 Number of splices: GC/AG | 177060 Number of splices: AT/AC | 10137 Number of splices: Non-canonical | 35688 Mismatch rate per base, % | 0.47% Deletion rate per base | 0.03% Deletion average length | 2.32 Insertion rate per base | 0.02% Insertion average length | 2.26 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 372444 % of reads mapped to multiple loci | 2.44% Number of reads mapped to too many loci | 24024 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.29% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 553853 553853 553853 N_multimapping 372444 372444 372444 N_noFeature 537219 14167531 637396 N_ambiguous 145069 819 73224 UnstrandedReadsAssigned:13656758 PositiveStrandReadsAssigned:170696 NegativeStrandReadsAssigned:13628426 Dataset is classified negative stranded MeadianReadLen=149 20thPercentileLength=139 echo kmer=135 SRR7166129 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166129-trimmed-pair1.fastq SRR7166129-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,249,724 reads, 13,575,081 reads pseudoaligned [quant] estimated average fragment length: 235.686 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,064 rounds 52401 SRR7166129.ke.tsv 34699 SRR7166129.se.tsv 87100 total ==> SRR7166129.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1783.31 1461 63.1792 Potri.005G024800.1.v4.1 1035 800.314 384 37.0018 Potri.004G059700.1.v4.1 961 726.324 58 6.15814 Potri.007G009000.2.v4.1 1416 1181.31 0 0 Potri.003G141000.2.v4.1 2943 2708.31 590.621 16.8175 Potri.016G087400.1.v4.1 270 82.4751 710.547 664.388 Potri.015G069301.1.v4.1 564 332.885 0 0 Potri.010G195200.1.v4.1 1773 1538.31 507 25.4164 Potri.012G127500.1.v4.1 977 742.319 3938 409.107 ==> SRR7166129.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 52 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 542 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 341 SRR7166129 completed mapping pipeline successfully