Starting /dee2/code/volunteer_pipeline.sh SRR7166135 current disk space = 3112610521088 free memory = 1571313068 SRR7166135 SRAfilesize 4e67d624e81e5044093567d6c091801d SRR7166135.sra SRR7166135.sra file validated SRR7166135 is paired end SRR7166135 is conventional basespace SRR7166135 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166135_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.844 33.0 32.0 34.0 28.0 34.0 2 32.175 33.0 33.0 34.0 29.0 34.0 3 32.0365 33.0 33.0 34.0 29.0 34.0 4 32.4035 33.0 33.0 34.0 31.0 34.0 5 32.44125 33.0 33.0 34.0 31.0 34.0 6 36.55925 38.0 37.0 38.0 34.0 38.0 7 36.95925 38.0 38.0 38.0 35.0 38.0 8 37.055 38.0 38.0 38.0 36.0 38.0 9 37.05625 38.0 38.0 38.0 36.0 38.0 10-14 36.9606 38.0 38.0 38.0 35.6 38.0 15-19 36.84609999999999 38.0 38.0 38.0 35.0 38.0 20-24 36.923399999999994 38.0 38.0 38.0 35.2 38.0 25-29 36.62075 38.0 38.0 38.0 34.0 38.0 30-34 36.397000000000006 38.0 37.8 38.0 33.8 38.0 35-39 36.312949999999994 38.0 37.2 38.0 33.0 38.0 40-44 36.219899999999996 38.0 37.0 38.0 33.0 38.0 45-49 36.1255 38.0 37.0 38.0 32.4 38.0 50-54 36.0918 38.0 37.0 38.0 31.8 38.0 55-59 35.92645 38.0 37.0 38.0 31.2 38.0 60-64 35.69035 38.0 36.6 38.0 29.8 38.0 65-69 35.79995000000001 38.0 37.0 38.0 30.6 38.0 70-74 35.688599999999994 38.0 36.2 38.0 30.0 38.0 75-79 35.07745 38.0 35.8 38.0 28.2 38.0 80-84 34.8793 38.0 36.0 38.0 27.4 38.0 85-89 34.6101 38.0 34.6 38.0 26.2 38.0 90-94 34.84335 38.0 35.0 38.0 26.8 38.0 95-99 34.193349999999995 38.0 34.4 38.0 24.0 38.0 100-104 33.64955 37.6 33.6 38.0 18.2 38.0 105-109 33.2307 37.4 32.8 38.0 15.0 38.0 110-114 32.506550000000004 37.0 31.0 38.0 15.0 38.0 115-119 32.577749999999995 37.0 31.0 38.0 15.0 38.0 120-124 31.77525 36.8 29.8 38.0 15.0 38.0 125-129 31.72335 36.6 30.0 38.0 15.0 38.0 130-134 30.4746 35.4 26.4 38.0 14.2 38.0 135-139 29.13975 33.8 23.0 38.0 13.2 38.0 140-144 27.617850000000004 33.8 19.6 38.0 2.0 38.0 145-149 25.86285 33.0 11.2 38.0 2.0 38.0 150-151 19.663125 17.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 2.0 15 0.0 16 8.0 17 6.0 18 6.0 19 18.0 20 10.0 21 20.0 22 27.0 23 22.0 24 42.0 25 58.0 26 68.0 27 82.0 28 105.0 29 128.0 30 165.0 31 162.0 32 215.0 33 297.0 34 422.0 35 560.0 36 861.0 37 715.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.367624810892586 19.591527987897127 10.489157841654059 32.55168935955623 2 19.075 27.025 36.125 17.775 3 16.35 33.35 26.650000000000002 23.65 4 20.8 37.6 23.0 18.6 5 19.725 38.574999999999996 23.45 18.25 6 17.150000000000002 38.1 24.75 20.0 7 12.725 20.150000000000002 46.475 20.65 8 16.400000000000002 24.2 26.700000000000003 32.7 9 17.4 22.55 31.55 28.499999999999996 10-14 18.745 31.305 26.179999999999996 23.77 15-19 19.16 29.755 27.744999999999997 23.34 20-24 18.955 29.5 28.395 23.150000000000002 25-29 19.02 30.235 27.560000000000002 23.185 30-34 19.61 29.68 27.584999999999997 23.125 35-39 19.29 29.520000000000003 27.865000000000002 23.325000000000003 40-44 19.66 29.62 27.825 22.895 45-49 19.27 29.310000000000002 28.02 23.400000000000002 50-54 19.285 29.635 27.67 23.41 55-59 19.139999999999997 29.439999999999998 27.55 23.87 60-64 19.57 29.26 27.765 23.405 65-69 19.465 29.67 27.189999999999998 23.674999999999997 70-74 19.762786507857072 29.416474827344608 27.980182163947553 22.840556500850763 75-79 19.97574410025772 28.96558694224064 28.025670827227245 23.032998130274397 80-84 19.835087009307973 28.35896398219344 27.96944556859571 23.836503439902874 85-89 19.85 29.445 27.474999999999998 23.23 90-94 19.8 28.955 27.450000000000003 23.794999999999998 95-99 19.71 28.88 28.305000000000003 23.105 100-104 19.705000000000002 28.925 27.389999999999997 23.98 105-109 20.215 28.765 27.35 23.669999999999998 110-114 20.485 29.505 26.365 23.645 115-119 19.975 29.395 27.339999999999996 23.29 120-124 20.168151336202584 29.081173055750178 26.79911920728656 23.951556400760683 125-129 20.44829138940311 28.763696402661733 26.737379296542752 24.050632911392405 130-134 20.690698260650365 28.47491807411142 26.811192336778422 24.02319132845979 135-139 20.339747444377632 29.109039887753056 26.80396873120866 23.747243936660652 140-144 21.126126126126128 28.663663663663662 26.506506506506504 23.703703703703706 145-149 21.304632097771968 28.889000653824876 26.012171201528943 23.794196046874212 150-151 21.472469584848866 27.53041515113508 27.053806597265773 23.943308666750283 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.5 21 3.0 22 3.0 23 4.0 24 6.5 25 5.5 26 6.5 27 9.0 28 11.5 29 21.5 30 34.5 31 40.0 32 46.5 33 68.0 34 79.0 35 87.5 36 115.5 37 143.5 38 157.5 39 183.5 40 211.0 41 226.0 42 254.0 43 286.5 44 291.5 45 257.0 46 222.5 47 215.0 48 208.0 49 173.5 50 138.0 51 119.0 52 104.0 53 79.0 54 51.5 55 37.0 56 29.0 57 22.0 58 15.5 59 9.0 60 5.0 61 4.5 62 4.0 63 3.5 64 2.5 65 1.5 66 1.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8500000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.09 75-79 1.055 80-84 1.16 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.09 125-129 0.065 130-134 0.8250000000000001 135-139 0.22 140-144 0.1 145-149 0.585 150-151 0.3375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42094662638469 98.725 2 0.4783484390735146 0.95 3 0.0755287009063444 0.22499999999999998 4 0.025176233635448138 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0125 0.0 76-77 0.037500000000000006 0.0 0.0 0.025 0.0 78-79 0.0625 0.0 0.0 0.025 0.0 80-81 0.075 0.0 0.0 0.025 0.0 82-83 0.125 0.0 0.0 0.025 0.0 84-85 0.16249999999999998 0.0 0.0 0.025 0.0 86-87 0.2 0.0 0.0 0.025 0.0 88-89 0.2875 0.0 0.0 0.025 0.0 90-91 0.4 0.0 0.0 0.025 0.0 92-93 0.42500000000000004 0.0 0.0 0.025 0.0 94-95 0.5625 0.0 0.0 0.025 0.0 96-97 0.6625 0.0 0.0 0.025 0.0 98-99 0.7375 0.0 0.0 0.025 0.0 100-101 0.8875 0.0 0.0 0.025 0.0 102-103 1.1625 0.0 0.0 0.025 0.0 104-105 1.35 0.0 0.0 0.025 0.0 106-107 1.6125 0.0 0.0 0.025 0.0 108-109 1.9125 0.0 0.0 0.025 0.0 110-111 2.2375 0.0 0.0 0.025 0.0 112-113 2.55 0.0 0.0 0.025 0.0 114-115 2.8625 0.0 0.0 0.025 0.0 116-117 3.1625 0.0 0.0 0.025 0.0 118-119 3.525 0.0 0.0 0.025 0.0 120-121 3.875 0.0 0.0 0.025 0.0 122-123 4.3 0.0 0.0 0.025 0.0 124-125 4.7375 0.0 0.0 0.025 0.0 126-127 5.324999999999999 0.0 0.0 0.025 0.0 128-129 5.8625 0.0 0.0 0.025 0.0 130-131 6.3375 0.0 0.0 0.025 0.0 132-133 6.85 0.0 0.0 0.025 0.0 134-135 7.5625 0.0 0.0 0.025 0.0 136-137 8.399999999999999 0.0 0.0 0.025 0.0 138-139 9.0125 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7166135 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166135_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.5445 33.0 33.0 34.0 32.0 34.0 2 32.64175 33.0 33.0 34.0 32.0 34.0 3 32.56525 33.0 33.0 34.0 31.0 34.0 4 32.5415 34.0 33.0 34.0 32.0 34.0 5 32.62025 33.0 33.0 34.0 32.0 34.0 6 36.589 38.0 38.0 38.0 34.0 38.0 7 36.65225 38.0 38.0 38.0 35.0 38.0 8 36.6395 38.0 38.0 38.0 34.0 38.0 9 36.74175 38.0 38.0 38.0 35.0 38.0 10-14 36.58005000000001 38.0 38.0 38.0 34.2 38.0 15-19 36.524 38.0 38.0 38.0 34.2 38.0 20-24 36.30030000000001 38.0 38.0 38.0 33.6 38.0 25-29 36.38745 38.0 38.0 38.0 34.0 38.0 30-34 36.41510000000001 38.0 38.0 38.0 33.8 38.0 35-39 36.347449999999995 38.0 38.0 38.0 33.8 38.0 40-44 36.18695 38.0 38.0 38.0 33.2 38.0 45-49 35.9661 38.0 37.4 38.0 31.8 38.0 50-54 35.7962 38.0 37.2 38.0 30.4 38.0 55-59 35.84085 38.0 37.0 38.0 31.2 38.0 60-64 35.73895 38.0 37.0 38.0 30.4 38.0 65-69 35.7432 38.0 37.0 38.0 30.6 38.0 70-74 35.49445 38.0 37.0 38.0 29.0 38.0 75-79 35.43785 38.0 36.8 38.0 29.0 38.0 80-84 35.41395 38.0 37.0 38.0 29.0 38.0 85-89 35.14645 38.0 36.2 38.0 28.4 38.0 90-94 34.9548 38.0 36.0 38.0 28.0 38.0 95-99 34.42455 38.0 34.8 38.0 25.0 38.0 100-104 34.2725 38.0 35.0 38.0 23.6 38.0 105-109 34.37285000000001 38.0 35.0 38.0 25.0 38.0 110-114 34.0892 38.0 34.4 38.0 22.6 38.0 115-119 33.546350000000004 38.0 34.0 38.0 18.6 38.0 120-124 33.00485 38.0 33.4 38.0 15.0 38.0 125-129 32.175700000000006 37.6 31.0 38.0 15.0 38.0 130-134 31.313200000000002 36.4 30.0 38.0 13.6 38.0 135-139 30.67935 36.0 28.8 38.0 13.2 38.0 140-144 29.84685 36.0 27.6 38.0 6.0 38.0 145-149 27.188850000000002 33.2 17.0 38.0 2.0 38.0 150-151 21.552374999999998 27.0 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 4.0 4 1.0 5 3.0 6 2.0 7 4.0 8 1.0 9 3.0 10 3.0 11 1.0 12 3.0 13 3.0 14 4.0 15 11.0 16 8.0 17 9.0 18 12.0 19 7.0 20 14.0 21 20.0 22 21.0 23 24.0 24 35.0 25 35.0 26 58.0 27 56.0 28 72.0 29 91.0 30 115.0 31 125.0 32 188.0 33 198.0 34 288.0 35 476.0 36 801.0 37 1292.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.425 17.325 14.725 27.525 2 24.387193596798397 23.386693346673336 34.517258629314654 17.70885442721361 3 20.935467733866933 26.163081540770385 32.741370685342666 20.16008004002001 4 23.29246935201401 35.876907680760574 21.341005754315738 19.489617212909682 5 24.312156078039017 36.59329664832416 21.310655327663834 17.78389194597299 6 18.35 38.5 23.35 19.8 7 17.325 16.650000000000002 44.4 21.625 8 21.6 21.55 28.175 28.675 9 22.536268134067033 24.137068534267133 28.16408204102051 25.162581290645324 10-14 22.50900360144058 28.93657462985194 27.465986394557824 21.08843537414966 15-19 23.035 27.650000000000002 28.51 20.805 20-24 23.45 28.355000000000004 28.255000000000003 19.939999999999998 25-29 22.955000000000002 27.67 28.9 20.474999999999998 30-34 22.785 27.325 29.385 20.505000000000003 35-39 22.956887066119837 27.71331399419826 28.758627588276482 20.57117135140542 40-44 23.155 28.58 28.7 19.564999999999998 45-49 23.165 27.46 28.71 20.665 50-54 23.189999999999998 28.12 28.444999999999997 20.244999999999997 55-59 23.427342734273427 28.30783078307831 28.59285928592859 19.671967196719674 60-64 23.915 27.715 28.34 20.03 65-69 23.064999999999998 28.294999999999998 28.410000000000004 20.23 70-74 23.695 27.365000000000002 28.89 20.05 75-79 24.015 27.705000000000002 28.055000000000003 20.225 80-84 23.39701910573172 27.423226968090425 29.068720616184855 20.111033309992997 85-89 23.932393239323932 28.03780378037804 28.002800280028 20.027002700270028 90-94 23.462038611583473 28.33850155046514 28.64359307792338 19.55586676002801 95-99 23.812143643092927 27.953386015804742 28.26848054416325 19.96598979693908 100-104 24.06564266773403 28.47851103217091 27.983189072897385 19.47265722719768 105-109 23.892698063160005 27.476102297182326 28.702267153796107 19.92893248586157 110-114 24.178133600200148 28.46634976232174 28.016012009006758 19.339504628471353 115-119 24.352305691707514 27.31819545863759 28.48854656396919 19.840952285685706 120-124 24.399879975995198 27.550510102020404 28.875775155031008 19.17383476695339 125-129 24.5 28.33 27.779999999999998 19.39 130-134 24.895 27.779999999999998 27.93 19.395 135-139 25.215 27.644999999999996 28.144999999999996 18.995 140-144 25.509999999999998 27.43 27.99 19.07 145-149 25.509999999999998 28.075 27.474999999999998 18.94 150-151 27.212500000000002 26.4625 27.6375 18.6875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.5 19 0.5 20 0.0 21 0.0 22 0.5 23 0.5 24 1.0 25 2.0 26 4.0 27 5.0 28 10.5 29 13.5 30 13.5 31 20.0 32 22.5 33 31.5 34 49.0 35 73.0 36 90.5 37 115.0 38 152.0 39 178.0 40 203.0 41 231.0 42 265.0 43 288.5 44 295.0 45 292.0 46 273.5 47 247.0 48 226.0 49 198.5 50 158.5 51 137.5 52 114.5 53 86.5 54 58.0 55 36.0 56 35.5 57 27.0 58 12.5 59 5.5 60 6.0 61 5.5 62 4.5 63 3.5 64 1.5 65 0.0 66 0.5 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.05 4 0.075 5 0.05 6 0.0 7 0.0 8 0.0 9 0.05 10-14 0.04 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.03 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.01 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.03 85-89 0.01 90-94 0.03 95-99 0.03 100-104 0.065 105-109 0.095 110-114 0.075 115-119 0.03 120-124 0.02 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26749179085628 98.25 2 0.6062136903258398 1.2 3 0.025258903763576663 0.075 4 0.050517807527153326 0.2 5 0.025258903763576663 0.125 6 0.025258903763576663 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCCTATTTT 6 0.15 No Hit AGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCCTATTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.45 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.6 0.0 0.0 0.0 0.0 96-97 0.6875 0.0 0.0 0.0 0.0 98-99 0.7625 0.0 0.0 0.0 0.0 100-101 0.9375 0.0 0.0 0.0 0.0 102-103 1.2000000000000002 0.0 0.0 0.0 0.0 104-105 1.375 0.0 0.0 0.0 0.0 106-107 1.6875 0.0 0.0 0.0 0.0 108-109 1.9749999999999999 0.0 0.0 0.0 0.0 110-111 2.325 0.0 0.0 0.0 0.0 112-113 2.6375 0.0 0.0 0.0 0.0 114-115 2.9375 0.0 0.0 0.0 0.0 116-117 3.25 0.0 0.0 0.0 0.0 118-119 3.6375 0.0 0.0 0.0 0.0 120-121 4.0 0.0 0.0 0.0 0.0 122-123 4.5 0.0 0.0 0.0 0.0 124-125 4.925 0.0 0.0 0.0 0.0 126-127 5.512499999999999 0.0 0.0 0.0 0.0 128-129 6.0875 0.0 0.0 0.0 0.0 130-131 6.5625 0.0 0.0 0.0 0.0 132-133 7.050000000000001 0.0 0.0 0.0 0.0 134-135 7.875 0.0 0.0 0.0 0.0 136-137 8.7375 0.0 0.0 0.0 0.0 138-139 9.3625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 643774 spots for SRR7166135.sra Written 643774 spots for SRR7166135.sra Read 643774 spots for SRR7166135.sra Written 643774 spots for SRR7166135.sra Read 643774 spots for SRR7166135.sra Written 643774 spots for SRR7166135.sra Read 643774 spots for SRR7166135.sra Written 643774 spots for SRR7166135.sra Read 643774 spots for SRR7166135.sra Written 643774 spots for SRR7166135.sra Read 643774 spots for SRR7166135.sra Written 643774 spots for SRR7166135.sra Read 643774 spots for SRR7166135.sra Written 643774 spots for SRR7166135.sra Read 643774 spots for SRR7166135.sra Written 643774 spots for SRR7166135.sra Read 643774 spots for SRR7166135.sra Written 643774 spots for SRR7166135.sra Read 643774 spots for SRR7166135.sra Written 643774 spots for SRR7166135.sra Read 643783 spots for SRR7166135.sra Written 643783 spots for SRR7166135.sra Read 643774 spots for SRR7166135.sra Written 643774 spots for SRR7166135.sra Read 643774 spots for SRR7166135.sra Written 643774 spots for SRR7166135.sra Read 643774 spots for SRR7166135.sra Written 643774 spots for SRR7166135.sra Read 643774 spots for SRR7166135.sra Written 643774 spots for SRR7166135.sra Read 643774 spots for SRR7166135.sra Written 643774 spots for SRR7166135.sra Read 643774 spots for SRR7166135.sra Written 643774 spots for SRR7166135.sra Read 643774 spots for SRR7166135.sra Written 643774 spots for SRR7166135.sra Read 643774 spots for SRR7166135.sra Written 643774 spots for SRR7166135.sra Read 643774 spots for SRR7166135.sra Written 643774 spots for SRR7166135.sra SRR ids: ['SRR7166135.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_f7fyl13i SRR7166135.sra spots: 12875489 blocks: [[1, 643774], [643775, 1287548], [1287549, 1931322], [1931323, 2575096], [2575097, 3218870], [3218871, 3862644], [3862645, 4506418], [4506419, 5150192], [5150193, 5793966], [5793967, 6437740], [6437741, 7081514], [7081515, 7725288], [7725289, 8369062], [8369063, 9012836], [9012837, 9656610], [9656611, 10300384], [10300385, 10944158], [10944159, 11587932], [11587933, 12231706], [12231707, 12875489]] SRR7166135 file size 4341380 SRR7166135 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166135 SRR7166135_1.fastq SRR7166135_2.fastq Input file: SRR7166135_1.fastq Paired file: SRR7166135_2.fastq trimmed: SRR7166135-trimmed-pair1.fastq, SRR7166135-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 15:40:14 2025 >> started Fri Feb 14 15:40:32 2025 >> done (17.886s) 12875489 read pairs processed; of these: 16953 ( 0.13%) short read pairs filtered out after trimming by size control 24105 ( 0.19%) empty read pairs filtered out after trimming by size control 12834431 (99.68%) read pairs available; of these: 8504858 (66.27%) trimmed read pairs available after processing 4329573 (33.73%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 5 0.00% 20 5 0.00% 21 4 0.00% 22 8 0.00% 23 2 0.00% 24 5 0.00% 25 8 0.00% 26 4 0.00% 27 8 0.00% 28 6 0.00% 29 8 0.00% 30 7 0.00% 31 6 0.00% 32 14 0.00% 33 4 0.00% 34 19 0.00% 35 5 0.00% 36 13 0.00% 37 15 0.00% 38 15 0.00% 39 13 0.00% 40 11 0.00% 41 20 0.00% 42 25 0.00% 43 16 0.00% 44 21 0.00% 45 33 0.00% 46 27 0.00% 47 34 0.00% 48 36 0.00% 49 45 0.00% 50 57 0.00% 51 59 0.00% 52 61 0.00% 53 75 0.00% 54 87 0.00% 55 101 0.00% 56 114 0.00% 57 132 0.00% 58 154 0.00% 59 171 0.00% 60 202 0.00% 61 234 0.00% 62 307 0.00% 63 313 0.00% 64 335 0.00% 65 373 0.00% 66 434 0.00% 67 462 0.00% 68 523 0.00% 69 627 0.00% 70 700 0.01% 71 838 0.01% 72 988 0.01% 73 1145 0.01% 74 1252 0.01% 75 1507 0.01% 76 1554 0.01% 77 1770 0.01% 78 1915 0.01% 79 2085 0.02% 80 2481 0.02% 81 2902 0.02% 82 3323 0.03% 83 3871 0.03% 84 4661 0.04% 85 5475 0.04% 86 5830 0.05% 87 6182 0.05% 88 6363 0.05% 89 6887 0.05% 90 7597 0.06% 91 8292 0.06% 92 9136 0.07% 93 9972 0.08% 94 10874 0.08% 95 11304 0.09% 96 12068 0.09% 97 12753 0.10% 98 13029 0.10% 99 14048 0.11% 100 14983 0.12% 101 16035 0.12% 102 17479 0.14% 103 18546 0.14% 104 20250 0.16% 105 21124 0.16% 106 21718 0.17% 107 22358 0.17% 108 22909 0.18% 109 23930 0.19% 110 25548 0.20% 111 26705 0.21% 112 28674 0.22% 113 31125 0.24% 114 32546 0.25% 115 34511 0.27% 116 35579 0.28% 117 36978 0.29% 118 38130 0.30% 119 39476 0.31% 120 40820 0.32% 121 42789 0.33% 122 45764 0.36% 123 48615 0.38% 124 51620 0.40% 125 54985 0.43% 126 56901 0.44% 127 59800 0.47% 128 61825 0.48% 129 64806 0.50% 130 67872 0.53% 131 72066 0.56% 132 77394 0.60% 133 82992 0.65% 134 90389 0.70% 135 97176 0.76% 136 102430 0.80% 137 107323 0.84% 138 114749 0.89% 139 127769 1.00% 140 144576 1.13% 141 140408 1.09% 142 154534 1.20% 143 171148 1.33% 144 199395 1.55% 145 239458 1.87% 146 302632 2.36% 147 398595 3.11% 148 553072 4.31% 149 973105 7.58% 150 3055174 23.80% 151 4329573 33.73% 12834431 reads passed initial QC criterion=sequence-density sequence-density=0.76 sequence-density-rank=1 fanout-score=2.49 fanout-score-rank=23 prefix-density=0.94 prefix-fanout=2.0 sequence=CATCTCAGACCTCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=109.65 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=10.0 sequence=CATCAATGGCACTCTCTCACAGCCAATAACTTCAACAACTTCCCTATCTTTAATCCTCTCACTCCACAAATTCATAAGCTTCACCATTTTACTTCACCAATTCCTTAGAGATGTAATAGCCCATAACAATAGGAAATATCAGAAATCCAATAAGAATCAGCAATTCAGGAAGAAATATGACAAGGAGTAGTAGTGTGGATGTTGTTGTTAGACACTTCTTTTTGTCTTTAAATATAAGGCGTGGTAGAATTACTGGCACTCCAATGATTCCATATAACGGCCATAATGGAGCTATAGAATACAACACCAACGTCGCAAAAAACCAGCAAAAATTCTTAACATTATTTTTAGAAATCCCATACTG criterion=sequence-density sequence-density=1.03 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=23 prefix-density=1.06 prefix-fanout=2.1 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=101.47 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=8.1 sequence=CTTCCATTTCCGCCCAAGCTGCTCACAGTATACGGGCGTCGGCATCCAGACCGTCGGCTGATCGTGGTTTTACTAGGCTAGACTAGCGTACGAGCACTATGGTCAGTAATTCCTGGAGGAATAGGTACCAAGAAAAAAACGAACCTTTGGGTTCCAGAGCTGTACGGTCGCACTGAACTCGGATAGGTCTCAGAAAAACGAAATATAGGCTTACGGTAGGTCCGAATGGCACAAAGCTTGTTCCGTTAGCTGGCATAAGATTCCATGCCTAGATGTGATACACGTTTCTGGAAACTGCCTCGTCATGCGACTGTTCCCCGGGGTCAGGGCCGCTGGTATTTGCTGT SRR7166135 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 15:41:29 Started mapping on | Feb 14 15:42:03 Finished on | Feb 14 15:44:22 Mapping speed, Million of reads per hour | 332.40 Number of input reads | 12834431 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 11945524 Uniquely mapped reads % | 93.07% Average mapped length | 289.17 Number of splices: Total | 11134368 Number of splices: Annotated (sjdb) | 10916541 Number of splices: GT/AG | 10954650 Number of splices: GC/AG | 141787 Number of splices: AT/AC | 8827 Number of splices: Non-canonical | 29104 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.03% Deletion average length | 2.37 Insertion rate per base | 0.02% Insertion average length | 2.06 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 338877 % of reads mapped to multiple loci | 2.64% Number of reads mapped to too many loci | 20039 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.06% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 565576 565576 565576 N_multimapping 338877 338877 338877 N_noFeature 354061 11777731 445950 N_ambiguous 133444 780 57157 UnstrandedReadsAssigned:11458019 PositiveStrandReadsAssigned:167013 NegativeStrandReadsAssigned:11442417 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=143 echo kmer=139 SRR7166135 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166135-trimmed-pair1.fastq SRR7166135-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,834,431 reads, 11,393,672 reads pseudoaligned [quant] estimated average fragment length: 226.195 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,056 rounds 52401 SRR7166135.ke.tsv 34699 SRR7166135.se.tsv 87100 total ==> SRR7166135.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1792.81 1231 50.6639 Potri.005G024800.1.v4.1 1035 809.805 341 31.0705 Potri.004G059700.1.v4.1 961 735.81 47 4.71309 Potri.007G009000.2.v4.1 1416 1190.81 0 0 Potri.003G141000.2.v4.1 2943 2717.81 565 15.3392 Potri.016G087400.1.v4.1 270 87.6013 921.928 776.533 Potri.015G069301.1.v4.1 564 341.897 0 0 Potri.010G195200.1.v4.1 1773 1547.81 373 17.7814 Potri.012G127500.1.v4.1 977 751.81 3704 363.527 ==> SRR7166135.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 68 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 584 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 278 SRR7166135 completed mapping pipeline successfully