Starting /dee2/code/volunteer_pipeline.sh SRR7166136 current disk space = 3112331849728 free memory = 1482085980 SRR7166136 SRAfilesize bb144aea2a2f72789d71a5f85203b14f SRR7166136.sra SRR7166136.sra file validated SRR7166136 is paired end SRR7166136 is conventional basespace SRR7166136 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166136_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.96125 31.0 18.0 33.0 18.0 33.0 2 31.796 33.0 31.0 33.0 29.0 34.0 3 32.0775 33.0 31.0 33.0 29.0 34.0 4 32.51275 33.0 33.0 33.0 32.0 34.0 5 33.00725 33.0 33.0 34.0 32.0 34.0 6 36.9855 38.0 37.0 38.0 35.0 38.0 7 37.46625 38.0 38.0 38.0 37.0 38.0 8 37.519 38.0 38.0 38.0 37.0 38.0 9 37.61125 38.0 38.0 38.0 38.0 38.0 10-14 37.57415 38.0 38.0 38.0 38.0 38.0 15-19 37.56230000000001 38.0 38.0 38.0 38.0 38.0 20-24 37.56485 38.0 38.0 38.0 37.6 38.0 25-29 37.555400000000006 38.0 38.0 38.0 38.0 38.0 30-34 37.526650000000004 38.0 38.0 38.0 38.0 38.0 35-39 37.466699999999996 38.0 38.0 38.0 37.2 38.0 40-44 37.41005 38.0 38.0 38.0 37.0 38.0 45-49 37.42375 38.0 38.0 38.0 37.0 38.0 50-54 37.241699999999994 38.0 38.0 38.0 36.8 38.0 55-59 36.816500000000005 38.0 38.0 38.0 36.2 38.0 60-64 37.048399999999994 38.0 38.0 38.0 36.0 38.0 65-69 37.183800000000005 38.0 38.0 38.0 36.2 38.0 70-74 37.1819 38.0 38.0 38.0 36.0 38.0 75-79 36.93150000000001 38.0 38.0 38.0 36.0 38.0 80-84 36.71965 38.0 38.0 38.0 35.2 38.0 85-89 36.59535 38.0 38.0 38.0 34.8 38.0 90-94 36.5695 38.0 38.0 38.0 35.0 38.0 95-99 36.4602 38.0 38.0 38.0 34.4 38.0 100-104 36.33345 38.0 38.0 38.0 34.0 38.0 105-109 36.0946 38.0 38.0 38.0 33.4 38.0 110-114 36.2042 38.0 38.0 38.0 33.8 38.0 115-119 35.91755 38.0 37.2 38.0 32.6 38.0 120-124 35.5822 38.0 36.6 38.0 31.0 38.0 125-129 35.52765 38.0 36.6 38.0 31.0 38.0 130-134 35.391149999999996 38.0 36.0 38.0 31.0 38.0 135-139 35.03770000000001 38.0 36.0 38.0 28.6 38.0 140-144 34.763349999999996 38.0 35.2 38.0 27.8 38.0 145-149 34.23935 38.0 35.0 38.0 26.2 38.0 150-151 30.842000000000002 36.5 29.5 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 2.0 17 1.0 18 9.0 19 15.0 20 5.0 21 3.0 22 7.0 23 0.0 24 12.0 25 10.0 26 10.0 27 14.0 28 25.0 29 25.0 30 38.0 31 49.0 32 68.0 33 105.0 34 167.0 35 279.0 36 687.0 37 2468.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.48984836802879 17.733230531996917 12.798766383962992 34.9781547160113 2 18.675 26.55 38.95 15.825 3 18.125 30.275000000000002 27.925 23.674999999999997 4 22.675 36.125 22.35 18.85 5 20.4 38.925 22.7 17.974999999999998 6 16.225 36.6 25.25 21.925 7 12.65 19.950000000000003 45.875 21.525 8 17.375 22.15 28.925 31.55 9 18.45 21.65 31.8 28.1 10-14 19.86 29.785 26.179999999999996 24.175 15-19 19.665 28.599999999999998 27.82 23.915 20-24 19.53 29.32 27.655 23.494999999999997 25-29 19.975 29.4 27.455000000000002 23.169999999999998 30-34 19.615 28.865000000000002 27.91 23.61 35-39 19.56 28.825 28.18 23.435 40-44 19.470000000000002 29.23 27.375 23.925 45-49 19.67 28.71 27.860000000000003 23.76 50-54 19.43189802268393 29.142828465321692 27.647294991468435 23.77797852052595 55-59 19.913771240172455 28.3895511032209 27.785949784428098 23.910727872178544 60-64 19.851539773297223 28.749122279065105 27.690841608987864 23.708496338649816 65-69 19.945 28.485 27.71 23.86 70-74 19.75 28.965000000000003 27.435 23.849999999999998 75-79 19.885 28.87 27.975 23.27 80-84 20.27 29.134999999999998 27.689999999999998 22.905 85-89 20.175 29.235 26.919999999999998 23.669999999999998 90-94 19.66 28.59 27.944999999999997 23.805 95-99 20.0 28.87 27.155 23.974999999999998 100-104 20.495 28.685 27.21 23.61 105-109 19.421860885275517 28.80658436213992 27.958446251129175 23.813108501455385 110-114 20.215 28.139999999999997 28.07 23.575 115-119 19.825 29.365000000000002 26.419999999999998 24.39 120-124 20.599999999999998 28.720000000000002 27.075 23.605 125-129 20.330000000000002 28.845 26.825 24.0 130-134 20.755000000000003 28.444999999999997 26.950000000000003 23.849999999999998 135-139 20.075000000000003 28.749999999999996 27.33 23.845 140-144 20.73 28.310000000000002 26.974999999999998 23.985 145-149 20.875 28.49 26.815 23.82 150-151 20.837500000000002 28.6625 26.1125 24.3875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 0.5 23 0.5 24 2.0 25 4.0 26 12.5 27 14.5 28 12.0 29 16.0 30 19.5 31 31.0 32 40.0 33 50.5 34 71.5 35 85.5 36 105.0 37 132.0 38 155.0 39 161.5 40 177.5 41 219.0 42 252.5 43 275.5 44 286.5 45 273.0 46 253.0 47 242.5 48 216.5 49 189.5 50 154.0 51 122.5 52 105.0 53 85.5 54 63.5 55 37.0 56 26.5 57 26.0 58 23.0 59 14.0 60 10.5 61 9.5 62 6.0 63 3.5 64 2.0 65 2.0 66 3.0 67 2.5 68 1.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.725 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.37 55-59 1.425 60-64 0.31 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.37 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62140333165068 98.675 2 0.3281171125694094 0.65 3 0.025239777889954566 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025239777889954566 0.6 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGGATACCAATCTCGTAT 24 0.6 TruSeq Adapter, Index 11 (97% over 39bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.32499999999999996 0.0 0.0 0.0 0.0 94-95 0.44999999999999996 0.0 0.0 0.0 0.0 96-97 0.55 0.0 0.0 0.0 0.0 98-99 0.5874999999999999 0.0 0.0 0.0 0.0 100-101 0.7250000000000001 0.0 0.0 0.0 0.0 102-103 0.8625 0.0 0.0 0.0 0.0 104-105 1.1 0.0 0.0 0.0 0.0 106-107 1.3625 0.0 0.0 0.0 0.0 108-109 1.5875 0.0 0.0 0.0 0.0 110-111 1.85 0.0 0.0 0.0 0.0 112-113 2.175 0.0 0.0 0.0 0.0 114-115 2.475 0.0 0.0 0.0 0.0 116-117 2.8875 0.0 0.0 0.0 0.0 118-119 3.2125 0.0 0.0 0.0 0.0 120-121 3.5 0.0 0.0 0.0 0.0 122-123 3.8125 0.0 0.0 0.0 0.0 124-125 4.175 0.0 0.0 0.0 0.0 126-127 4.5125 0.0 0.0 0.0 0.0 128-129 4.9 0.0 0.0 0.0 0.0 130-131 5.237500000000001 0.0 0.0 0.0 0.0 132-133 5.5875 0.0 0.0 0.0 0.0 134-135 6.05 0.0 0.0 0.0 0.0 136-137 6.6625 0.0 0.0 0.0 0.0 138-139 7.300000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACAGTT 10 0.006901744 144.5 7 >>END_MODULE SRR7166136 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166136_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.996 33.0 33.0 34.0 32.0 34.0 2 33.125 34.0 33.0 34.0 32.0 34.0 3 33.16825 34.0 33.0 34.0 33.0 34.0 4 33.1795 34.0 33.0 34.0 33.0 34.0 5 33.187 34.0 33.0 34.0 33.0 34.0 6 37.37175 38.0 38.0 38.0 37.0 38.0 7 37.334 38.0 38.0 38.0 37.0 38.0 8 37.33425 38.0 38.0 38.0 37.0 38.0 9 37.3505 38.0 38.0 38.0 37.0 38.0 10-14 37.287 38.0 38.0 38.0 37.0 38.0 15-19 37.263650000000005 38.0 38.0 38.0 37.0 38.0 20-24 37.242650000000005 38.0 38.0 38.0 37.0 38.0 25-29 37.198299999999996 38.0 38.0 38.0 37.0 38.0 30-34 37.100199999999994 38.0 38.0 38.0 36.6 38.0 35-39 37.0285 38.0 38.0 38.0 36.0 38.0 40-44 37.028600000000004 38.0 38.0 38.0 36.0 38.0 45-49 36.858799999999995 38.0 38.0 38.0 36.0 38.0 50-54 36.71295 38.0 38.0 38.0 35.4 38.0 55-59 36.581849999999996 38.0 38.0 38.0 34.4 38.0 60-64 36.61535 38.0 38.0 38.0 34.8 38.0 65-69 36.6302 38.0 38.0 38.0 35.0 38.0 70-74 36.576100000000004 38.0 38.0 38.0 34.6 38.0 75-79 36.42625 38.0 38.0 38.0 34.2 38.0 80-84 36.1546 38.0 38.0 38.0 33.8 38.0 85-89 36.050749999999994 38.0 38.0 38.0 33.4 38.0 90-94 35.79415 38.0 37.0 38.0 32.2 38.0 95-99 35.6965 38.0 37.0 38.0 31.6 38.0 100-104 35.44010000000001 38.0 37.0 38.0 29.8 38.0 105-109 35.33475 38.0 36.8 38.0 30.0 38.0 110-114 35.019450000000006 38.0 36.0 38.0 28.0 38.0 115-119 34.79905 38.0 36.0 38.0 27.4 38.0 120-124 34.41955 38.0 35.0 38.0 25.4 38.0 125-129 34.27995 38.0 35.0 38.0 24.2 38.0 130-134 33.7727 38.0 34.6 38.0 21.0 38.0 135-139 33.43194999999999 38.0 34.0 38.0 19.8 38.0 140-144 33.118750000000006 38.0 34.0 38.0 14.6 38.0 145-149 31.805699999999995 38.0 32.6 38.0 11.2 38.0 150-151 27.188125 34.0 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 2.0 4 1.0 5 3.0 6 2.0 7 1.0 8 2.0 9 2.0 10 1.0 11 1.0 12 3.0 13 1.0 14 0.0 15 2.0 16 4.0 17 6.0 18 13.0 19 12.0 20 8.0 21 8.0 22 17.0 23 10.0 24 11.0 25 20.0 26 25.0 27 27.0 28 25.0 29 47.0 30 48.0 31 79.0 32 117.0 33 128.0 34 209.0 35 318.0 36 798.0 37 2044.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.05 15.275 15.25 31.424999999999997 2 23.575 23.65 36.4 16.375 3 20.525 26.200000000000003 31.6 21.675 4 23.175 35.175 21.775 19.875 5 23.1 37.9 21.349999999999998 17.65 6 18.70935467733867 37.81890945472736 23.81190595297649 19.65982991495748 7 16.987740805604204 16.787590693019766 44.708531398548914 21.51613710282712 8 20.610305152576288 22.011005502751377 27.788894447223612 29.589794897448723 9 22.041531148361273 23.167375531648737 28.971728796597446 25.819364523392547 10-14 23.121936580974292 28.473542062618783 27.263178953686108 21.141342402720817 15-19 22.90187056116835 27.39821946583975 28.89366810043013 20.806241872561767 20-24 22.43528763831172 27.957742952986532 28.368297201221647 21.238672207480096 25-29 22.971485742871437 27.898949474737368 28.574287143571787 20.555277638819412 30-34 23.298783235691754 28.145811426568525 28.250963897651594 20.304441440088127 35-39 23.10118660191258 28.03284433985881 28.072898412857356 20.79307064537125 40-44 23.00375469336671 28.475594493116397 28.390488110137674 20.130162703379224 45-49 23.060744153437827 27.998397516150032 28.41904952676649 20.52180880364565 50-54 23.937875751503007 27.530060120240478 28.14128256513026 20.390781563126254 55-59 23.67761971548788 27.805049088359045 28.351031857343216 20.166299338809857 60-64 23.995591624085762 28.363891393647933 27.97314898306783 19.667367999198476 65-69 23.04417509766603 28.35320044074927 28.54352399078433 20.059100470800363 70-74 23.575973147637892 28.891338109313157 27.533690696858876 19.99899804619007 75-79 23.726266219127297 28.91137718551175 27.548720004007816 19.81363659135314 80-84 24.036247121257635 28.06648643236207 28.246720736958046 19.65054570942225 85-89 24.47282744803406 28.580015026296017 27.548209366391184 19.398948159278735 90-94 23.656129452432243 27.939481989880267 28.230048594759783 20.17433996292771 95-99 23.625795460239516 28.195620584256147 27.794758731272236 20.383825224232098 100-104 24.3175557225144 27.75356874530428 27.963936889556724 19.964938642624595 105-109 24.33745804318421 28.129853213766847 27.764140073142627 19.768548669906316 110-114 23.879923824797032 28.47549363536133 27.88413350706625 19.760449032775384 115-119 24.280845945675054 27.808960609401623 27.733787711736994 20.17640573318633 120-124 24.390855309335205 28.426752231023766 27.168354557304724 20.014037902336305 125-129 24.264595339513907 28.569280881984465 27.4718115760461 19.694312202455524 130-134 24.777031766710092 28.259344623709794 27.19210341717607 19.77152019240405 135-139 24.932385054592807 28.212962035460283 27.53180406691375 19.322848843033157 140-144 24.654447115384613 28.335336538461537 27.428886217948715 19.581330128205128 145-149 25.757651655562793 27.71627510895156 28.026849671893 18.499223563592647 150-151 25.225225225225223 28.703703703703702 26.5015015015015 19.56956956956957 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 1.0 15 1.0 16 1.5 17 1.5 18 0.5 19 0.5 20 0.5 21 0.5 22 0.5 23 0.0 24 1.5 25 4.5 26 5.0 27 5.0 28 9.0 29 10.0 30 13.0 31 24.0 32 35.0 33 40.0 34 50.0 35 70.5 36 82.5 37 109.5 38 146.5 39 168.0 40 201.5 41 246.5 42 267.5 43 267.5 44 267.5 45 278.0 46 271.5 47 240.5 48 227.5 49 211.5 50 165.5 51 130.5 52 108.5 53 87.0 54 64.5 55 41.0 56 34.0 57 29.0 58 18.5 59 16.5 60 14.0 61 6.5 62 5.5 63 4.5 64 2.5 65 2.5 66 2.0 67 0.0 68 0.0 69 0.5 70 1.0 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.05 7 0.075 8 0.05 9 0.075 10-14 0.03 15-19 0.03 20-24 0.135 25-29 0.05 30-34 0.145 35-39 0.135 40-44 0.125 45-49 0.155 50-54 0.2 55-59 0.18 60-64 0.19 65-69 0.16999999999999998 70-74 0.19499999999999998 75-79 0.19499999999999998 80-84 0.13 85-89 0.17500000000000002 90-94 0.19499999999999998 95-99 0.215 100-104 0.17500000000000002 105-109 0.19499999999999998 110-114 0.22999999999999998 115-119 0.22999999999999998 120-124 0.27 125-129 0.22499999999999998 130-134 0.21 135-139 0.16999999999999998 140-144 0.16 145-149 0.185 150-151 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69758064516128 98.9 2 0.25201612903225806 0.5 3 0.025201612903225805 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025201612903225805 0.525 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGGATACCAGTGTAGATCT 21 0.525 Illumina Single End PCR Primer 1 (97% over 36bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.15000000000000002 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.55 0.0 0.0 0.0 0.0 98-99 0.5874999999999999 0.0 0.0 0.0 0.0 100-101 0.7250000000000001 0.0 0.0 0.0 0.0 102-103 0.8625 0.0 0.0 0.0 0.0 104-105 1.075 0.0 0.0 0.0 0.0 106-107 1.3375 0.0 0.0 0.0 0.0 108-109 1.575 0.0 0.0 0.0 0.0 110-111 1.875 0.0 0.0 0.0 0.0 112-113 2.2125000000000004 0.0 0.0 0.0 0.0 114-115 2.525 0.0 0.0 0.0 0.0 116-117 2.925 0.0 0.0 0.0 0.0 118-119 3.2375 0.0 0.0 0.0 0.0 120-121 3.55 0.0 0.0 0.0 0.0 122-123 3.8625 0.0 0.0 0.0 0.0 124-125 4.225 0.0 0.0 0.0 0.0 126-127 4.5625 0.0 0.0 0.0 0.0 128-129 4.9625 0.0 0.0 0.0 0.0 130-131 5.3125 0.0 0.0 0.0 0.0 132-133 5.637499999999999 0.0 0.0 0.0 0.0 134-135 6.0625 0.0 0.0 0.0 0.0 136-137 6.65 0.0 0.0 0.0 0.0 138-139 7.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1053332 spots for SRR7166136.sra Written 1053332 spots for SRR7166136.sra Read 1053332 spots for SRR7166136.sra Written 1053332 spots for SRR7166136.sra Read 1053332 spots for SRR7166136.sra Written 1053332 spots for SRR7166136.sra Read 1053332 spots for SRR7166136.sra Written 1053332 spots for SRR7166136.sra Read 1053332 spots for SRR7166136.sra Written 1053332 spots for SRR7166136.sra Read 1053332 spots for SRR7166136.sra Written 1053332 spots for SRR7166136.sra Read 1053332 spots for SRR7166136.sra Written 1053332 spots for SRR7166136.sra Read 1053332 spots for SRR7166136.sra Written 1053332 spots for SRR7166136.sra Read 1053332 spots for SRR7166136.sra Written 1053332 spots for SRR7166136.sra Read 1053332 spots for SRR7166136.sra Written 1053332 spots for SRR7166136.sra Read 1053332 spots for SRR7166136.sra Written 1053332 spots for SRR7166136.sra Read 1053332 spots for SRR7166136.sra Written 1053332 spots for SRR7166136.sra Read 1053332 spots for SRR7166136.sra Written 1053332 spots for SRR7166136.sra Read 1053332 spots for SRR7166136.sra Written 1053332 spots for SRR7166136.sra Read 1053333 spots for SRR7166136.sra Written 1053333 spots for SRR7166136.sra Read 1053332 spots for SRR7166136.sra Written 1053332 spots for SRR7166136.sra Read 1053332 spots for SRR7166136.sra Written 1053332 spots for SRR7166136.sra Read 1053332 spots for SRR7166136.sra Written 1053332 spots for SRR7166136.sra Read 1053332 spots for SRR7166136.sra Written 1053332 spots for SRR7166136.sra Read 1053332 spots for SRR7166136.sra Written 1053332 spots for SRR7166136.sra SRR ids: ['SRR7166136.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ci7q0pe7 SRR7166136.sra spots: 21066641 blocks: [[1, 1053332], [1053333, 2106664], [2106665, 3159996], [3159997, 4213328], [4213329, 5266660], [5266661, 6319992], [6319993, 7373324], [7373325, 8426656], [8426657, 9479988], [9479989, 10533320], [10533321, 11586652], [11586653, 12639984], [12639985, 13693316], [13693317, 14746648], [14746649, 15799980], [15799981, 16853312], [16853313, 17906644], [17906645, 18959976], [18959977, 20013308], [20013309, 21066641]] SRR7166136 file size 7117093 SRR7166136 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166136 SRR7166136_1.fastq SRR7166136_2.fastq Input file: SRR7166136_1.fastq Paired file: SRR7166136_2.fastq trimmed: SRR7166136-trimmed-pair1.fastq, SRR7166136-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 15:05:06 2025 >> started Fri Feb 14 15:05:30 2025 >> done (24.688s) 21066641 read pairs processed; of these: 14386 ( 0.07%) short read pairs filtered out after trimming by size control 122474 ( 0.58%) empty read pairs filtered out after trimming by size control 20929781 (99.35%) read pairs available; of these: 9556093 (45.66%) trimmed read pairs available after processing 11373688 (54.34%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 5 0.00% 20 3 0.00% 21 5 0.00% 22 5 0.00% 23 7 0.00% 24 5 0.00% 25 6 0.00% 26 3 0.00% 27 6 0.00% 28 9 0.00% 29 6 0.00% 30 6 0.00% 31 9 0.00% 32 11 0.00% 33 12 0.00% 34 8 0.00% 35 8 0.00% 36 9 0.00% 37 13 0.00% 38 11 0.00% 39 4 0.00% 40 14 0.00% 41 13 0.00% 42 12 0.00% 43 18 0.00% 44 22 0.00% 45 32 0.00% 46 35 0.00% 47 50 0.00% 48 42 0.00% 49 62 0.00% 50 53 0.00% 51 85 0.00% 52 73 0.00% 53 92 0.00% 54 99 0.00% 55 106 0.00% 56 128 0.00% 57 150 0.00% 58 189 0.00% 59 201 0.00% 60 226 0.00% 61 246 0.00% 62 280 0.00% 63 326 0.00% 64 342 0.00% 65 398 0.00% 66 463 0.00% 67 531 0.00% 68 611 0.00% 69 736 0.00% 70 798 0.00% 71 886 0.00% 72 1162 0.01% 73 1238 0.01% 74 1456 0.01% 75 1684 0.01% 76 2608 0.01% 77 2687 0.01% 78 2237 0.01% 79 2608 0.01% 80 2972 0.01% 81 3440 0.02% 82 3875 0.02% 83 4727 0.02% 84 6437 0.03% 85 6287 0.03% 86 6521 0.03% 87 6934 0.03% 88 7586 0.04% 89 8299 0.04% 90 8934 0.04% 91 9817 0.05% 92 10825 0.05% 93 11905 0.06% 94 12931 0.06% 95 13555 0.06% 96 14498 0.07% 97 15257 0.07% 98 16342 0.08% 99 18838 0.09% 100 18163 0.09% 101 19599 0.09% 102 20834 0.10% 103 22352 0.11% 104 23841 0.11% 105 25262 0.12% 106 26310 0.13% 107 27283 0.13% 108 28872 0.14% 109 29847 0.14% 110 31439 0.15% 111 33140 0.16% 112 35058 0.17% 113 37135 0.18% 114 38925 0.19% 115 40862 0.20% 116 42497 0.20% 117 44147 0.21% 118 45528 0.22% 119 47301 0.23% 120 48151 0.23% 121 50609 0.24% 122 52492 0.25% 123 55646 0.27% 124 57805 0.28% 125 60014 0.29% 126 61971 0.30% 127 63676 0.30% 128 65935 0.32% 129 67953 0.32% 130 70427 0.34% 131 73802 0.35% 132 76664 0.37% 133 81295 0.39% 134 84838 0.41% 135 88618 0.42% 136 92395 0.44% 137 97040 0.46% 138 102824 0.49% 139 108329 0.52% 140 114940 0.55% 141 124203 0.59% 142 135515 0.65% 143 150394 0.72% 144 172087 0.82% 145 200206 0.96% 146 244985 1.17% 147 327539 1.56% 148 482506 2.31% 149 911371 4.35% 150 4380328 20.93% 151 11373688 54.34% 20929781 reads passed initial QC criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=3.07 fanout-score-rank=23 prefix-density=0.99 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACCA criterion=fanout-score sequence-density=0.07 sequence-density-rank=29 fanout-score=21.39 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=7.9 sequence=ATCAACCTCTGCTGGTCTGG criterion=sequence-density sequence-density=0.93 sequence-density-rank=1 fanout-score=2.25 fanout-score-rank=33 prefix-density=0.94 prefix-fanout=2.2 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.08 sequence-density-rank=33 fanout-score=29.76 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=8.8 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7166136 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 15:06:26 Started mapping on | Feb 14 15:06:27 Finished on | Feb 14 15:09:12 Mapping speed, Million of reads per hour | 456.65 Number of input reads | 20929781 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 19786553 Uniquely mapped reads % | 94.54% Average mapped length | 293.28 Number of splices: Total | 19001112 Number of splices: Annotated (sjdb) | 18598725 Number of splices: GT/AG | 18690735 Number of splices: GC/AG | 237697 Number of splices: AT/AC | 16500 Number of splices: Non-canonical | 56180 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.04% Deletion average length | 2.49 Insertion rate per base | 0.02% Insertion average length | 2.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 509768 % of reads mapped to multiple loci | 2.44% Number of reads mapped to too many loci | 64671 % of reads mapped to too many loci | 0.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.63% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 646015 646015 646015 N_multimapping 509768 509768 509768 N_noFeature 741843 19544864 872406 N_ambiguous 218140 1469 106039 UnstrandedReadsAssigned:18826570 PositiveStrandReadsAssigned:240220 NegativeStrandReadsAssigned:18808108 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7166136 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166136-trimmed-pair1.fastq SRR7166136-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,929,781 reads, 18,651,130 reads pseudoaligned [quant] estimated average fragment length: 235.37 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,099 rounds 52401 SRR7166136.ke.tsv 34699 SRR7166136.se.tsv 87100 total ==> SRR7166136.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1783.63 2141 55.2533 Potri.005G024800.1.v4.1 1035 800.63 646 37.1404 Potri.004G059700.1.v4.1 961 726.654 22 1.39361 Potri.007G009000.2.v4.1 1416 1181.63 0 0 Potri.003G141000.2.v4.1 2943 2708.63 868.136 14.7531 Potri.016G087400.1.v4.1 270 85.2246 1502.56 811.546 Potri.015G069301.1.v4.1 564 334.629 0 0 Potri.010G195200.1.v4.1 1773 1538.63 701.889 20.9981 Potri.012G127500.1.v4.1 977 742.645 12302 762.501 ==> SRR7166136.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 27 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 916 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 754 SRR7166136 completed mapping pipeline successfully