Starting /dee2/code/volunteer_pipeline.sh SRR7166134 current disk space = 3112429432832 free memory = 1577918668 SRR7166134 SRAfilesize a65245502a172de147704024e0c184f5 SRR7166134.sra SRR7166134.sra file validated SRR7166134 is paired end SRR7166134 is conventional basespace SRR7166134 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166134_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.87325 18.0 18.0 33.0 18.0 33.0 2 25.00725 27.0 18.0 30.0 18.0 33.0 3 28.13225 29.0 27.0 31.0 25.0 33.0 4 30.105 31.0 29.0 33.0 27.0 33.0 5 30.6965 32.0 31.0 33.0 27.0 33.0 6 35.3715 37.0 35.0 38.0 31.0 38.0 7 35.36625 37.0 35.0 38.0 31.0 38.0 8 36.52225 38.0 37.0 38.0 34.0 38.0 9 37.1695 38.0 38.0 38.0 36.0 38.0 10-14 37.53375 38.0 38.0 38.0 37.0 38.0 15-19 37.6279 38.0 38.0 38.0 38.0 38.0 20-24 37.6356 38.0 38.0 38.0 38.0 38.0 25-29 37.623400000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.635200000000005 38.0 38.0 38.0 38.0 38.0 35-39 37.6056 38.0 38.0 38.0 38.0 38.0 40-44 37.59655 38.0 38.0 38.0 38.0 38.0 45-49 37.57475 38.0 38.0 38.0 38.0 38.0 50-54 37.3752 38.0 38.0 38.0 37.6 38.0 55-59 37.041999999999994 38.0 38.0 38.0 37.0 38.0 60-64 37.2157 38.0 38.0 38.0 36.8 38.0 65-69 37.391 38.0 38.0 38.0 37.0 38.0 70-74 37.31545 38.0 38.0 38.0 36.8 38.0 75-79 37.21925 38.0 38.0 38.0 36.6 38.0 80-84 37.121900000000004 38.0 38.0 38.0 36.0 38.0 85-89 37.0466 38.0 38.0 38.0 36.0 38.0 90-94 37.0047 38.0 38.0 38.0 36.0 38.0 95-99 36.88334999999999 38.0 38.0 38.0 36.0 38.0 100-104 36.70075 38.0 38.0 38.0 35.0 38.0 105-109 36.45955 38.0 38.0 38.0 34.4 38.0 110-114 36.55185 38.0 38.0 38.0 34.0 38.0 115-119 36.435199999999995 38.0 38.0 38.0 34.0 38.0 120-124 36.26135 38.0 37.8 38.0 34.0 38.0 125-129 36.1112 38.0 37.6 38.0 33.4 38.0 130-134 35.98775 38.0 36.8 38.0 32.8 38.0 135-139 35.741550000000004 38.0 36.4 38.0 32.4 38.0 140-144 35.5427 38.0 36.0 38.0 31.4 38.0 145-149 35.2682 38.0 35.8 38.0 31.0 38.0 150-151 32.264625 36.5 33.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 2.0 18 1.0 19 4.0 20 1.0 21 1.0 22 3.0 23 5.0 24 6.0 25 4.0 26 10.0 27 8.0 28 21.0 29 28.0 30 36.0 31 52.0 32 50.0 33 80.0 34 131.0 35 251.0 36 760.0 37 2544.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.57160899216974 14.624905279110886 10.507703965647892 31.295781763071485 2 23.200000000000003 23.549999999999997 36.275 16.975 3 16.875 32.800000000000004 25.2 25.124999999999996 4 20.349999999999998 39.574999999999996 20.125 19.950000000000003 5 20.94070552914686 39.104328246184636 20.84063047285464 19.11433575181386 6 16.825000000000003 37.9 24.3 20.974999999999998 7 13.15 20.525 44.800000000000004 21.525 8 17.375 21.4 29.25 31.974999999999998 9 17.974999999999998 21.95 30.975 29.099999999999998 10-14 19.63 30.514999999999997 26.26 23.595 15-19 20.085 28.675 27.775 23.465 20-24 19.195 29.23 28.050000000000004 23.525 25-29 20.01 29.54 27.58 22.869999999999997 30-34 20.064999999999998 29.285 27.400000000000002 23.25 35-39 19.59 29.865000000000002 27.205000000000002 23.34 40-44 19.21 29.645 27.67 23.474999999999998 45-49 19.725 29.244999999999997 27.750000000000004 23.28 50-54 19.467737886015566 29.008285212151648 28.234998744664825 23.288978157167964 55-59 19.83228935138412 29.13719943422914 27.83390583956355 23.196605374823196 60-64 19.97189883580891 28.818747490967482 27.50903251706142 23.700321156162186 65-69 20.23 28.88 27.939999999999998 22.95 70-74 20.114022804560914 28.720744148829763 27.750550110022004 23.414682936587315 75-79 19.61 28.98 28.055000000000003 23.355 80-84 20.115 29.205 27.13 23.549999999999997 85-89 20.64 27.925 27.79 23.645 90-94 20.91 29.32 27.195000000000004 22.575 95-99 20.78 28.754999999999995 27.47 22.994999999999997 100-104 20.672740014015417 28.611472619881873 27.765542096305936 22.950245269796778 105-109 20.99236641221374 29.26376054640418 27.079148252310166 22.664724789071915 110-114 20.62 29.24 27.02 23.119999999999997 115-119 21.067120476500325 29.210671204765003 26.688022423544723 23.03418589518995 120-124 20.46102305115256 29.246462323116155 26.826341317065854 23.466173308665432 125-129 20.859816825984687 29.53806115810019 26.174866122816674 23.427255893098444 130-134 21.0 28.754999999999995 26.634999999999998 23.61 135-139 21.015 28.610000000000003 26.875 23.5 140-144 20.905 29.12 26.125 23.849999999999998 145-149 20.685000000000002 28.835 26.415 24.065 150-151 21.7129977460556 27.748559979964938 25.957926371149508 24.58051590282995 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.5 19 1.0 20 1.0 21 0.5 22 0.5 23 1.5 24 2.0 25 2.0 26 6.0 27 8.0 28 13.0 29 17.5 30 22.5 31 31.0 32 40.0 33 56.5 34 69.5 35 88.0 36 105.0 37 120.5 38 154.0 39 182.5 40 196.5 41 223.0 42 255.5 43 265.5 44 263.5 45 268.5 46 256.0 47 235.0 48 215.0 49 191.5 50 168.5 51 136.0 52 104.0 53 75.0 54 58.0 55 47.0 56 37.5 57 25.0 58 14.0 59 10.5 60 8.0 61 7.0 62 4.0 63 3.0 64 2.5 65 1.5 66 1.0 67 0.5 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0250000000000001 2 0.0 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.42500000000000004 55-59 1.02 60-64 0.36 65-69 0.0 70-74 0.02 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.11 105-109 0.44 110-114 0.0 115-119 0.105 120-124 0.005 125-129 0.095 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.17500000000000002 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.48750000000000004 0.0 0.0 0.0 0.0 96-97 0.625 0.0 0.0 0.0 0.0 98-99 0.8500000000000001 0.0 0.0 0.0 0.0 100-101 1.0375 0.0 0.0 0.0 0.0 102-103 1.15 0.0 0.0 0.0 0.0 104-105 1.3 0.0 0.0 0.0 0.0 106-107 1.4375 0.0 0.0 0.0 0.0 108-109 1.7 0.0 0.0 0.0 0.0 110-111 1.9125 0.0 0.0 0.0 0.0 112-113 2.2249999999999996 0.0 0.0 0.0 0.0 114-115 2.6375 0.0 0.0 0.0 0.0 116-117 3.0625 0.0 0.0 0.0 0.0 118-119 3.5875 0.0 0.0 0.0 0.0 120-121 4.2375 0.0 0.0 0.0 0.0 122-123 4.75 0.0 0.0 0.0 0.0 124-125 5.1125 0.0 0.0 0.0 0.0 126-127 5.6625 0.0 0.0 0.0 0.0 128-129 6.2125 0.0 0.0 0.0 0.0 130-131 6.95 0.0 0.0 0.0 0.0 132-133 7.425000000000001 0.0 0.0 0.0 0.0 134-135 7.85 0.0 0.0 0.0 0.0 136-137 8.399999999999999 0.0 0.0 0.0 0.0 138-139 9.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACAAAAT 10 0.00664379 146.32912 1 >>END_MODULE SRR7166134 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166134_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8275 33.0 33.0 34.0 32.0 34.0 2 32.88375 33.0 33.0 34.0 32.0 34.0 3 32.99425 33.0 33.0 34.0 32.0 34.0 4 33.00525 34.0 33.0 34.0 32.0 34.0 5 33.00375 33.0 33.0 34.0 32.0 34.0 6 37.32625 38.0 38.0 38.0 37.0 38.0 7 37.34225 38.0 38.0 38.0 37.0 38.0 8 37.24575 38.0 38.0 38.0 37.0 38.0 9 37.1865 38.0 38.0 38.0 37.0 38.0 10-14 37.309000000000005 38.0 38.0 38.0 37.0 38.0 15-19 37.27015 38.0 38.0 38.0 37.0 38.0 20-24 37.192949999999996 38.0 38.0 38.0 36.6 38.0 25-29 37.20354999999999 38.0 38.0 38.0 37.0 38.0 30-34 37.106049999999996 38.0 38.0 38.0 36.2 38.0 35-39 37.06465 38.0 38.0 38.0 36.0 38.0 40-44 36.987300000000005 38.0 38.0 38.0 35.8 38.0 45-49 36.845349999999996 38.0 38.0 38.0 35.4 38.0 50-54 36.68315 38.0 38.0 38.0 34.6 38.0 55-59 36.5899 38.0 38.0 38.0 34.0 38.0 60-64 36.577650000000006 38.0 38.0 38.0 34.0 38.0 65-69 36.42375 38.0 38.0 38.0 33.8 38.0 70-74 36.4308 38.0 38.0 38.0 34.0 38.0 75-79 36.175349999999995 38.0 37.2 38.0 33.4 38.0 80-84 36.120999999999995 38.0 37.0 38.0 33.0 38.0 85-89 35.95255 38.0 37.0 38.0 31.8 38.0 90-94 35.63235 38.0 37.0 38.0 29.8 38.0 95-99 35.4517 38.0 36.4 38.0 29.0 38.0 100-104 35.1496 38.0 36.0 38.0 28.4 38.0 105-109 34.9486 38.0 35.8 38.0 27.2 38.0 110-114 34.54915 38.0 35.0 38.0 25.6 38.0 115-119 34.137950000000004 38.0 34.2 38.0 23.2 38.0 120-124 33.744699999999995 38.0 34.0 38.0 22.2 38.0 125-129 33.4281 38.0 33.8 38.0 17.4 38.0 130-134 32.675850000000004 37.6 33.2 38.0 14.8 38.0 135-139 32.0154 36.6 31.6 38.0 14.0 38.0 140-144 30.976350000000004 36.0 29.4 38.0 13.4 38.0 145-149 29.48465 35.0 26.8 38.0 4.2 38.0 150-151 24.445625 32.5 11.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 5.0 14 3.0 15 4.0 16 4.0 17 4.0 18 5.0 19 9.0 20 8.0 21 6.0 22 20.0 23 15.0 24 17.0 25 34.0 26 31.0 27 38.0 28 44.0 29 56.0 30 82.0 31 87.0 32 163.0 33 207.0 34 278.0 35 481.0 36 903.0 37 1491.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.050000000000004 15.225 14.124999999999998 31.6 2 22.650000000000002 23.1 36.875 17.375 3 20.625 25.124999999999996 32.5 21.75 4 22.75 36.0 22.125 19.125 5 23.3 37.45 22.325 16.925 6 17.4 37.675 24.725 20.200000000000003 7 15.675 15.15 45.824999999999996 23.35 8 20.724999999999998 20.424999999999997 28.575 30.275000000000002 9 22.05 22.775000000000002 28.775000000000002 26.400000000000002 10-14 22.7 28.185 27.810000000000002 21.305 15-19 22.43 28.21 27.975 21.385 20-24 22.634999999999998 28.77 28.035 20.560000000000002 25-29 22.75 27.85 28.4 21.0 30-34 22.855 28.310000000000002 28.305000000000003 20.53 35-39 22.215 28.134999999999998 28.575 21.075 40-44 22.865 28.12 28.465 20.549999999999997 45-49 22.8 27.805000000000003 28.43 20.965 50-54 22.545 27.66 28.935 20.86 55-59 23.330000000000002 27.384999999999998 28.715000000000003 20.57 60-64 22.905 27.595 28.595 20.905 65-69 23.45 27.529999999999998 28.785 20.235 70-74 22.88 27.965 28.07 21.085 75-79 22.965 28.22 28.155 20.66 80-84 23.49 28.249999999999996 27.889999999999997 20.369999999999997 85-89 23.189999999999998 27.644999999999996 28.585 20.580000000000002 90-94 22.905 28.1 28.449999999999996 20.544999999999998 95-99 23.195 27.38 28.884999999999998 20.54 100-104 23.75 27.755000000000003 28.139999999999997 20.355 105-109 23.87 27.77 27.955000000000002 20.405 110-114 23.69 27.76 28.235 20.315 115-119 24.169999999999998 28.025 27.82 19.985 120-124 24.295 27.91 27.67 20.125 125-129 24.125 27.925 27.915 20.035 130-134 24.404999999999998 27.785 27.839999999999996 19.97 135-139 24.745 27.38 27.500000000000004 20.375 140-144 24.445 27.675 28.16 19.72 145-149 24.895 27.37 28.01 19.725 150-151 24.884331624359135 27.172689758659494 27.735400775290735 20.207577841690632 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.0 24 1.5 25 3.5 26 4.5 27 6.0 28 8.0 29 11.0 30 15.0 31 26.5 32 35.0 33 33.5 34 49.5 35 69.0 36 87.0 37 108.5 38 140.0 39 169.0 40 198.0 41 245.0 42 266.0 43 272.5 44 281.0 45 286.5 46 280.0 47 246.0 48 222.0 49 200.5 50 162.5 51 129.5 52 102.5 53 82.0 54 69.5 55 51.5 56 33.0 57 25.5 58 24.5 59 16.5 60 7.5 61 7.5 62 6.0 63 4.5 64 3.5 65 1.5 66 0.5 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54739753583102 98.97500000000001 2 0.35202413879808897 0.7000000000000001 3 0.07543374402816193 0.22499999999999998 4 0.025144581342720643 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.48750000000000004 0.0 0.0 0.0 0.0 96-97 0.625 0.0 0.0 0.0 0.0 98-99 0.825 0.0 0.0 0.0 0.0 100-101 1.0125 0.0 0.0 0.0 0.0 102-103 1.125 0.0 0.0 0.0 0.0 104-105 1.275 0.0 0.0 0.0 0.0 106-107 1.4125 0.0 0.0 0.0 0.0 108-109 1.675 0.0 0.0 0.0 0.0 110-111 1.8624999999999998 0.0 0.0 0.0 0.0 112-113 2.175 0.0 0.0 0.0 0.0 114-115 2.5875 0.0 0.0 0.0 0.0 116-117 3.0125 0.0 0.0 0.0 0.0 118-119 3.5625 0.0 0.0 0.0 0.0 120-121 4.1875 0.0 0.0 0.0 0.0 122-123 4.6875 0.0 0.0 0.0 0.0 124-125 5.025 0.0 0.0 0.0 0.0 126-127 5.5125 0.0 0.0 0.0 0.0 128-129 6.05 0.0 0.0 0.0 0.0 130-131 6.6625 0.0 0.0 0.0 0.0 132-133 7.1 0.0 0.0 0.0 0.0 134-135 7.5125 0.0 0.0 0.0 0.0 136-137 7.975 0.0 0.0 0.0 0.0 138-139 8.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAATTTC 10 0.006830828 145.0 9 ATGCAGC 10 0.006830828 145.0 6 >>END_MODULE Read 858657 spots for SRR7166134.sra Written 858657 spots for SRR7166134.sra Read 858657 spots for SRR7166134.sra Written 858657 spots for SRR7166134.sra Read 858657 spots for SRR7166134.sra Written 858657 spots for SRR7166134.sra Read 858657 spots for SRR7166134.sra Written 858657 spots for SRR7166134.sra Read 858657 spots for SRR7166134.sra Written 858657 spots for SRR7166134.sra Read 858657 spots for SRR7166134.sra Written 858657 spots for SRR7166134.sra Read 858657 spots for SRR7166134.sra Written 858657 spots for SRR7166134.sra Read 858657 spots for SRR7166134.sra Written 858657 spots for SRR7166134.sra Read 858657 spots for SRR7166134.sra Written 858657 spots for SRR7166134.sra Read 858657 spots for SRR7166134.sra Written 858657 spots for SRR7166134.sra Read 858657 spots for SRR7166134.sra Written 858657 spots for SRR7166134.sra Read 858657 spots for SRR7166134.sra Written 858657 spots for SRR7166134.sra Read 858661 spots for SRR7166134.sra Written 858661 spots for SRR7166134.sra Read 858657 spots for SRR7166134.sra Written 858657 spots for SRR7166134.sra Read 858657 spots for SRR7166134.sra Written 858657 spots for SRR7166134.sra Read 858657 spots for SRR7166134.sra Written 858657 spots for SRR7166134.sra Read 858657 spots for SRR7166134.sra Written 858657 spots for SRR7166134.sra Read 858657 spots for SRR7166134.sra Written 858657 spots for SRR7166134.sra Read 858657 spots for SRR7166134.sra Written 858657 spots for SRR7166134.sra Read 858657 spots for SRR7166134.sra Written 858657 spots for SRR7166134.sra SRR ids: ['SRR7166134.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xtpim75s SRR7166134.sra spots: 17173144 blocks: [[1, 858657], [858658, 1717314], [1717315, 2575971], [2575972, 3434628], [3434629, 4293285], [4293286, 5151942], [5151943, 6010599], [6010600, 6869256], [6869257, 7727913], [7727914, 8586570], [8586571, 9445227], [9445228, 10303884], [10303885, 11162541], [11162542, 12021198], [12021199, 12879855], [12879856, 13738512], [13738513, 14597169], [14597170, 15455826], [15455827, 16314483], [16314484, 17173144]] SRR7166134 file size 5797714 SRR7166134 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166134 SRR7166134_1.fastq SRR7166134_2.fastq Input file: SRR7166134_1.fastq Paired file: SRR7166134_2.fastq trimmed: SRR7166134-trimmed-pair1.fastq, SRR7166134-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 14:47:38 2025 >> started Fri Feb 14 14:47:57 2025 >> done (18.796s) 17173144 read pairs processed; of these: 6039 ( 0.04%) short read pairs filtered out after trimming by size control 5792 ( 0.03%) empty read pairs filtered out after trimming by size control 17161313 (99.93%) read pairs available; of these: 7490773 (43.65%) trimmed read pairs available after processing 9670540 (56.35%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 4 0.00% 21 4 0.00% 22 10 0.00% 23 1 0.00% 24 5 0.00% 25 6 0.00% 26 6 0.00% 27 9 0.00% 28 4 0.00% 29 3 0.00% 30 7 0.00% 31 11 0.00% 32 5 0.00% 33 5 0.00% 34 10 0.00% 35 19 0.00% 36 9 0.00% 37 8 0.00% 38 15 0.00% 39 14 0.00% 40 13 0.00% 41 13 0.00% 42 19 0.00% 43 23 0.00% 44 28 0.00% 45 25 0.00% 46 25 0.00% 47 41 0.00% 48 41 0.00% 49 49 0.00% 50 45 0.00% 51 70 0.00% 52 82 0.00% 53 79 0.00% 54 76 0.00% 55 95 0.00% 56 124 0.00% 57 163 0.00% 58 180 0.00% 59 199 0.00% 60 225 0.00% 61 263 0.00% 62 249 0.00% 63 360 0.00% 64 337 0.00% 65 400 0.00% 66 472 0.00% 67 523 0.00% 68 579 0.00% 69 680 0.00% 70 891 0.01% 71 928 0.01% 72 1088 0.01% 73 1287 0.01% 74 1387 0.01% 75 1619 0.01% 76 1817 0.01% 77 1953 0.01% 78 2145 0.01% 79 2501 0.01% 80 2840 0.02% 81 3189 0.02% 82 3751 0.02% 83 4353 0.03% 84 5030 0.03% 85 5586 0.03% 86 5899 0.03% 87 6587 0.04% 88 6934 0.04% 89 7424 0.04% 90 8140 0.05% 91 9201 0.05% 92 10148 0.06% 93 10843 0.06% 94 11918 0.07% 95 12665 0.07% 96 13462 0.08% 97 14407 0.08% 98 15077 0.09% 99 16064 0.09% 100 16263 0.09% 101 17424 0.10% 102 19118 0.11% 103 20464 0.12% 104 21880 0.13% 105 23241 0.14% 106 23839 0.14% 107 24544 0.14% 108 25283 0.15% 109 26060 0.15% 110 27161 0.16% 111 28436 0.17% 112 30550 0.18% 113 32446 0.19% 114 34407 0.20% 115 35961 0.21% 116 36961 0.22% 117 38365 0.22% 118 38826 0.23% 119 39415 0.23% 120 41051 0.24% 121 42129 0.25% 122 44321 0.26% 123 46832 0.27% 124 48897 0.28% 125 51082 0.30% 126 53305 0.31% 127 54615 0.32% 128 55864 0.33% 129 57401 0.33% 130 58214 0.34% 131 60646 0.35% 132 63697 0.37% 133 66879 0.39% 134 70741 0.41% 135 73656 0.43% 136 77408 0.45% 137 80604 0.47% 138 84434 0.49% 139 89003 0.52% 140 93061 0.54% 141 100073 0.58% 142 109113 0.64% 143 119537 0.70% 144 136033 0.79% 145 158245 0.92% 146 192627 1.12% 147 249930 1.46% 148 363249 2.12% 149 676287 3.94% 150 3316422 19.32% 151 9670540 56.35% 17161313 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=7.04 fanout-score-rank=14 prefix-density=0.20 prefix-fanout=4.9 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.09 sequence-density-rank=23 fanout-score=77.74 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=18.5 sequence=CATCACCAACAG criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.41 fanout-score-rank=29 prefix-density=0.23 prefix-fanout=2.3 sequence=GGCAGTGGCTGCAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=30 fanout-score=73.95 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=12.5 sequence=AGGAGAAGAAATGGCATCTATCTGTCAAGGTAAGAGTTCATGGCCGGAGCTTCTTGGAGTAGACGGGAAGTGCGCTGTCGAAACGATCGAGAGAGAAAACTCTCTGGTTGAAGCTATAATTGTGCCAGAAGGATCATCAATCATCGAGGATTTTCGGTGCGATAGGGTTTGGGTTTGGGTTGATAAAGATGGCATTG SRR7166134 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 14:49:04 Started mapping on | Feb 14 14:49:04 Finished on | Feb 14 14:51:29 Mapping speed, Million of reads per hour | 426.07 Number of input reads | 17161313 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 16095219 Uniquely mapped reads % | 93.79% Average mapped length | 292.78 Number of splices: Total | 15449731 Number of splices: Annotated (sjdb) | 15159055 Number of splices: GT/AG | 15193632 Number of splices: GC/AG | 194651 Number of splices: AT/AC | 12135 Number of splices: Non-canonical | 49313 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.04% Deletion average length | 2.18 Insertion rate per base | 0.02% Insertion average length | 2.22 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 488482 % of reads mapped to multiple loci | 2.85% Number of reads mapped to too many loci | 54290 % of reads mapped to too many loci | 0.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.97% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 584159 584159 584159 N_multimapping 488482 488482 488482 N_noFeature 524455 15904933 642775 N_ambiguous 160386 1413 87370 UnstrandedReadsAssigned:15410378 PositiveStrandReadsAssigned:188873 NegativeStrandReadsAssigned:15365074 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7166134 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166134-trimmed-pair1.fastq SRR7166134-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,161,313 reads, 15,291,513 reads pseudoaligned [quant] estimated average fragment length: 229.972 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,123 rounds 52401 SRR7166134.ke.tsv 34699 SRR7166134.se.tsv 87100 total ==> SRR7166134.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1789.03 1460 56.1214 Potri.005G024800.1.v4.1 1035 806.028 502 42.8298 Potri.004G059700.1.v4.1 961 732.043 9 0.84547 Potri.007G009000.2.v4.1 1416 1187.03 0 0 Potri.003G141000.2.v4.1 2943 2714.03 435 11.0222 Potri.016G087400.1.v4.1 270 86.9009 959 758.904 Potri.015G069301.1.v4.1 564 339.589 0 0 Potri.010G195200.1.v4.1 1773 1544.03 290 12.9162 Potri.012G127500.1.v4.1 977 748.043 7173 659.427 ==> SRR7166134.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 30 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 393 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 382 SRR7166134 completed mapping pipeline successfully