Starting /dee2/code/volunteer_pipeline.sh SRR7166133 current disk space = 3112636059648 free memory = 1563941440 SRR7166133 SRAfilesize d43b94ffdd8a1a3b3c739c9179e0b234 SRR7166133.sra SRR7166133.sra file validated SRR7166133 is paired end SRR7166133 is conventional basespace SRR7166133 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166133_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.6315 33.0 32.0 34.0 27.0 34.0 2 32.0845 33.0 33.0 34.0 29.0 34.0 3 31.9195 33.0 31.0 34.0 28.0 34.0 4 32.271 33.0 33.0 34.0 30.0 34.0 5 32.2525 33.0 33.0 34.0 30.0 34.0 6 36.44925 38.0 37.0 38.0 34.0 38.0 7 36.8615 38.0 37.0 38.0 35.0 38.0 8 37.025 38.0 38.0 38.0 35.0 38.0 9 36.988 38.0 38.0 38.0 35.0 38.0 10-14 36.83775 38.0 38.0 38.0 35.0 38.0 15-19 36.6956 38.0 38.0 38.0 34.2 38.0 20-24 36.85015 38.0 38.0 38.0 35.0 38.0 25-29 36.50075 38.0 37.8 38.0 34.0 38.0 30-34 36.26185 38.0 37.2 38.0 32.8 38.0 35-39 36.127950000000006 38.0 37.0 38.0 32.4 38.0 40-44 36.0934 38.0 37.0 38.0 32.2 38.0 45-49 36.041549999999994 38.0 37.0 38.0 31.8 38.0 50-54 35.9187 38.0 37.0 38.0 30.6 38.0 55-59 35.75195 38.0 36.8 38.0 30.0 38.0 60-64 35.50115 38.0 36.0 38.0 29.0 38.0 65-69 35.57405 38.0 36.2 38.0 29.0 38.0 70-74 35.4242 38.0 36.0 38.0 29.0 38.0 75-79 34.718450000000004 38.0 35.8 38.0 26.6 38.0 80-84 34.407500000000006 38.0 35.0 38.0 25.8 38.0 85-89 34.456 38.0 34.4 38.0 25.2 38.0 90-94 34.6126 38.0 35.0 38.0 25.6 38.0 95-99 34.04085 38.0 34.2 38.0 22.0 38.0 100-104 33.4584 37.4 33.6 38.0 16.6 38.0 105-109 33.34715 37.2 33.4 38.0 16.6 38.0 110-114 32.231849999999994 37.0 30.0 38.0 15.0 38.0 115-119 32.49135 37.0 31.0 38.0 15.0 38.0 120-124 31.75305 36.6 29.4 38.0 15.0 38.0 125-129 31.52805 36.4 29.4 38.0 14.6 38.0 130-134 30.173750000000002 35.2 25.4 38.0 13.4 38.0 135-139 28.77445 33.4 22.2 38.0 13.0 38.0 140-144 27.488349999999997 33.6 18.0 38.0 2.0 38.0 145-149 25.60725 33.0 10.8 38.0 2.0 38.0 150-151 19.306375000000003 17.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 2.0 9 1.0 10 0.0 11 0.0 12 2.0 13 0.0 14 2.0 15 3.0 16 6.0 17 2.0 18 9.0 19 10.0 20 7.0 21 21.0 22 30.0 23 24.0 24 44.0 25 55.0 26 93.0 27 88.0 28 122.0 29 149.0 30 147.0 31 178.0 32 254.0 33 287.0 34 420.0 35 568.0 36 815.0 37 661.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.911392405063292 18.10126582278481 12.430379746835444 38.55696202531645 2 19.05 27.325 36.8 16.825000000000003 3 15.8 32.9 26.5 24.8 4 19.85 39.85 21.0 19.3 5 20.825 38.65 22.650000000000002 17.875 6 15.299999999999999 39.125 24.425 21.15 7 12.0 20.875 44.9 22.225 8 17.45 21.55 27.224999999999998 33.775 9 16.400000000000002 23.35 29.925 30.325000000000003 10-14 18.235 31.814999999999998 26.445 23.505000000000003 15-19 18.94 30.03 27.474999999999998 23.555 20-24 18.625 30.130000000000003 27.92 23.325000000000003 25-29 19.24 29.86 27.35 23.549999999999997 30-34 19.57 29.615000000000002 27.66 23.155 35-39 19.259999999999998 29.654999999999998 27.97 23.115 40-44 19.605 30.14 27.01 23.244999999999997 45-49 19.655 29.15 27.215 23.98 50-54 19.0 29.86 27.805000000000003 23.335 55-59 19.42 29.98 27.235 23.365 60-64 19.025 29.845 27.939999999999998 23.189999999999998 65-69 19.345000000000002 29.360000000000003 27.755000000000003 23.54 70-74 19.74066286172024 29.498347852207868 27.50075097626915 23.260238309802745 75-79 19.631683369791933 29.582337080938085 27.094673653151546 23.69130589611843 80-84 19.718597063621534 29.2771207177814 27.044249592169656 23.960032626427406 85-89 19.655 28.935 28.02 23.39 90-94 19.53 29.225 27.365000000000002 23.880000000000003 95-99 19.73 28.675 28.055000000000003 23.54 100-104 19.75 28.915000000000003 27.185 24.15 105-109 19.885 28.87 27.445000000000004 23.799999999999997 110-114 20.3 28.99 27.375 23.335 115-119 20.41 29.065 27.555000000000003 22.97 120-124 19.76889600320144 29.023060377169724 27.18723425541494 24.020809364213896 125-129 20.975975975975977 28.993993993993993 26.906906906906908 23.123123123123122 130-134 21.204016753292628 28.869152747640914 26.073573194731797 23.85325730433466 135-139 20.987036388207617 28.539966965313578 26.953300966014314 23.519695680464487 140-144 20.920460230115058 28.71935967983992 26.47823911955978 23.881940970485243 145-149 20.38523274478331 28.054775280898873 27.29233547351525 24.267656500802566 150-151 20.839073262366938 26.950532247964937 27.025673137132124 25.184721352536005 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.0 21 2.0 22 3.0 23 1.5 24 1.5 25 2.5 26 5.5 27 13.0 28 21.5 29 23.5 30 25.5 31 35.5 32 48.0 33 63.5 34 86.0 35 108.5 36 127.0 37 142.0 38 155.5 39 187.5 40 227.0 41 230.5 42 248.5 43 262.5 44 246.0 45 260.0 46 255.0 47 217.0 48 189.0 49 177.0 50 155.0 51 120.0 52 86.0 53 68.0 54 58.0 55 44.0 56 29.0 57 17.5 58 13.5 59 8.0 60 6.0 61 5.5 62 5.5 63 2.5 64 2.0 65 2.5 66 1.5 67 2.5 68 2.0 69 1.0 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.13 75-79 1.7149999999999999 80-84 1.92 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.045 125-129 0.1 130-134 0.915 135-139 0.105 140-144 0.05 145-149 0.32 150-151 0.1875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39607448414695 98.75 2 0.5535983895319577 1.0999999999999999 3 0.050327126321087066 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.6875 0.0 0.0 0.0 0.0 100-101 0.8375 0.0 0.0 0.0 0.0 102-103 1.025 0.0 0.0 0.0 0.0 104-105 1.175 0.0 0.0 0.0 0.0 106-107 1.525 0.0 0.0 0.0 0.0 108-109 1.825 0.0 0.0 0.0 0.0 110-111 2.1375 0.0 0.0 0.0 0.0 112-113 2.3499999999999996 0.0 0.0 0.0 0.0 114-115 2.6125 0.0 0.0 0.0 0.0 116-117 2.8875 0.0 0.0 0.0 0.0 118-119 3.225 0.0 0.0 0.0 0.0 120-121 3.5999999999999996 0.0 0.0 0.0 0.0 122-123 3.8875 0.0 0.0 0.0 0.0 124-125 4.25 0.0 0.0 0.0 0.0 126-127 4.6875 0.0 0.0 0.0 0.0 128-129 5.2 0.0 0.0 0.0 0.0 130-131 5.7 0.0 0.0 0.0 0.0 132-133 6.1875 0.0 0.0 0.0 0.0 134-135 6.875 0.0 0.0 0.0 0.0 136-137 7.475 0.0 0.0 0.0 0.0 138-139 8.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAGGCC 10 0.0069465647 144.1875 2 >>END_MODULE SRR7166133 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166133_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.53825 33.0 33.0 34.0 31.0 34.0 2 32.67925 33.0 33.0 34.0 32.0 34.0 3 32.7715 34.0 33.0 34.0 32.0 34.0 4 32.6495 34.0 33.0 34.0 32.0 34.0 5 32.67325 34.0 33.0 34.0 32.0 34.0 6 36.65875 38.0 38.0 38.0 34.0 38.0 7 36.729 38.0 38.0 38.0 34.0 38.0 8 36.75475 38.0 38.0 38.0 35.0 38.0 9 36.78225 38.0 38.0 38.0 35.0 38.0 10-14 36.58935 38.0 38.0 38.0 34.4 38.0 15-19 36.52565 38.0 38.0 38.0 34.0 38.0 20-24 36.42895 38.0 38.0 38.0 33.8 38.0 25-29 36.48425 38.0 38.0 38.0 34.2 38.0 30-34 36.51805 38.0 38.0 38.0 34.0 38.0 35-39 36.447500000000005 38.0 38.0 38.0 33.8 38.0 40-44 36.135450000000006 38.0 37.8 38.0 32.6 38.0 45-49 36.01915 38.0 37.4 38.0 31.0 38.0 50-54 35.97545 38.0 37.2 38.0 31.4 38.0 55-59 36.01195 38.0 37.0 38.0 32.0 38.0 60-64 35.853300000000004 38.0 37.0 38.0 30.8 38.0 65-69 35.817899999999995 38.0 37.0 38.0 31.0 38.0 70-74 35.5764 38.0 37.0 38.0 29.0 38.0 75-79 35.467200000000005 38.0 36.8 38.0 28.8 38.0 80-84 35.43685000000001 38.0 36.8 38.0 29.0 38.0 85-89 35.333 38.0 36.6 38.0 29.0 38.0 90-94 35.04065 38.0 36.0 38.0 27.8 38.0 95-99 34.5855 38.0 35.4 38.0 25.6 38.0 100-104 34.503550000000004 38.0 35.0 38.0 25.4 38.0 105-109 34.48805 38.0 35.0 38.0 25.0 38.0 110-114 34.13985 38.0 34.6 38.0 23.0 38.0 115-119 33.74345 38.0 34.0 38.0 21.4 38.0 120-124 33.03865 38.0 33.8 38.0 15.0 38.0 125-129 32.34625 37.8 31.0 38.0 15.0 38.0 130-134 31.333799999999997 36.6 30.0 38.0 13.6 38.0 135-139 30.801949999999998 36.0 29.2 38.0 13.2 38.0 140-144 30.052750000000003 36.0 28.2 38.0 7.8 38.0 145-149 27.59115 33.8 18.2 38.0 2.0 38.0 150-151 21.706875 26.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 1.0 4 2.0 5 3.0 6 1.0 7 1.0 8 0.0 9 3.0 10 2.0 11 2.0 12 0.0 13 5.0 14 4.0 15 5.0 16 10.0 17 12.0 18 10.0 19 9.0 20 10.0 21 13.0 22 25.0 23 33.0 24 32.0 25 53.0 26 48.0 27 61.0 28 73.0 29 69.0 30 123.0 31 141.0 32 181.0 33 216.0 34 300.0 35 436.0 36 739.0 37 1371.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.925000000000004 15.75 14.6 33.725 2 23.425 22.725 39.025 14.825 3 21.075 25.374999999999996 32.85 20.7 4 25.30632658164541 33.558389597399355 21.180295073768445 19.954988747186796 5 23.25 36.975 23.1 16.675 6 17.474999999999998 38.95 23.849999999999998 19.725 7 15.950000000000001 15.675 46.025 22.35 8 20.4 21.075 28.9 29.625 9 23.1 23.425 26.950000000000003 26.525 10-14 22.814999999999998 28.849999999999998 27.455000000000002 20.880000000000003 15-19 23.345 28.17 28.42 20.064999999999998 20-24 23.525 28.015 28.225 20.235 25-29 22.755 28.015 28.82 20.41 30-34 22.955000000000002 27.73 29.07 20.244999999999997 35-39 22.915 28.275 28.294999999999998 20.515 40-44 23.35 28.265 28.4 19.985 45-49 24.02 27.22 28.660000000000004 20.1 50-54 22.785 28.645 28.32 20.25 55-59 23.57 28.244999999999997 28.000000000000004 20.185 60-64 22.99 27.29 28.965000000000003 20.755000000000003 65-69 23.275000000000002 27.355 29.07 20.3 70-74 23.335 27.55 28.955 20.16 75-79 23.400000000000002 27.575 29.01 20.015 80-84 23.369999999999997 28.01 29.015 19.605 85-89 23.995 27.87 28.634999999999998 19.5 90-94 23.21 27.485 29.060000000000002 20.244999999999997 95-99 23.57 28.46 28.355000000000004 19.615 100-104 23.656182809140457 28.746437321866093 27.91139556977849 19.68598429921496 105-109 23.872161648494547 27.488246473942183 28.458537561268383 20.18105431629489 110-114 23.755938984746187 28.072018004501125 28.307076769192296 19.86496624156039 115-119 23.425 28.17 28.605000000000004 19.8 120-124 24.2 27.85 28.28 19.67 125-129 24.295 28.310000000000002 28.43 18.965 130-134 24.47 28.57 27.775 19.185 135-139 24.875 27.834999999999997 28.615000000000002 18.675 140-144 24.845 27.74 28.27 19.145 145-149 25.729999999999997 27.800000000000004 28.015 18.455 150-151 25.7875 27.675 28.462500000000002 18.075 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.5 18 1.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 1.0 25 3.5 26 4.0 27 4.0 28 10.0 29 12.0 30 18.0 31 25.5 32 34.0 33 49.5 34 63.0 35 70.5 36 95.5 37 115.5 38 141.0 39 179.0 40 200.0 41 232.0 42 266.0 43 281.5 44 277.0 45 268.0 46 255.5 47 256.0 48 236.5 49 196.5 50 167.0 51 130.5 52 100.5 53 80.5 54 62.5 55 45.0 56 33.5 57 24.5 58 13.5 59 10.5 60 10.5 61 6.5 62 2.5 63 1.5 64 3.0 65 3.0 66 1.5 67 0.5 68 1.0 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.025 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.005 105-109 0.03 110-114 0.025 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21697398332913 98.2 2 0.6314725940894165 1.25 3 0.07577671129072998 0.22499999999999998 4 0.050517807527153326 0.2 5 0.025258903763576663 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCCTATTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.32499999999999996 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.55 0.0 0.0 0.0 0.0 98-99 0.7125 0.0 0.0 0.0 0.0 100-101 0.8625 0.0 0.0 0.0 0.0 102-103 1.0499999999999998 0.0 0.0 0.0 0.0 104-105 1.2 0.0 0.0 0.0 0.0 106-107 1.5499999999999998 0.0 0.0 0.0 0.0 108-109 1.9 0.0 0.0 0.0 0.0 110-111 2.2125 0.0 0.0 0.0 0.0 112-113 2.425 0.0 0.0 0.0 0.0 114-115 2.675 0.0 0.0 0.0 0.0 116-117 2.9749999999999996 0.0 0.0 0.0 0.0 118-119 3.35 0.0 0.0 0.0 0.0 120-121 3.7750000000000004 0.0 0.0 0.0 0.0 122-123 4.0875 0.0 0.0 0.0 0.0 124-125 4.5 0.0 0.0 0.0 0.0 126-127 4.9 0.0 0.0 0.0 0.0 128-129 5.3875 0.0 0.0 0.0 0.0 130-131 5.95 0.0 0.0 0.0 0.0 132-133 6.4875 0.0 0.0 0.0 0.0 134-135 7.1375 0.0 0.0 0.0 0.0 136-137 7.875 0.0 0.0 0.0 0.0 138-139 8.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 924673 spots for SRR7166133.sra Written 924673 spots for SRR7166133.sra Read 924678 spots for SRR7166133.sra Written 924678 spots for SRR7166133.sra Read 924673 spots for SRR7166133.sra Written 924673 spots for SRR7166133.sra Read 924673 spots for SRR7166133.sra Written 924673 spots for SRR7166133.sra Read 924673 spots for SRR7166133.sra Written 924673 spots for SRR7166133.sra Read 924673 spots for SRR7166133.sra Written 924673 spots for SRR7166133.sra Read 924673 spots for SRR7166133.sra Written 924673 spots for SRR7166133.sra Read 924673 spots for SRR7166133.sra Written 924673 spots for SRR7166133.sra Read 924673 spots for SRR7166133.sra Written 924673 spots for SRR7166133.sra Read 924673 spots for SRR7166133.sra Written 924673 spots for SRR7166133.sra Read 924673 spots for SRR7166133.sra Written 924673 spots for SRR7166133.sra Read 924673 spots for SRR7166133.sra Written 924673 spots for SRR7166133.sra Read 924673 spots for SRR7166133.sra Written 924673 spots for SRR7166133.sra Read 924673 spots for SRR7166133.sra Written 924673 spots for SRR7166133.sra Read 924673 spots for SRR7166133.sra Written 924673 spots for SRR7166133.sra Read 924673 spots for SRR7166133.sra Written 924673 spots for SRR7166133.sra Read 924673 spots for SRR7166133.sra Written 924673 spots for SRR7166133.sra Read 924673 spots for SRR7166133.sra Written 924673 spots for SRR7166133.sra Read 924673 spots for SRR7166133.sra Written 924673 spots for SRR7166133.sra Read 924673 spots for SRR7166133.sra Written 924673 spots for SRR7166133.sra SRR ids: ['SRR7166133.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_e5vd5cvx SRR7166133.sra spots: 18493465 blocks: [[1, 924673], [924674, 1849346], [1849347, 2774019], [2774020, 3698692], [3698693, 4623365], [4623366, 5548038], [5548039, 6472711], [6472712, 7397384], [7397385, 8322057], [8322058, 9246730], [9246731, 10171403], [10171404, 11096076], [11096077, 12020749], [12020750, 12945422], [12945423, 13870095], [13870096, 14794768], [14794769, 15719441], [15719442, 16644114], [16644115, 17568787], [17568788, 18493465]] SRR7166133 file size 6245128 SRR7166133 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166133 SRR7166133_1.fastq SRR7166133_2.fastq Input file: SRR7166133_1.fastq Paired file: SRR7166133_2.fastq trimmed: SRR7166133-trimmed-pair1.fastq, SRR7166133-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 15:11:42 2025 >> started Fri Feb 14 15:12:01 2025 >> done (19.697s) 18493465 read pairs processed; of these: 16182 ( 0.09%) short read pairs filtered out after trimming by size control 15437 ( 0.08%) empty read pairs filtered out after trimming by size control 18461846 (99.83%) read pairs available; of these: 12183372 (65.99%) trimmed read pairs available after processing 6278474 (34.01%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 3 0.00% 20 4 0.00% 21 7 0.00% 22 6 0.00% 23 8 0.00% 24 2 0.00% 25 6 0.00% 26 3 0.00% 27 6 0.00% 28 8 0.00% 29 8 0.00% 30 5 0.00% 31 9 0.00% 32 12 0.00% 33 14 0.00% 34 10 0.00% 35 5 0.00% 36 9 0.00% 37 8 0.00% 38 20 0.00% 39 19 0.00% 40 16 0.00% 41 19 0.00% 42 22 0.00% 43 25 0.00% 44 29 0.00% 45 17 0.00% 46 25 0.00% 47 48 0.00% 48 56 0.00% 49 57 0.00% 50 52 0.00% 51 70 0.00% 52 79 0.00% 53 103 0.00% 54 106 0.00% 55 115 0.00% 56 139 0.00% 57 164 0.00% 58 184 0.00% 59 253 0.00% 60 227 0.00% 61 302 0.00% 62 312 0.00% 63 345 0.00% 64 434 0.00% 65 467 0.00% 66 608 0.00% 67 609 0.00% 68 727 0.00% 69 831 0.00% 70 969 0.01% 71 1131 0.01% 72 1196 0.01% 73 1476 0.01% 74 1664 0.01% 75 1830 0.01% 76 2115 0.01% 77 2241 0.01% 78 2583 0.01% 79 2807 0.02% 80 3323 0.02% 81 3827 0.02% 82 4420 0.02% 83 4994 0.03% 84 6029 0.03% 85 6815 0.04% 86 7363 0.04% 87 7991 0.04% 88 8677 0.05% 89 9243 0.05% 90 9999 0.05% 91 11395 0.06% 92 12150 0.07% 93 13389 0.07% 94 14567 0.08% 95 15509 0.08% 96 16511 0.09% 97 17593 0.10% 98 18633 0.10% 99 19870 0.11% 100 21109 0.11% 101 22731 0.12% 102 24283 0.13% 103 26189 0.14% 104 27537 0.15% 105 29350 0.16% 106 30426 0.16% 107 31611 0.17% 108 32621 0.18% 109 34718 0.19% 110 36501 0.20% 111 38737 0.21% 112 41066 0.22% 113 42951 0.23% 114 45923 0.25% 115 48631 0.26% 116 49970 0.27% 117 52778 0.29% 118 54528 0.30% 119 56732 0.31% 120 58813 0.32% 121 62076 0.34% 122 64873 0.35% 123 68164 0.37% 124 73167 0.40% 125 76329 0.41% 126 80546 0.44% 127 84244 0.46% 128 87438 0.47% 129 93418 0.51% 130 97563 0.53% 131 103276 0.56% 132 110627 0.60% 133 118334 0.64% 134 127099 0.69% 135 137601 0.75% 136 143921 0.78% 137 151645 0.82% 138 163064 0.88% 139 181838 0.98% 140 206097 1.12% 141 200650 1.09% 142 220583 1.19% 143 244104 1.32% 144 284166 1.54% 145 341500 1.85% 146 430447 2.33% 147 570883 3.09% 148 792661 4.29% 149 1397686 7.57% 150 4425239 23.97% 151 6278474 34.01% 18461846 reads passed initial QC criterion=sequence-density sequence-density=0.84 sequence-density-rank=1 fanout-score=2.99 fanout-score-rank=21 prefix-density=1.26 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=36.30 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=7.5 sequence=AAAAAGAGAGATGAAATAACATTACAAACGAGGAAGCAGCCGCAGCTTTAGCTTCTACTTTTATTTAATAGTTTTATAGATTACACAAAGGAAATACAACACAAGATCTCCCCACAAATCACACACATTGATGCAGTACTGAACTCGTTGCACGAAAGCGCTTAGATATATATTATACAAGTACTAGCATGATCACAAACATGTGATGCTTATTGGTCGAGATCGATGACCCCTTCTATTACTCCGTGCTAAGGGCTTCGTCGATGTCTTTAGTCATATGAACCATAAGATCAACATAAATCTCTGGAACCGGGACTTCAGGATGGAGTTTTTCGTATTCAATGGTCAGTTTTGCCAAGCAGCCCGAGCCTTTTGGTGTAAGCTGCCAGACGGGCCTATAGACCTTGTAAATTTTCATGACATCTCCTTCCAAACCATTAAGAGTTATGATCTTGTTCTCATCATCGAAGGAAACCTCCTCTTTAAAGACCCCGGCTTTCCCTCCGATTGT criterion=sequence-density sequence-density=1.14 sequence-density-rank=1 fanout-score=2.43 fanout-score-rank=25 prefix-density=1.15 prefix-fanout=2.4 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.20 sequence-density-rank=19 fanout-score=18.72 fanout-score-rank=1 prefix-density=1.15 prefix-fanout=3.3 sequence=TGCAAGTGCGGATCAAACTG SRR7166133 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 15:12:47 Started mapping on | Feb 14 15:12:47 Finished on | Feb 14 15:14:48 Mapping speed, Million of reads per hour | 549.28 Number of input reads | 18461846 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 17485771 Uniquely mapped reads % | 94.71% Average mapped length | 289.48 Number of splices: Total | 15730859 Number of splices: Annotated (sjdb) | 15392924 Number of splices: GT/AG | 15475102 Number of splices: GC/AG | 194696 Number of splices: AT/AC | 13595 Number of splices: Non-canonical | 47466 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.04% Deletion average length | 2.45 Insertion rate per base | 0.02% Insertion average length | 2.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 425393 % of reads mapped to multiple loci | 2.30% Number of reads mapped to too many loci | 37665 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.65% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 565702 565702 565702 N_multimapping 425393 425393 425393 N_noFeature 633612 17250925 749131 N_ambiguous 201722 1222 81733 UnstrandedReadsAssigned:16650437 PositiveStrandReadsAssigned:233624 NegativeStrandReadsAssigned:16654907 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=142 echo kmer=137 SRR7166133 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166133-trimmed-pair1.fastq SRR7166133-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,461,846 reads, 16,524,494 reads pseudoaligned [quant] estimated average fragment length: 226.026 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,150 rounds 52401 SRR7166133.ke.tsv 34699 SRR7166133.se.tsv 87100 total ==> SRR7166133.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1792.97 1585 43.2989 Potri.005G024800.1.v4.1 1035 809.974 876 52.973 Potri.004G059700.1.v4.1 961 735.985 20 1.33101 Potri.007G009000.2.v4.1 1416 1190.97 0 0 Potri.003G141000.2.v4.1 2943 2717.97 818.283 14.7462 Potri.016G087400.1.v4.1 270 86.8386 1417 799.243 Potri.015G069301.1.v4.1 564 341.498 0 0 Potri.010G195200.1.v4.1 1773 1547.97 415.859 13.1584 Potri.012G127500.1.v4.1 977 751.98 12746 830.213 ==> SRR7166133.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 161 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 1020 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 590 SRR7166133 completed mapping pipeline successfully