Starting /dee2/code/volunteer_pipeline.sh SRR7166132 current disk space = 3112341434368 free memory = 1570933492 SRR7166132 SRAfilesize ee9284ce08b307ca97fd57a1bc2e4fa7 SRR7166132.sra SRR7166132.sra file validated SRR7166132 is paired end SRR7166132 is conventional basespace SRR7166132 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166132_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.98375 33.0 33.0 34.0 32.0 34.0 2 32.87375 33.0 33.0 34.0 32.0 34.0 3 32.46325 33.0 33.0 34.0 31.0 34.0 4 32.69725 33.0 33.0 34.0 32.0 34.0 5 32.8615 33.0 33.0 34.0 32.0 34.0 6 36.39275 38.0 37.0 38.0 33.0 38.0 7 37.23425 38.0 38.0 38.0 36.0 38.0 8 37.4435 38.0 38.0 38.0 37.0 38.0 9 37.5265 38.0 38.0 38.0 37.0 38.0 10-14 37.5335 38.0 38.0 38.0 37.4 38.0 15-19 37.5692 38.0 38.0 38.0 38.0 38.0 20-24 37.5642 38.0 38.0 38.0 37.8 38.0 25-29 37.5768 38.0 38.0 38.0 38.0 38.0 30-34 37.55385 38.0 38.0 38.0 38.0 38.0 35-39 37.50205 38.0 38.0 38.0 37.6 38.0 40-44 37.49025 38.0 38.0 38.0 37.4 38.0 45-49 37.46435000000001 38.0 38.0 38.0 37.2 38.0 50-54 37.2794 38.0 38.0 38.0 37.0 38.0 55-59 36.8522 38.0 38.0 38.0 36.2 38.0 60-64 37.0947 38.0 38.0 38.0 36.2 38.0 65-69 37.29175 38.0 38.0 38.0 37.0 38.0 70-74 37.18104999999999 38.0 38.0 38.0 36.0 38.0 75-79 37.18785 38.0 38.0 38.0 36.6 38.0 80-84 37.03235 38.0 38.0 38.0 36.0 38.0 85-89 37.01025 38.0 38.0 38.0 36.0 38.0 90-94 36.8724 38.0 38.0 38.0 35.4 38.0 95-99 36.775650000000006 38.0 38.0 38.0 35.0 38.0 100-104 36.79985 38.0 38.0 38.0 35.0 38.0 105-109 36.5406 38.0 38.0 38.0 34.0 38.0 110-114 36.54845 38.0 38.0 38.0 34.2 38.0 115-119 36.3961 38.0 38.0 38.0 33.8 38.0 120-124 36.16179999999999 38.0 37.4 38.0 33.6 38.0 125-129 36.08615 38.0 37.0 38.0 33.4 38.0 130-134 35.88590000000001 38.0 37.0 38.0 32.6 38.0 135-139 35.616099999999996 38.0 36.0 38.0 31.4 38.0 140-144 35.31675 38.0 36.0 38.0 31.0 38.0 145-149 34.975199999999994 38.0 36.0 38.0 29.8 38.0 150-151 31.845125000000003 36.5 31.5 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 2.0 17 1.0 18 0.0 19 4.0 20 1.0 21 2.0 22 2.0 23 11.0 24 6.0 25 6.0 26 11.0 27 14.0 28 14.0 29 26.0 30 40.0 31 41.0 32 59.0 33 63.0 34 140.0 35 267.0 36 573.0 37 2716.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.300771208226216 18.22622107969152 11.079691516709511 33.393316195372755 2 18.375 26.924999999999997 38.275 16.425 3 17.0 32.975 27.575 22.45 4 20.05 38.550000000000004 21.7 19.7 5 20.801001251564454 37.84730913642053 22.503128911138923 18.848560700876096 6 16.8 37.8 24.65 20.75 7 13.025 22.35 44.65 19.975 8 18.525 22.425 27.700000000000003 31.35 9 18.675 22.275 30.375000000000004 28.675 10-14 19.37 30.930000000000003 26.505000000000003 23.195 15-19 19.625 29.509999999999998 27.49 23.375 20-24 19.305 30.435000000000002 27.165 23.095 25-29 19.225 30.135 27.255000000000003 23.385 30-34 19.39 30.035 27.52 23.055 35-39 20.055 29.470000000000002 27.875 22.6 40-44 19.580000000000002 29.965000000000003 27.029999999999998 23.425 45-49 19.6 30.03 27.034999999999997 23.335 50-54 19.286717495987162 30.211677367576247 27.212078651685395 23.289526484751207 55-59 19.640141915864167 29.523568170299036 27.521540800810946 23.314749113025847 60-64 19.654861041436742 29.813384167753586 27.6361994582121 22.895555332597574 65-69 19.18 28.99 28.13 23.7 70-74 19.925 29.62 27.445000000000004 23.01 75-79 19.85 29.435 26.935 23.78 80-84 19.384999999999998 29.549999999999997 27.565 23.5 85-89 19.89 29.744999999999997 27.455000000000002 22.91 90-94 19.74 29.294999999999998 27.38 23.585 95-99 20.265 29.044999999999998 27.405 23.285 100-104 19.68 29.799999999999997 27.26 23.26 105-109 20.32658785814466 29.022240032057706 27.404327790022037 23.246844319775594 110-114 20.835 28.675 27.055 23.435 115-119 21.02 29.020000000000003 26.695 23.265 120-124 20.849999999999998 29.275000000000002 26.76 23.115 125-129 20.72 28.849999999999998 26.965 23.465 130-134 21.485000000000003 28.79 26.674999999999997 23.05 135-139 21.52 29.12 26.245 23.115 140-144 21.55 28.105000000000004 26.950000000000003 23.395 145-149 21.215 28.63 26.529999999999998 23.625 150-151 20.764411027568922 29.06015037593985 26.516290726817044 23.659147869674186 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.5 22 2.5 23 2.5 24 6.0 25 7.5 26 8.0 27 12.0 28 13.5 29 21.5 30 33.0 31 45.0 32 56.0 33 75.5 34 86.0 35 104.5 36 128.0 37 140.0 38 164.0 39 183.5 40 198.0 41 213.0 42 237.0 43 250.5 44 244.5 45 245.0 46 256.0 47 235.0 48 193.5 49 165.5 50 152.5 51 123.5 52 91.0 53 74.5 54 55.0 55 38.5 56 29.5 57 30.0 58 19.0 59 9.0 60 12.5 61 13.5 62 7.5 63 2.5 64 3.5 65 4.5 66 1.5 67 0.0 68 0.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.75 2 0.0 3 0.0 4 0.0 5 0.125 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.32 55-59 1.35 60-64 0.33 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.18 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.25 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.01315789473685 97.82499999999999 2 0.8350202429149798 1.6500000000000001 3 0.07591093117408906 0.22499999999999998 4 0.07591093117408906 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.4875 0.0 0.0 0.0 0.0 94-95 0.5375000000000001 0.0 0.0 0.0 0.0 96-97 0.625 0.0 0.0 0.0 0.0 98-99 0.775 0.0 0.0 0.0 0.0 100-101 0.925 0.0 0.0 0.0 0.0 102-103 1.2375 0.0 0.0 0.0 0.0 104-105 1.7125 0.0 0.0 0.0 0.0 106-107 1.95 0.0 0.0 0.0 0.0 108-109 2.275 0.0 0.0 0.0 0.0 110-111 2.6125 0.0 0.0 0.0 0.0 112-113 2.95 0.0 0.0 0.0 0.0 114-115 3.3 0.0 0.0 0.0 0.0 116-117 3.625 0.0 0.0 0.0 0.0 118-119 3.95 0.0 0.0 0.0 0.0 120-121 4.4125 0.0 0.0 0.0 0.0 122-123 4.9375 0.0 0.0 0.0 0.0 124-125 5.65 0.0 0.0 0.0 0.0 126-127 6.199999999999999 0.0 0.0 0.0 0.0 128-129 6.75 0.0 0.0 0.0 0.0 130-131 7.375 0.0 0.0 0.0 0.0 132-133 7.9625 0.0 0.0 0.0 0.0 134-135 8.5 0.0 0.0 0.0 0.0 136-137 9.3 0.0 0.0 0.0 0.0 138-139 9.975000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGATACA 10 0.006601011 146.64557 4 ATACACT 10 0.0068573058 144.8125 6 >>END_MODULE SRR7166132 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166132_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.05 33.0 33.0 34.0 32.0 34.0 2 33.11375 34.0 33.0 34.0 32.0 34.0 3 33.16875 34.0 33.0 34.0 33.0 34.0 4 33.10725 34.0 33.0 34.0 32.0 34.0 5 33.01425 34.0 33.0 34.0 32.0 34.0 6 37.33975 38.0 38.0 38.0 37.0 38.0 7 37.435 38.0 38.0 38.0 37.0 38.0 8 37.35225 38.0 38.0 38.0 37.0 38.0 9 37.35425 38.0 38.0 38.0 37.0 38.0 10-14 37.32575 38.0 38.0 38.0 37.0 38.0 15-19 37.321799999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.33225 38.0 38.0 38.0 37.0 38.0 25-29 37.23905 38.0 38.0 38.0 37.0 38.0 30-34 37.2171 38.0 38.0 38.0 36.8 38.0 35-39 37.16545 38.0 38.0 38.0 37.0 38.0 40-44 37.15975 38.0 38.0 38.0 37.0 38.0 45-49 37.086600000000004 38.0 38.0 38.0 36.2 38.0 50-54 36.956849999999996 38.0 38.0 38.0 36.0 38.0 55-59 36.930350000000004 38.0 38.0 38.0 36.0 38.0 60-64 36.9182 38.0 38.0 38.0 36.0 38.0 65-69 36.880199999999995 38.0 38.0 38.0 36.0 38.0 70-74 36.75515 38.0 38.0 38.0 35.0 38.0 75-79 36.665299999999995 38.0 38.0 38.0 35.0 38.0 80-84 36.56875 38.0 38.0 38.0 34.2 38.0 85-89 36.52275 38.0 38.0 38.0 34.0 38.0 90-94 36.34455 38.0 38.0 38.0 33.8 38.0 95-99 36.24445 38.0 37.8 38.0 33.6 38.0 100-104 36.15325 38.0 37.6 38.0 33.8 38.0 105-109 36.0032 38.0 37.2 38.0 33.2 38.0 110-114 35.766450000000006 38.0 37.0 38.0 31.8 38.0 115-119 35.521 38.0 37.0 38.0 30.8 38.0 120-124 35.37265 38.0 36.0 38.0 30.2 38.0 125-129 35.12095 38.0 36.0 38.0 28.4 38.0 130-134 34.7798 38.0 35.0 38.0 27.6 38.0 135-139 34.4191 38.0 35.0 38.0 25.8 38.0 140-144 33.80174999999999 38.0 35.0 38.0 22.6 38.0 145-149 32.777300000000004 38.0 33.8 38.0 15.0 38.0 150-151 29.030375 36.0 24.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 2.0 4 1.0 5 0.0 6 2.0 7 1.0 8 0.0 9 0.0 10 0.0 11 3.0 12 0.0 13 4.0 14 1.0 15 3.0 16 2.0 17 2.0 18 5.0 19 3.0 20 8.0 21 4.0 22 7.0 23 13.0 24 21.0 25 10.0 26 14.0 27 27.0 28 32.0 29 31.0 30 41.0 31 59.0 32 87.0 33 125.0 34 145.0 35 290.0 36 690.0 37 2365.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.1 16.75 15.325 29.825000000000003 2 24.325 22.425 36.625 16.625 3 19.900000000000002 26.474999999999998 33.625 20.0 4 24.925 32.75 22.75 19.575 5 22.575 37.6 22.05 17.775 6 18.475 38.65 24.5 18.375 7 16.55 16.8 44.800000000000004 21.85 8 21.725 20.424999999999997 27.575 30.275000000000002 9 22.475 23.75 28.499999999999996 25.275 10-14 22.55 28.38 26.91 22.16 15-19 23.375 27.77 28.055000000000003 20.8 20-24 23.674999999999997 28.37 27.505000000000003 20.45 25-29 23.345 27.87 28.485 20.3 30-34 23.125 28.000000000000004 28.28 20.595 35-39 22.99 27.834999999999997 28.689999999999998 20.485 40-44 23.28 27.834999999999997 28.634999999999998 20.25 45-49 22.465 27.71 28.38 21.445 50-54 23.425 28.03 28.595 19.950000000000003 55-59 23.27 27.765 28.7 20.265 60-64 23.29 28.345 28.439999999999998 19.925 65-69 23.835 27.165 29.03 19.97 70-74 23.549999999999997 27.935 28.48 20.035 75-79 23.775 27.575 28.634999999999998 20.015 80-84 23.13 27.794999999999998 28.59 20.485 85-89 23.76 27.845 28.51 19.885 90-94 24.03 27.87 27.92 20.18 95-99 23.455000000000002 27.35 28.54 20.655 100-104 23.875 27.534999999999997 28.705000000000002 19.885 105-109 23.5 27.525 29.345 19.63 110-114 23.575 27.935 28.634999999999998 19.855 115-119 24.205 27.47 28.315 20.01 120-124 24.224999999999998 27.18 28.77 19.825 125-129 24.195 27.939999999999998 28.09 19.775000000000002 130-134 25.205 27.43 28.51 18.855 135-139 25.11 26.625 29.080000000000002 19.185 140-144 25.155 27.589999999999996 28.28 18.975 145-149 25.485000000000003 27.74 27.99 18.785 150-151 25.897660452896282 26.785937695483547 28.612535968972853 18.703865882647317 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 1.0 23 1.5 24 2.5 25 6.0 26 10.0 27 11.5 28 7.0 29 8.5 30 18.0 31 27.0 32 33.5 33 36.0 34 42.0 35 68.0 36 88.5 37 117.5 38 155.0 39 173.5 40 203.0 41 233.0 42 237.5 43 242.5 44 278.5 45 279.5 46 260.5 47 244.5 48 221.5 49 204.0 50 170.0 51 132.0 52 117.5 53 97.5 54 71.0 55 54.5 56 34.5 57 28.5 58 20.0 59 9.0 60 9.0 61 11.5 62 7.5 63 5.0 64 6.5 65 4.0 66 1.0 67 0.5 68 1.5 69 2.0 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.08791487205472 97.775 2 0.6587281479604763 1.3 3 0.12667848999239928 0.375 4 0.07600709399543958 0.3 5 0.05067139599695972 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCTCC 5 0.125 No Hit GCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCCTATTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.4875 0.0 0.0 0.0 0.0 94-95 0.5375000000000001 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.75 0.0 0.0 0.0 0.0 100-101 0.8999999999999999 0.0 0.0 0.0 0.0125 102-103 1.2125 0.0 0.0 0.0 0.025 104-105 1.6875 0.0 0.0 0.0 0.025 106-107 1.925 0.0 0.0 0.0 0.025 108-109 2.25 0.0 0.0 0.0 0.025 110-111 2.5875 0.0 0.0 0.0 0.025 112-113 2.925 0.0 0.0 0.0 0.025 114-115 3.3 0.0 0.0 0.0 0.025 116-117 3.625 0.0 0.0 0.0 0.025 118-119 3.9375 0.0 0.0 0.0 0.025 120-121 4.3625 0.0 0.0 0.0 0.025 122-123 4.875 0.0 0.0 0.0 0.025 124-125 5.5875 0.0 0.0 0.0 0.025 126-127 6.0875 0.0 0.0 0.0 0.025 128-129 6.675 0.0 0.0 0.0 0.025 130-131 7.325 0.0 0.0 0.0 0.025 132-133 7.9 0.0 0.0 0.0 0.025 134-135 8.425 0.0 0.0 0.0 0.025 136-137 9.2 0.0 0.0 0.0 0.025 138-139 9.875 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 846184 spots for SRR7166132.sra Written 846184 spots for SRR7166132.sra Read 846184 spots for SRR7166132.sra Written 846184 spots for SRR7166132.sra Read 846184 spots for SRR7166132.sra Written 846184 spots for SRR7166132.sra Read 846184 spots for SRR7166132.sra Written 846184 spots for SRR7166132.sra Read 846184 spots for SRR7166132.sra Written 846184 spots for SRR7166132.sra Read 846184 spots for SRR7166132.sra Written 846184 spots for SRR7166132.sra Read 846184 spots for SRR7166132.sra Written 846184 spots for SRR7166132.sra Read 846184 spots for SRR7166132.sra Written 846184 spots for SRR7166132.sra Read 846184 spots for SRR7166132.sra Written 846184 spots for SRR7166132.sra Read 846184 spots for SRR7166132.sra Written 846184 spots for SRR7166132.sra Read 846184 spots for SRR7166132.sra Written 846184 spots for SRR7166132.sra Read 846184 spots for SRR7166132.sra Written 846184 spots for SRR7166132.sra Read 846184 spots for SRR7166132.sra Written 846184 spots for SRR7166132.sra Read 846184 spots for SRR7166132.sra Written 846184 spots for SRR7166132.sra Read 846196 spots for SRR7166132.sra Written 846196 spots for SRR7166132.sra Read 846184 spots for SRR7166132.sra Written 846184 spots for SRR7166132.sra Read 846184 spots for SRR7166132.sra Written 846184 spots for SRR7166132.sra Read 846184 spots for SRR7166132.sra Written 846184 spots for SRR7166132.sra Read 846184 spots for SRR7166132.sra Written 846184 spots for SRR7166132.sra Read 846184 spots for SRR7166132.sra Written 846184 spots for SRR7166132.sra SRR ids: ['SRR7166132.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_q1scde6e SRR7166132.sra spots: 16923692 blocks: [[1, 846184], [846185, 1692368], [1692369, 2538552], [2538553, 3384736], [3384737, 4230920], [4230921, 5077104], [5077105, 5923288], [5923289, 6769472], [6769473, 7615656], [7615657, 8461840], [8461841, 9308024], [9308025, 10154208], [10154209, 11000392], [11000393, 11846576], [11846577, 12692760], [12692761, 13538944], [13538945, 14385128], [14385129, 15231312], [15231313, 16077496], [16077497, 16923692]] SRR7166132 file size 5713183 SRR7166132 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166132 SRR7166132_1.fastq SRR7166132_2.fastq Input file: SRR7166132_1.fastq Paired file: SRR7166132_2.fastq trimmed: SRR7166132-trimmed-pair1.fastq, SRR7166132-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 14:54:07 2025 >> started Fri Feb 14 14:54:26 2025 >> done (18.845s) 16923692 read pairs processed; of these: 5907 ( 0.03%) short read pairs filtered out after trimming by size control 8451 ( 0.05%) empty read pairs filtered out after trimming by size control 16909334 (99.92%) read pairs available; of these: 7572839 (44.78%) trimmed read pairs available after processing 9336495 (55.22%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 6 0.00% 20 4 0.00% 21 12 0.00% 22 7 0.00% 23 5 0.00% 24 5 0.00% 25 2 0.00% 26 7 0.00% 27 5 0.00% 28 7 0.00% 29 8 0.00% 30 4 0.00% 31 8 0.00% 32 2 0.00% 33 7 0.00% 34 10 0.00% 35 9 0.00% 36 11 0.00% 37 6 0.00% 38 9 0.00% 39 9 0.00% 40 8 0.00% 41 13 0.00% 42 20 0.00% 43 21 0.00% 44 22 0.00% 45 20 0.00% 46 33 0.00% 47 29 0.00% 48 43 0.00% 49 39 0.00% 50 60 0.00% 51 65 0.00% 52 81 0.00% 53 80 0.00% 54 97 0.00% 55 114 0.00% 56 114 0.00% 57 168 0.00% 58 178 0.00% 59 184 0.00% 60 212 0.00% 61 276 0.00% 62 296 0.00% 63 339 0.00% 64 386 0.00% 65 426 0.00% 66 473 0.00% 67 557 0.00% 68 616 0.00% 69 700 0.00% 70 785 0.00% 71 1058 0.01% 72 1179 0.01% 73 1381 0.01% 74 1522 0.01% 75 1722 0.01% 76 1904 0.01% 77 2108 0.01% 78 2277 0.01% 79 2706 0.02% 80 3082 0.02% 81 3588 0.02% 82 4122 0.02% 83 4827 0.03% 84 5466 0.03% 85 6238 0.04% 86 6692 0.04% 87 7217 0.04% 88 7759 0.05% 89 8103 0.05% 90 9134 0.05% 91 10158 0.06% 92 11500 0.07% 93 12407 0.07% 94 13712 0.08% 95 14608 0.09% 96 15669 0.09% 97 16247 0.10% 98 16767 0.10% 99 18437 0.11% 100 18736 0.11% 101 20021 0.12% 102 21424 0.13% 103 23653 0.14% 104 24876 0.15% 105 26633 0.16% 106 27737 0.16% 107 28146 0.17% 108 28721 0.17% 109 29517 0.17% 110 30784 0.18% 111 32201 0.19% 112 34272 0.20% 113 37412 0.22% 114 38845 0.23% 115 41292 0.24% 116 42726 0.25% 117 43515 0.26% 118 43852 0.26% 119 44881 0.27% 120 45340 0.27% 121 47535 0.28% 122 48921 0.29% 123 52115 0.31% 124 54962 0.33% 125 56877 0.34% 126 58647 0.35% 127 59390 0.35% 128 60680 0.36% 129 61651 0.36% 130 63230 0.37% 131 64743 0.38% 132 67235 0.40% 133 70842 0.42% 134 75096 0.44% 135 78081 0.46% 136 81366 0.48% 137 84624 0.50% 138 87368 0.52% 139 90875 0.54% 140 93803 0.55% 141 100728 0.60% 142 107896 0.64% 143 117947 0.70% 144 133951 0.79% 145 155859 0.92% 146 187229 1.11% 147 238966 1.41% 148 344156 2.04% 149 652499 3.86% 150 3272794 19.35% 151 9336495 55.22% 16909334 reads passed initial QC criterion=sequence-density sequence-density=1.22 sequence-density-rank=1 fanout-score=2.74 fanout-score-rank=23 prefix-density=1.70 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=28.45 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.7 sequence=TTTTTTTTACGTTTCATCAATGGCACTCTCTCACAGCCAATAACTTCAACAACTTCCCTATCTTTAATCCTCTCACTCCACAAATTCATAAGCTTCACCATTTTACTTCACCAATTCCTTAGAGATGTAATAGCCCATAACAATAGGAAATATCAGAAATCCAATAAGAATCAGCAATTCAGGAAGAAATATGACAAGGAGTAGTAGTGTGGATGTTGTTGTTAGACACTTCTTTTTGTCTTTAAATATAAGGCGTGGTAGAATTACTGGCACTCCAATGATTCCATATAACGGCCATAATGGAGCTATAGAATACAACACCAACGTCGCAAAAAACCAGCAAAAATTCTTAACATTATTTTTAGAAATCCCATACTGCCACCGAATATTCAGTCCTTTAAGAAATCGAACAGCATACCCAACATAGTAAAAACCATCAATAATGCAAATACCGTTACCACAAGTGCAAATACTCCCATT criterion=sequence-density sequence-density=1.52 sequence-density-rank=1 fanout-score=2.58 fanout-score-rank=14 prefix-density=1.53 prefix-fanout=2.6 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.35 sequence-density-rank=19 fanout-score=13.84 fanout-score-rank=1 prefix-density=1.51 prefix-fanout=3.2 sequence=TGCAAGTGCGGATCAAACTG SRR7166132 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 14:55:48 Started mapping on | Feb 14 14:55:48 Finished on | Feb 14 14:58:55 Mapping speed, Million of reads per hour | 325.53 Number of input reads | 16909334 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 15456911 Uniquely mapped reads % | 91.41% Average mapped length | 292.05 Number of splices: Total | 13718396 Number of splices: Annotated (sjdb) | 13437256 Number of splices: GT/AG | 13497999 Number of splices: GC/AG | 168512 Number of splices: AT/AC | 10842 Number of splices: Non-canonical | 41043 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.04% Deletion average length | 2.62 Insertion rate per base | 0.02% Insertion average length | 2.20 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 370904 % of reads mapped to multiple loci | 2.19% Number of reads mapped to too many loci | 34947 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.13% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1087780 1087780 1087780 N_multimapping 370904 370904 370904 N_noFeature 537424 15239897 646392 N_ambiguous 179573 1151 70837 UnstrandedReadsAssigned:14739914 PositiveStrandReadsAssigned:215863 NegativeStrandReadsAssigned:14739682 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7166132 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166132-trimmed-pair1.fastq SRR7166132-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,909,334 reads, 14,514,333 reads pseudoaligned [quant] estimated average fragment length: 223.518 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,171 rounds 52401 SRR7166132.ke.tsv 34699 SRR7166132.se.tsv 87100 total ==> SRR7166132.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1795.48 1846 55.2135 Potri.005G024800.1.v4.1 1035 812.482 551 36.4194 Potri.004G059700.1.v4.1 961 738.496 36 2.61787 Potri.007G009000.2.v4.1 1416 1193.48 0 0 Potri.003G141000.2.v4.1 2943 2720.48 936.654 18.4896 Potri.016G087400.1.v4.1 270 88.9788 1289.16 778.064 Potri.015G069301.1.v4.1 564 344.631 0 0 Potri.010G195200.1.v4.1 1773 1550.48 344 11.9148 Potri.012G127500.1.v4.1 977 754.487 6245 444.504 ==> SRR7166132.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 165 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 952 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 347 SRR7166132 completed mapping pipeline successfully