Starting /dee2/code/volunteer_pipeline.sh SRR7166131 current disk space = 3110320480256 free memory = 1448881372 SRR7166131 SRAfilesize fd11a029fb156d5ebe2a5948200bee7e SRR7166131.sra SRR7166131.sra file validated SRR7166131 is paired end SRR7166131 is conventional basespace SRR7166131 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166131_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.69975 33.0 32.0 34.0 28.0 34.0 2 32.10825 33.0 31.0 34.0 29.0 34.0 3 31.96225 33.0 31.0 34.0 29.0 34.0 4 32.24775 33.0 33.0 34.0 31.0 34.0 5 32.32 33.0 33.0 34.0 31.0 34.0 6 36.53075 38.0 37.0 38.0 34.0 38.0 7 36.97075 38.0 38.0 38.0 35.0 38.0 8 37.08925 38.0 38.0 38.0 36.0 38.0 9 37.00275 38.0 38.0 38.0 36.0 38.0 10-14 36.9352 38.0 38.0 38.0 35.4 38.0 15-19 36.7783 38.0 38.0 38.0 34.6 38.0 20-24 36.8702 38.0 38.0 38.0 35.0 38.0 25-29 36.5119 38.0 37.8 38.0 33.8 38.0 30-34 36.32765 38.0 37.0 38.0 33.2 38.0 35-39 36.15375 38.0 37.0 38.0 32.4 38.0 40-44 36.03914999999999 38.0 37.0 38.0 31.0 38.0 45-49 35.9142 38.0 37.0 38.0 30.6 38.0 50-54 35.87734999999999 38.0 36.8 38.0 30.4 38.0 55-59 35.7291 38.0 36.4 38.0 29.2 38.0 60-64 35.440000000000005 38.0 36.0 38.0 28.8 38.0 65-69 35.529900000000005 38.0 36.0 38.0 29.0 38.0 70-74 35.41355 38.0 36.0 38.0 29.0 38.0 75-79 34.72525 38.0 35.4 38.0 27.4 38.0 80-84 34.331849999999996 38.0 35.0 38.0 25.4 38.0 85-89 34.264700000000005 38.0 34.2 38.0 24.8 38.0 90-94 34.562200000000004 38.0 34.8 38.0 25.4 38.0 95-99 33.84400000000001 37.6 33.6 38.0 19.0 38.0 100-104 33.3193 37.4 32.8 38.0 16.6 38.0 105-109 33.0329 37.0 32.2 38.0 15.0 38.0 110-114 32.0672 36.8 28.8 38.0 15.0 38.0 115-119 32.437799999999996 37.0 31.0 38.0 15.0 38.0 120-124 31.518349999999998 36.0 28.4 38.0 15.0 38.0 125-129 31.280100000000004 35.8 28.2 38.0 14.6 38.0 130-134 29.733249999999998 35.0 24.0 38.0 13.0 38.0 135-139 28.481149999999996 33.4 22.2 38.0 10.8 38.0 140-144 27.1844 33.6 16.8 38.0 2.0 38.0 145-149 25.46685 32.6 11.2 38.0 2.0 38.0 150-151 19.038249999999998 16.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 3.0 12 3.0 13 0.0 14 2.0 15 3.0 16 2.0 17 7.0 18 6.0 19 12.0 20 14.0 21 19.0 22 29.0 23 21.0 24 61.0 25 53.0 26 85.0 27 81.0 28 104.0 29 144.0 30 168.0 31 178.0 32 253.0 33 332.0 34 458.0 35 560.0 36 872.0 37 529.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.88964819033156 19.336876740065804 11.262971399645659 33.51050366995697 2 19.950000000000003 26.424999999999997 36.0 17.625 3 17.4 31.85 27.375 23.375 4 19.225 38.75 22.6 19.425 5 19.950000000000003 37.574999999999996 23.7 18.775 6 16.5 37.675 24.075 21.75 7 12.6 20.599999999999998 45.925 20.875 8 18.275 20.775 29.075 31.874999999999996 9 17.625 22.075 31.25 29.049999999999997 10-14 19.15 30.669999999999998 26.265 23.915 15-19 19.145 29.725 27.92 23.21 20-24 18.65 29.299999999999997 28.225 23.825 25-29 19.814999999999998 29.79 27.675 22.720000000000002 30-34 19.05 29.759999999999998 28.105000000000004 23.085 35-39 19.06 29.270000000000003 27.845 23.825 40-44 19.545 29.439999999999998 27.939999999999998 23.075000000000003 45-49 19.225 28.804999999999996 28.475 23.494999999999997 50-54 19.634999999999998 29.395 27.694999999999997 23.275000000000002 55-59 19.495 29.34 27.700000000000003 23.465 60-64 19.56 29.520000000000003 27.815 23.105 65-69 19.28 28.96 27.925 23.835 70-74 19.527338273583016 29.346084518325654 27.979170839174845 23.147406368916485 75-79 19.700976403580146 29.973555736371033 27.105370219690805 23.220097640358013 80-84 19.45336800775075 28.56560093824894 28.366732955994085 23.61429809800622 85-89 19.21 29.25 28.189999999999998 23.35 90-94 19.580000000000002 29.235 28.17 23.015 95-99 19.835 28.994999999999997 28.199999999999996 22.97 100-104 19.57 29.304999999999996 28.025 23.1 105-109 20.044999999999998 28.945 27.36 23.65 110-114 20.150000000000002 29.32 27.095000000000002 23.435 115-119 19.900000000000002 29.28 27.3 23.52 120-124 20.215107553776885 29.17958979489745 26.778389194597295 23.826913456728363 125-129 19.50853310645113 29.042590460937888 27.396026224913665 24.05285020769731 130-134 20.63131313131313 28.67676767676768 26.924242424242422 23.767676767676768 135-139 20.322516025641026 29.211738782051285 26.978165064102566 23.487580128205128 140-144 20.836460053029164 28.8408624743609 26.37450597828806 23.948171494321876 145-149 20.64273160933969 28.576449912126538 26.105950288727094 24.674868189806677 150-151 20.47362485904022 28.01653928079188 26.563087332414486 24.946748527753414 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 1.0 14 1.0 15 0.0 16 0.0 17 0.5 18 0.5 19 1.0 20 2.5 21 1.5 22 0.5 23 1.0 24 4.0 25 6.0 26 6.5 27 12.5 28 21.0 29 21.5 30 28.5 31 43.0 32 53.0 33 65.0 34 72.5 35 92.0 36 117.5 37 135.5 38 168.0 39 202.5 40 224.5 41 240.0 42 248.0 43 270.0 44 264.5 45 249.0 46 253.0 47 229.0 48 201.0 49 161.5 50 122.5 51 104.5 52 94.5 53 78.5 54 53.5 55 42.5 56 33.5 57 21.0 58 14.0 59 12.0 60 7.5 61 2.5 62 3.0 63 3.5 64 2.5 65 1.5 66 1.5 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.225 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.13999999999999999 75-79 1.68 80-84 1.9449999999999998 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.05 125-129 0.095 130-134 1.0 135-139 0.16 140-144 0.055 145-149 0.42500000000000004 150-151 0.2375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67361285463218 99.25 2 0.25106703489831783 0.5 3 0.05021340697966357 0.15 4 0.025106703489831784 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.44999999999999996 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.8 0.0 0.0 0.0 0.0 96-97 0.9125 0.0 0.0 0.0 0.0 98-99 1.1 0.0 0.0 0.0 0.0 100-101 1.2875 0.0 0.0 0.0 0.0 102-103 1.475 0.0 0.0 0.0 0.0 104-105 1.6875 0.0 0.0 0.0 0.0 106-107 1.9625 0.0 0.0 0.0 0.0 108-109 2.2125000000000004 0.0 0.0 0.0 0.0 110-111 2.4625 0.0 0.0 0.0 0.0 112-113 2.6875 0.0 0.0 0.0 0.0 114-115 3.1375 0.0 0.0 0.0 0.0 116-117 3.4125 0.0 0.0 0.0 0.0 118-119 3.85 0.0 0.0 0.0 0.0 120-121 4.2 0.0 0.0 0.0 0.0 122-123 4.525 0.0 0.0 0.0 0.0 124-125 4.95 0.0 0.0 0.0 0.0 126-127 5.4875 0.0 0.0 0.0 0.0 128-129 5.9375 0.0 0.0 0.0 0.0 130-131 6.525 0.0 0.0 0.0 0.0 132-133 7.0 0.0 0.0 0.0 0.0 134-135 7.6875 0.0 0.0 0.0 0.0 136-137 8.55 0.0 0.0 0.0 0.0 138-139 9.399999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7166131 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166131_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.525 33.0 33.0 34.0 32.0 34.0 2 32.58225 33.0 33.0 34.0 32.0 34.0 3 32.60725 33.0 33.0 34.0 32.0 34.0 4 32.52525 34.0 33.0 34.0 31.0 34.0 5 32.576 33.0 33.0 34.0 32.0 34.0 6 36.56425 38.0 38.0 38.0 34.0 38.0 7 36.675 38.0 38.0 38.0 34.0 38.0 8 36.5425 38.0 38.0 38.0 34.0 38.0 9 36.65475 38.0 38.0 38.0 34.0 38.0 10-14 36.51655000000001 38.0 38.0 38.0 34.0 38.0 15-19 36.451 38.0 38.0 38.0 34.0 38.0 20-24 36.27675000000001 38.0 37.8 38.0 33.2 38.0 25-29 36.326950000000004 38.0 38.0 38.0 33.8 38.0 30-34 36.343900000000005 38.0 38.0 38.0 33.8 38.0 35-39 36.281 38.0 38.0 38.0 33.8 38.0 40-44 36.07815000000001 38.0 37.8 38.0 32.8 38.0 45-49 35.8198 38.0 37.2 38.0 31.0 38.0 50-54 35.65145 38.0 37.0 38.0 29.4 38.0 55-59 35.720099999999995 38.0 37.0 38.0 30.0 38.0 60-64 35.57535 38.0 37.0 38.0 29.6 38.0 65-69 35.506049999999995 38.0 37.0 38.0 29.0 38.0 70-74 35.39655 38.0 36.8 38.0 29.0 38.0 75-79 35.27605 38.0 36.0 38.0 28.8 38.0 80-84 35.1804 38.0 36.2 38.0 28.2 38.0 85-89 35.0147 38.0 36.0 38.0 28.0 38.0 90-94 34.799350000000004 38.0 36.0 38.0 26.4 38.0 95-99 34.245400000000004 38.0 34.8 38.0 22.8 38.0 100-104 34.05675 38.0 34.2 38.0 23.0 38.0 105-109 34.0113 38.0 34.2 38.0 23.2 38.0 110-114 33.62675 38.0 34.0 38.0 19.0 38.0 115-119 33.1223 38.0 33.4 38.0 15.0 38.0 120-124 32.52525000000001 37.6 32.4 38.0 15.0 38.0 125-129 31.59735 37.0 30.6 38.0 15.0 38.0 130-134 30.7214 36.0 28.4 38.0 13.2 38.0 135-139 29.964100000000002 35.6 26.4 38.0 13.0 38.0 140-144 29.42675 35.4 26.2 38.0 4.2 38.0 145-149 26.9611 33.2 14.4 38.0 2.0 38.0 150-151 21.123375 26.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 4.0 4 4.0 5 4.0 6 5.0 7 2.0 8 1.0 9 0.0 10 1.0 11 2.0 12 5.0 13 6.0 14 4.0 15 7.0 16 9.0 17 9.0 18 18.0 19 16.0 20 20.0 21 18.0 22 22.0 23 37.0 24 36.0 25 46.0 26 55.0 27 55.0 28 82.0 29 98.0 30 118.0 31 117.0 32 195.0 33 235.0 34 316.0 35 444.0 36 806.0 37 1196.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.425 17.150000000000002 14.05 28.375 2 24.3 24.175 34.699999999999996 16.825000000000003 3 20.625 26.325 33.5 19.55 4 25.025 34.975 21.65 18.35 5 23.400000000000002 37.3 22.175 17.125 6 17.474999999999998 38.65 24.55 19.325 7 17.9 16.325 46.2 19.575 8 20.724999999999998 20.925 28.000000000000004 30.349999999999998 9 21.05 24.775 28.7 25.474999999999998 10-14 22.689999999999998 29.520000000000003 27.05 20.74 15-19 23.189999999999998 27.744999999999997 28.71 20.355 20-24 22.765 28.62 28.58 20.035 25-29 22.814999999999998 28.48 28.439999999999998 20.265 30-34 22.755 28.415000000000003 28.585 20.244999999999997 35-39 22.075 28.84 28.444999999999997 20.64 40-44 23.005 27.99 28.65 20.355 45-49 23.200000000000003 27.825 28.99 19.985 50-54 22.86 28.105000000000004 29.07 19.965 55-59 24.07 28.084999999999997 28.599999999999998 19.245 60-64 23.455000000000002 27.905 28.76 19.88 65-69 23.810000000000002 27.315 28.804999999999996 20.07 70-74 23.875 28.38 28.465 19.28 75-79 23.31 28.435 28.315 19.939999999999998 80-84 23.189999999999998 27.634999999999998 28.875 20.3 85-89 24.11 28.199999999999996 28.185 19.505 90-94 23.65 27.865000000000002 28.93 19.555 95-99 23.385 28.03 29.095 19.49 100-104 24.016200810040502 28.086404320216012 28.14140707035352 19.75598779938997 105-109 23.81357203580537 27.559133870080508 29.294394159123872 19.332899934990248 110-114 24.007400740074008 28.537853785378537 27.8977897789779 19.556955695569556 115-119 23.990000000000002 28.165000000000003 28.310000000000002 19.535 120-124 24.25 27.61 28.7 19.439999999999998 125-129 24.305 28.54 28.075 19.08 130-134 24.66 28.02 28.21 19.11 135-139 25.44 28.21 27.384999999999998 18.965 140-144 25.590000000000003 28.27 27.355 18.785 145-149 25.419999999999998 28.439999999999998 27.229999999999997 18.91 150-151 26.337500000000002 26.3 28.025 19.3375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 1.0 19 1.5 20 0.5 21 0.5 22 2.5 23 3.0 24 2.5 25 2.5 26 5.0 27 7.5 28 10.5 29 16.0 30 20.0 31 27.0 32 37.0 33 47.5 34 57.0 35 79.5 36 103.0 37 126.5 38 155.5 39 173.5 40 201.5 41 239.0 42 263.5 43 275.0 44 282.5 45 274.5 46 268.0 47 243.0 48 211.0 49 190.0 50 152.0 51 123.5 52 107.5 53 82.0 54 57.5 55 41.0 56 30.0 57 22.0 58 10.5 59 7.0 60 7.0 61 7.5 62 8.0 63 4.5 64 2.5 65 3.0 66 1.5 67 0.5 68 0.0 69 0.5 70 1.0 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.005 105-109 0.015 110-114 0.01 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62311557788944 99.125 2 0.32663316582914576 0.65 3 0.0 0.0 4 0.02512562814070352 0.1 5 0.02512562814070352 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCCTATTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.3875 0.0 0.0 0.0 0.0 90-91 0.42500000000000004 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 0.8375 0.0 0.0 0.0 0.0 98-99 1.0 0.0 0.0 0.0 0.0 100-101 1.2125 0.0 0.0 0.0 0.0 102-103 1.4 0.0 0.0 0.0 0.0 104-105 1.575 0.0 0.0 0.0 0.0 106-107 1.8375 0.0 0.0 0.0 0.0 108-109 2.075 0.0 0.0 0.0 0.0 110-111 2.3499999999999996 0.0 0.0 0.0 0.0 112-113 2.575 0.0 0.0 0.0 0.0 114-115 3.0625 0.0 0.0 0.0 0.0 116-117 3.3625 0.0 0.0 0.0 0.0 118-119 3.7874999999999996 0.0 0.0 0.0 0.0 120-121 4.15 0.0 0.0 0.0 0.0 122-123 4.5 0.0 0.0 0.0 0.0 124-125 4.95 0.0 0.0 0.0 0.0 126-127 5.525 0.0 0.0 0.0 0.0 128-129 6.012499999999999 0.0 0.0 0.0 0.0 130-131 6.5875 0.0 0.0 0.0 0.0 132-133 7.15 0.0 0.0 0.0 0.0 134-135 7.887499999999999 0.0 0.0 0.0 0.0 136-137 8.8 0.0 0.0 0.0 0.0 138-139 9.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 862057 spots for SRR7166131.sra Written 862057 spots for SRR7166131.sra Read 862057 spots for SRR7166131.sra Written 862057 spots for SRR7166131.sra Read 862057 spots for SRR7166131.sra Written 862057 spots for SRR7166131.sra Read 862057 spots for SRR7166131.sra Written 862057 spots for SRR7166131.sra Read 862057 spots for SRR7166131.sra Written 862057 spots for SRR7166131.sra Read 862057 spots for SRR7166131.sra Written 862057 spots for SRR7166131.sra Read 862057 spots for SRR7166131.sra Written 862057 spots for SRR7166131.sra Read 862057 spots for SRR7166131.sra Written 862057 spots for SRR7166131.sra Read 862057 spots for SRR7166131.sra Written 862057 spots for SRR7166131.sra Read 862057 spots for SRR7166131.sra Written 862057 spots for SRR7166131.sra Read 862057 spots for SRR7166131.sra Written 862057 spots for SRR7166131.sra Read 862057 spots for SRR7166131.sra Written 862057 spots for SRR7166131.sra Read 862057 spots for SRR7166131.sra Written 862057 spots for SRR7166131.sra Read 862057 spots for SRR7166131.sra Written 862057 spots for SRR7166131.sra Read 862057 spots for SRR7166131.sra Written 862057 spots for SRR7166131.sra Read 862057 spots for SRR7166131.sra Written 862057 spots for SRR7166131.sra Read 862059 spots for SRR7166131.sra Written 862059 spots for SRR7166131.sra Read 862057 spots for SRR7166131.sra Written 862057 spots for SRR7166131.sra Read 862057 spots for SRR7166131.sra Written 862057 spots for SRR7166131.sra Read 862057 spots for SRR7166131.sra Written 862057 spots for SRR7166131.sra SRR ids: ['SRR7166131.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_azx8es45 SRR7166131.sra spots: 17241142 blocks: [[1, 862057], [862058, 1724114], [1724115, 2586171], [2586172, 3448228], [3448229, 4310285], [4310286, 5172342], [5172343, 6034399], [6034400, 6896456], [6896457, 7758513], [7758514, 8620570], [8620571, 9482627], [9482628, 10344684], [10344685, 11206741], [11206742, 12068798], [12068799, 12930855], [12930856, 13792912], [13792913, 14654969], [14654970, 15517026], [15517027, 16379083], [16379084, 17241142]] SRR7166131 file size 5820756 SRR7166131 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166131 SRR7166131_1.fastq SRR7166131_2.fastq Input file: SRR7166131_1.fastq Paired file: SRR7166131_2.fastq trimmed: SRR7166131-trimmed-pair1.fastq, SRR7166131-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 13:48:39 2025 >> started Fri Feb 14 13:49:07 2025 >> done (28.065s) 17241142 read pairs processed; of these: 22979 ( 0.13%) short read pairs filtered out after trimming by size control 19455 ( 0.11%) empty read pairs filtered out after trimming by size control 17198708 (99.75%) read pairs available; of these: 12012141 (69.84%) trimmed read pairs available after processing 5186567 (30.16%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 4 0.00% 20 7 0.00% 21 6 0.00% 22 11 0.00% 23 9 0.00% 24 2 0.00% 25 7 0.00% 26 9 0.00% 27 4 0.00% 28 11 0.00% 29 9 0.00% 30 7 0.00% 31 6 0.00% 32 7 0.00% 33 14 0.00% 34 10 0.00% 35 20 0.00% 36 16 0.00% 37 13 0.00% 38 16 0.00% 39 22 0.00% 40 19 0.00% 41 31 0.00% 42 21 0.00% 43 25 0.00% 44 33 0.00% 45 40 0.00% 46 44 0.00% 47 47 0.00% 48 65 0.00% 49 79 0.00% 50 101 0.00% 51 94 0.00% 52 107 0.00% 53 131 0.00% 54 130 0.00% 55 165 0.00% 56 176 0.00% 57 204 0.00% 58 266 0.00% 59 306 0.00% 60 339 0.00% 61 428 0.00% 62 436 0.00% 63 527 0.00% 64 594 0.00% 65 638 0.00% 66 718 0.00% 67 793 0.00% 68 937 0.01% 69 1080 0.01% 70 1264 0.01% 71 1479 0.01% 72 1774 0.01% 73 2053 0.01% 74 2201 0.01% 75 2486 0.01% 76 2671 0.02% 77 2884 0.02% 78 3311 0.02% 79 3703 0.02% 80 4399 0.03% 81 5036 0.03% 82 5881 0.03% 83 6630 0.04% 84 8018 0.05% 85 8878 0.05% 86 9457 0.05% 87 9962 0.06% 88 10523 0.06% 89 11287 0.07% 90 12315 0.07% 91 13583 0.08% 92 15101 0.09% 93 16665 0.10% 94 17574 0.10% 95 18405 0.11% 96 19420 0.11% 97 20222 0.12% 98 21231 0.12% 99 22235 0.13% 100 24006 0.14% 101 25582 0.15% 102 27095 0.16% 103 29121 0.17% 104 31160 0.18% 105 33620 0.20% 106 34441 0.20% 107 34903 0.20% 108 36123 0.21% 109 37648 0.22% 110 39769 0.23% 111 42401 0.25% 112 44911 0.26% 113 48039 0.28% 114 50976 0.30% 115 54205 0.32% 116 55391 0.32% 117 57459 0.33% 118 58973 0.34% 119 61340 0.36% 120 63499 0.37% 121 66670 0.39% 122 70444 0.41% 123 74735 0.43% 124 80569 0.47% 125 84490 0.49% 126 88617 0.52% 127 92680 0.54% 128 96416 0.56% 129 100654 0.59% 130 104919 0.61% 131 111463 0.65% 132 119897 0.70% 133 128243 0.75% 134 138566 0.81% 135 150080 0.87% 136 156613 0.91% 137 163823 0.95% 138 174901 1.02% 139 191403 1.11% 140 213637 1.24% 141 213527 1.24% 142 232529 1.35% 143 257996 1.50% 144 299929 1.74% 145 356486 2.07% 146 445619 2.59% 147 580525 3.38% 148 794446 4.62% 149 1351939 7.86% 150 3890226 22.62% 151 5186567 30.16% 17198708 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=30 prefix-density=0.26 prefix-fanout=2.1 sequence=TTCTATTACTCCGTGCTAAGGGCTTCGTCGATGTCTTTAGTCATATGAACCATAAGATCAACATAAATCTCTGGAACCGGGACTTCAGGATGGAGTTTTTCGTATTCAATGGTCAGTTTTGCCAAGCAGCCCGAGCCTTTTGGTGTAAGCTGCCAGACGGGCCTATAGACCTTGTAAATTTTCATGACATCTCCTTCCAAACCATTAAGAGTTATGATCTTGTTCTCATCATCGAAGGAAACCTCCTCTTTAAAGACCCCGGCTTTCCCTCCGATTGTGTACTGCCAAATCCTGATAGAGCCCGCAGTCTCCCAGTCACCTGCATGTATATCAACTCCTTGGATATGCTTGGAAGCATGTTTGGGAACATGGAAGGACTGGCTCCTCCACACTTTGTAGAACTTCTCTGCGGAGGACTTGAGTTCTAATGTTGTCTCAATCTTTCCATGTAGTGCCATTGTTTTCTATATCAACACAAATCTATGCACTCTCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=246.42 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=17.1 sequence=AAACAGAAACTAATTAAGCATTTTCATTAATAATCATCAACTCCACATAGTTCAAGTTTCCAAGCATACATGAAAACACCTTGAAAGTTGAAGCAGCCAACAAAGCAGTGACGCGTACACAAGACAAAGGATTTATAGGAACCCTTTGCTGTTTATTATTATTTAACAA criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=4.73 fanout-score-rank=22 prefix-density=0.42 prefix-fanout=3.6 sequence=TGCAAGTGCGGCAGTGGCTG criterion=fanout-score sequence-density=0.07 sequence-density-rank=29 fanout-score=44.43 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=10.3 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7166131 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 13:50:20 Started mapping on | Feb 14 13:50:21 Finished on | Feb 14 13:53:28 Mapping speed, Million of reads per hour | 331.10 Number of input reads | 17198708 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 15998056 Uniquely mapped reads % | 93.02% Average mapped length | 287.36 Number of splices: Total | 14517227 Number of splices: Annotated (sjdb) | 14172213 Number of splices: GT/AG | 14265915 Number of splices: GC/AG | 192708 Number of splices: AT/AC | 13896 Number of splices: Non-canonical | 44708 Mismatch rate per base, % | 0.47% Deletion rate per base | 0.03% Deletion average length | 2.39 Insertion rate per base | 0.02% Insertion average length | 2.29 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 408797 % of reads mapped to multiple loci | 2.38% Number of reads mapped to too many loci | 120715 % of reads mapped to too many loci | 0.70% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.63% % of reads unmapped: other | 0.27% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 813216 813216 813216 N_multimapping 408797 408797 408797 N_noFeature 692982 15781360 830016 N_ambiguous 163630 1371 83016 UnstrandedReadsAssigned:15141444 PositiveStrandReadsAssigned:215325 NegativeStrandReadsAssigned:15085024 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=141 echo kmer=137 SRR7166131 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166131-trimmed-pair1.fastq SRR7166131-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,198,708 reads, 15,088,802 reads pseudoaligned [quant] estimated average fragment length: 224.905 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,166 rounds 52401 SRR7166131.ke.tsv 34699 SRR7166131.se.tsv 87100 total ==> SRR7166131.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1794.09 1504 51.5907 Potri.005G024800.1.v4.1 1035 811.095 391 29.667 Potri.004G059700.1.v4.1 961 737.114 11 0.91839 Potri.007G009000.2.v4.1 1416 1192.09 0 0 Potri.003G141000.2.v4.1 2943 2719.09 516.205 11.6833 Potri.016G087400.1.v4.1 270 89.5136 1122 771.387 Potri.015G069301.1.v4.1 564 343.162 0 0 Potri.010G195200.1.v4.1 1773 1549.09 513.777 20.4111 Potri.012G127500.1.v4.1 977 753.1 17054 1393.62 ==> SRR7166131.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 97 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 449 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 623 SRR7166131 completed mapping pipeline successfully