Starting /dee2/code/volunteer_pipeline.sh SRR7166137 current disk space = 3110908977152 free memory = 1299466928 SRR7166137 SRAfilesize 26aabdb63302289283f523820b459348 SRR7166137.sra SRR7166137.sra file validated SRR7166137 is paired end SRR7166137 is conventional basespace SRR7166137 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166137_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 42 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.82475 33.0 32.0 34.0 28.0 34.0 2 32.23475 33.0 33.0 34.0 29.0 34.0 3 32.085 33.0 33.0 34.0 29.0 34.0 4 32.38525 33.0 33.0 34.0 31.0 34.0 5 32.49425 33.0 33.0 34.0 31.0 34.0 6 36.5675 38.0 37.0 38.0 34.0 38.0 7 37.04375 38.0 38.0 38.0 36.0 38.0 8 37.01925 38.0 38.0 38.0 36.0 38.0 9 37.1095 38.0 38.0 38.0 36.0 38.0 10-14 36.9545 38.0 38.0 38.0 35.4 38.0 15-19 36.79345000000001 38.0 38.0 38.0 34.6 38.0 20-24 36.949349999999995 38.0 38.0 38.0 35.4 38.0 25-29 36.5202 38.0 38.0 38.0 33.8 38.0 30-34 36.311449999999994 38.0 37.4 38.0 33.4 38.0 35-39 36.2595 38.0 37.0 38.0 33.0 38.0 40-44 36.217949999999995 38.0 37.0 38.0 33.0 38.0 45-49 36.131449999999994 38.0 37.0 38.0 32.6 38.0 50-54 35.968149999999994 38.0 37.0 38.0 31.0 38.0 55-59 35.87570000000001 38.0 37.0 38.0 30.4 38.0 60-64 35.6222 38.0 36.2 38.0 29.2 38.0 65-69 35.630849999999995 38.0 36.4 38.0 29.0 38.0 70-74 35.55665 38.0 36.2 38.0 29.0 38.0 75-79 35.0392 38.0 36.0 38.0 28.6 38.0 80-84 34.80625 38.0 36.0 38.0 27.6 38.0 85-89 34.5437 38.0 34.4 38.0 25.6 38.0 90-94 34.89184999999999 38.0 35.2 38.0 27.4 38.0 95-99 34.1728 38.0 34.4 38.0 21.2 38.0 100-104 33.843399999999995 38.0 33.8 38.0 21.4 38.0 105-109 33.51235 37.6 33.6 38.0 19.4 38.0 110-114 32.553 37.0 31.0 38.0 15.0 38.0 115-119 32.9188 37.0 32.2 38.0 15.0 38.0 120-124 31.9695 36.4 30.0 38.0 15.0 38.0 125-129 31.84015 36.6 29.6 38.0 15.0 38.0 130-134 30.68345 35.4 27.4 38.0 14.2 38.0 135-139 29.42905 33.8 24.2 38.0 13.0 38.0 140-144 27.8762 33.6 20.0 38.0 4.2 38.0 145-149 26.08415 33.0 11.2 38.0 2.0 38.0 150-151 20.130499999999998 25.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 0.0 11 2.0 12 3.0 13 2.0 14 2.0 15 0.0 16 3.0 17 2.0 18 5.0 19 6.0 20 13.0 21 16.0 22 16.0 23 32.0 24 54.0 25 48.0 26 69.0 27 84.0 28 104.0 29 133.0 30 140.0 31 187.0 32 219.0 33 298.0 34 409.0 35 585.0 36 836.0 37 730.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.05854150895786 20.010093363613425 12.23820338127681 31.693161746151905 2 19.175 27.150000000000002 35.949999999999996 17.724999999999998 3 16.650000000000002 33.6 28.225 21.525 4 19.025 37.9 23.225 19.85 5 19.275000000000002 39.625 23.974999999999998 17.125 6 15.25 39.95 24.825 19.975 7 11.899999999999999 21.725 46.075 20.3 8 16.375 23.9 27.250000000000004 32.475 9 16.525000000000002 24.025 30.725 28.725 10-14 18.965 32.875 25.83 22.33 15-19 18.834999999999997 31.35 27.41 22.405 20-24 18.555 31.28 27.515 22.650000000000002 25-29 19.335 31.080000000000002 27.02 22.564999999999998 30-34 18.68 31.095 27.544999999999998 22.68 35-39 19.06 31.16 27.49 22.29 40-44 18.64 31.505 27.834999999999997 22.02 45-49 19.505 30.895 26.935 22.665 50-54 19.225 30.97 27.58 22.225 55-59 19.744999999999997 30.34 27.425 22.49 60-64 18.45 30.535 27.41 23.605 65-69 19.18 30.985000000000003 27.275 22.56 70-74 19.40634698167985 30.728801681850037 27.14485934527981 22.71999199119031 75-79 19.843077701847633 30.82257656289547 26.256643887623387 23.07770184763351 80-84 19.561910556738667 30.88429165399047 26.79748504208498 22.756312747185884 85-89 19.245 30.39 27.355 23.01 90-94 19.24 30.445 27.55 22.765 95-99 19.735 30.09 27.435 22.74 100-104 19.869999999999997 30.385 27.150000000000002 22.595000000000002 105-109 19.91 29.409999999999997 27.29 23.39 110-114 20.09 29.604999999999997 26.974999999999998 23.330000000000002 115-119 20.23 30.54 26.745 22.485 120-124 19.867914144193726 30.20463301145745 26.507229699304546 23.42022314504428 125-129 20.602512135315017 29.470049542110793 26.587599459540613 23.33983886303358 130-134 19.83862834089763 29.652042360060516 26.77760968229955 23.731719616742307 135-139 20.521042084168336 29.223446893787575 26.51803607214429 23.737474949899802 140-144 20.29819382598689 29.259018361935258 26.3621353880022 24.080652424075648 145-149 20.25634581553154 29.00728826338276 26.398592611208848 24.33777330987685 150-151 21.24404314020567 26.812139453222976 26.185101580135438 25.758715826435918 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 2.0 21 3.0 22 3.5 23 5.5 24 8.0 25 6.5 26 12.0 27 20.5 28 22.5 29 30.5 30 45.0 31 59.5 32 80.0 33 99.5 34 133.5 35 156.5 36 155.5 37 182.0 38 207.5 39 205.5 40 198.0 41 191.5 42 208.5 43 212.5 44 204.5 45 214.0 46 205.0 47 180.0 48 173.5 49 159.5 50 128.5 51 108.0 52 92.5 53 75.5 54 57.0 55 40.5 56 25.5 57 23.0 58 19.5 59 11.0 60 10.0 61 7.5 62 3.0 63 4.5 64 3.5 65 1.0 66 0.5 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.9249999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.11 75-79 1.225 80-84 1.39 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.065 125-129 0.08499999999999999 130-134 0.8500000000000001 135-139 0.2 140-144 0.065 145-149 0.525 150-151 0.325 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.15 #Duplication Level Percentage of deduplicated Percentage of total 1 97.42589703588143 93.675 2 1.794071762870515 3.45 3 0.4420176807072283 1.275 4 0.15600624024961 0.6 5 0.10400416016640666 0.5 6 0.026001040041601666 0.15 7 0.05200208008320333 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTGATAGATGCCTCTTTAAAATATCTAAGTGCTGGGGTTATGAGTAGGGA 7 0.17500000000000002 No Hit CTTTGATATTCTCTGCATCCTATTTAGGGCTATTGATATTTAACAAATAT 7 0.17500000000000002 No Hit GCCTCTTTAAAATATCTAAGTGCTGGGGTTATGAGTAGGGATGAGCATAA 6 0.15 No Hit TGGAACTCTACCAATTGGAGCTTTCTTAGCTGTCTTAGCAGTAGTTTATA 5 0.125 No Hit AAAATATCTAAGTGCTGGGGTTATGAGTAGGGATGAGCATAAACCAACAA 5 0.125 No Hit GGAATATATCCCATTTTTAGTTATAATGATGCCTTATGTGATAGATGCCT 5 0.125 No Hit CTTTAATCCTCTCACTCCACAAATTCATAAGCTTCACCATTTTACTTCAC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.48750000000000004 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.925 0.0 0.0 0.0 0.0 98-99 1.05 0.0 0.0 0.0 0.0 100-101 1.325 0.0 0.0 0.0 0.0 102-103 1.5375 0.0 0.0 0.0 0.0 104-105 1.7875 0.0 0.0 0.0 0.0 106-107 2.1125 0.0 0.0 0.0 0.0 108-109 2.5125 0.0 0.0 0.0 0.0 110-111 3.0374999999999996 0.0 0.0 0.0 0.0 112-113 3.6 0.0 0.0 0.0 0.0 114-115 4.05 0.0 0.0 0.0 0.0 116-117 4.4625 0.0 0.0 0.0 0.0 118-119 4.9375 0.0 0.0 0.0 0.0 120-121 5.3875 0.0 0.0 0.0 0.0 122-123 5.8375 0.0 0.0 0.0 0.0 124-125 6.387499999999999 0.0 0.0 0.0 0.0 126-127 7.0375 0.0 0.0 0.0 0.0 128-129 7.65 0.0 0.0 0.0 0.0 130-131 8.175 0.0 0.0 0.0 0.0 132-133 8.65 0.0 0.0 0.0 0.0 134-135 9.2125 0.0 0.0 0.0 0.0 136-137 10.075 0.0 0.0 0.0 0.0 138-139 10.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7166137 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166137_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.65225 33.0 33.0 34.0 32.0 34.0 2 32.682 33.0 33.0 34.0 32.0 34.0 3 32.7485 33.0 33.0 34.0 32.0 34.0 4 32.71625 34.0 33.0 34.0 32.0 34.0 5 32.7585 34.0 33.0 34.0 32.0 34.0 6 36.74175 38.0 38.0 38.0 35.0 38.0 7 36.6775 38.0 38.0 38.0 34.0 38.0 8 36.807 38.0 38.0 38.0 35.0 38.0 9 36.781 38.0 38.0 38.0 35.0 38.0 10-14 36.64209999999999 38.0 38.0 38.0 34.6 38.0 15-19 36.6001 38.0 38.0 38.0 34.6 38.0 20-24 36.418600000000005 38.0 38.0 38.0 34.0 38.0 25-29 36.55845 38.0 38.0 38.0 34.6 38.0 30-34 36.53869999999999 38.0 38.0 38.0 34.0 38.0 35-39 36.4662 38.0 38.0 38.0 34.0 38.0 40-44 36.24935 38.0 38.0 38.0 33.4 38.0 45-49 36.0618 38.0 38.0 38.0 32.6 38.0 50-54 35.92165 38.0 37.4 38.0 31.2 38.0 55-59 35.98515 38.0 37.2 38.0 32.4 38.0 60-64 35.9082 38.0 37.4 38.0 31.4 38.0 65-69 35.9258 38.0 37.0 38.0 31.8 38.0 70-74 35.650850000000005 38.0 37.0 38.0 30.0 38.0 75-79 35.55284999999999 38.0 37.0 38.0 29.2 38.0 80-84 35.573299999999996 38.0 37.0 38.0 30.2 38.0 85-89 35.31750000000001 38.0 36.8 38.0 29.0 38.0 90-94 35.14085 38.0 36.0 38.0 28.6 38.0 95-99 34.745050000000006 38.0 35.6 38.0 26.2 38.0 100-104 34.41825 38.0 35.2 38.0 24.4 38.0 105-109 34.43665 38.0 34.8 38.0 25.4 38.0 110-114 34.2065 38.0 35.0 38.0 24.0 38.0 115-119 33.7727 38.0 34.0 38.0 22.6 38.0 120-124 33.2769 38.0 33.8 38.0 16.2 38.0 125-129 32.4551 37.8 31.0 38.0 15.0 38.0 130-134 31.748199999999997 36.8 30.6 38.0 14.6 38.0 135-139 31.099649999999997 36.0 29.6 38.0 13.2 38.0 140-144 30.211599999999997 36.0 28.2 38.0 8.0 38.0 145-149 27.659399999999998 33.6 18.4 38.0 2.0 38.0 150-151 22.206875 27.5 2.0 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 8.0 4 1.0 5 5.0 6 2.0 7 3.0 8 2.0 9 2.0 10 3.0 11 3.0 12 3.0 13 4.0 14 6.0 15 3.0 16 6.0 17 9.0 18 8.0 19 8.0 20 10.0 21 16.0 22 16.0 23 24.0 24 28.0 25 27.0 26 37.0 27 63.0 28 60.0 29 103.0 30 108.0 31 139.0 32 152.0 33 194.0 34 341.0 35 433.0 36 824.0 37 1341.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.199999999999996 16.675 14.099999999999998 28.025 2 24.73736868434217 23.21160580290145 34.4672336168084 17.58379189594797 3 21.030257564391096 26.531632908227053 33.083270817704424 19.35483870967742 4 23.686843421710854 35.1175587793897 22.586293146573286 18.609304652326163 5 25.362681340670335 36.7183591795898 21.010505252626313 16.908454227113555 6 19.575 37.375 24.525 18.525 7 17.474999999999998 16.525000000000002 44.824999999999996 21.175 8 21.099999999999998 22.5 27.3 29.099999999999998 9 22.83070767691923 24.456114028507127 27.53188297074269 25.18129532383096 10-14 23.15578894723681 28.417104276069015 27.156789197299325 21.27031757939485 15-19 23.86 27.639999999999997 28.26 20.24 20-24 23.855 27.965 28.075 20.105 25-29 23.674999999999997 27.755000000000003 28.24 20.330000000000002 30-34 23.28 27.589999999999996 28.9 20.23 35-39 22.783417512626894 28.104215632344854 28.659298894834222 20.45306796019403 40-44 23.255 28.720000000000002 27.97 20.055 45-49 22.765 27.150000000000002 30.095 19.99 50-54 23.24 27.66 29.43 19.67 55-59 23.546177308865442 27.68638431921596 29.226461323066154 19.540977048852444 60-64 22.98 28.115000000000002 29.07 19.835 65-69 23.105 27.6 29.115000000000002 20.18 70-74 22.61 28.139999999999997 29.265 19.985 75-79 22.97 28.27 29.24 19.52 80-84 22.879575915183036 27.720544108821766 29.815963192638527 19.583916783356674 85-89 23.04615230761538 27.791389569478476 29.42647132356618 19.735986799339965 90-94 23.30349552432865 28.119217882682403 29.624443666549983 18.952842926438965 95-99 23.373506025903886 28.234235135270293 29.044356653498028 19.3479021853278 100-104 23.50175087543772 26.908454227113555 29.85492746373187 19.734867433716857 105-109 23.2863004102872 27.7944561192835 29.135394776343443 19.783848694085858 110-114 23.367852318775327 28.560708389614287 28.915903747060884 19.1555355445495 115-119 24.02980596119224 28.11562312462493 29.100820164032807 18.75375075015003 120-124 24.173626043906584 28.064209631444715 28.674301145171775 19.087863179476923 125-129 24.055 27.834999999999997 29.330000000000002 18.78 130-134 24.685000000000002 28.285 28.305000000000003 18.725 135-139 24.709999999999997 28.07 28.645 18.575 140-144 24.83 27.735 28.48 18.955 145-149 25.66 27.46 28.084999999999997 18.795 150-151 25.95 26.900000000000002 28.275 18.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.0 21 0.0 22 1.5 23 3.5 24 2.0 25 2.5 26 5.0 27 8.0 28 10.5 29 10.5 30 24.0 31 37.5 32 43.0 33 49.0 34 65.5 35 93.5 36 112.5 37 120.5 38 155.0 39 186.5 40 196.5 41 224.0 42 261.0 43 264.5 44 273.5 45 278.5 46 242.0 47 214.0 48 209.5 49 189.0 50 154.0 51 126.0 52 95.0 53 84.5 54 79.5 55 58.5 56 32.0 57 23.5 58 19.5 59 12.5 60 9.5 61 7.5 62 6.0 63 3.5 64 0.5 65 0.5 66 0.5 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.025 4 0.05 5 0.05 6 0.0 7 0.0 8 0.0 9 0.025 10-14 0.025 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.015 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.005 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.02 85-89 0.005 90-94 0.015 95-99 0.015 100-104 0.05 105-109 0.06999999999999999 110-114 0.055 115-119 0.02 120-124 0.015 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.075 #Duplication Level Percentage of deduplicated Percentage of total 1 97.97033567525371 94.125 2 1.2230028623471247 2.35 3 0.4944054124381993 1.425 4 0.078064012490242 0.3 5 0.10408534998698933 0.5 6 0.052042674993494666 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.078064012490242 1.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCTCC 17 0.42500000000000004 No Hit GCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCC 12 0.3 No Hit AGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCCTATTT 11 0.27499999999999997 No Hit GCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCCTATTTT 6 0.15 No Hit GGGAGGTATCCCAATAGGAGGTTTCCTCCTATGGTTTTCAAAACAATCAC 6 0.15 No Hit CGGGCGTCGGCATCCAGACCGTCGGCTGATCGTGGTTTTACTAGGCTAGA 5 0.125 No Hit CTTGAGCAGATTCATTCGCCAACTAACCCTTTAATTTATCCTATTTTTCC 5 0.125 No Hit CTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCT 5 0.125 No Hit GCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.9125 0.0 0.0 0.0 0.0 98-99 1.0375 0.0 0.0 0.0 0.0 100-101 1.3 0.0 0.0 0.0 0.0 102-103 1.4875 0.0 0.0 0.0 0.0 104-105 1.7625000000000002 0.0 0.0 0.0 0.0 106-107 2.05 0.0 0.0 0.0 0.0 108-109 2.45 0.0 0.0 0.0 0.0 110-111 2.975 0.0 0.0 0.0 0.0 112-113 3.5250000000000004 0.0 0.0 0.0 0.0 114-115 3.925 0.0 0.0 0.0 0.0 116-117 4.35 0.0 0.0 0.0 0.0 118-119 4.8625 0.0 0.0 0.0 0.0 120-121 5.2875 0.0 0.0 0.0 0.0 122-123 5.7625 0.0 0.0 0.0 0.0 124-125 6.35 0.0 0.0 0.0 0.0 126-127 7.05 0.0 0.0 0.0 0.0 128-129 7.6875 0.0 0.0 0.0 0.0 130-131 8.225000000000001 0.0 0.0 0.0 0.0 132-133 8.8 0.0 0.0 0.0 0.0 134-135 9.5125 0.0 0.0 0.0 0.0 136-137 10.4625 0.0 0.0 0.0 0.0 138-139 11.225000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAAGAT 10 0.0068608476 144.78749 1 GCCCTAA 20 3.6087015E-4 108.59062 5 AAAGCCC 20 3.6087015E-4 108.59062 2 AAGCCCT 20 3.6087015E-4 108.59062 3 GAAAGCC 20 3.6087015E-4 108.59062 1 CCCTAAC 20 3.6087015E-4 108.59062 6 CCTAACT 25 8.764213E-4 86.8725 7 TAACTTA 25 8.764213E-4 86.8725 9 CTAACTT 25 8.764213E-4 86.8725 8 AGCCCTA 25 8.764213E-4 86.8725 4 AGTGAGG 35 0.00333173 62.05179 145 ATGGACG 35 0.0035668064 20.683928 15-19 >>END_MODULE Read 650224 spots for SRR7166137.sra Written 650224 spots for SRR7166137.sra Read 650224 spots for SRR7166137.sra Written 650224 spots for SRR7166137.sra Read 650224 spots for SRR7166137.sra Written 650224 spots for SRR7166137.sra Read 650224 spots for SRR7166137.sra Written 650224 spots for SRR7166137.sra Read 650224 spots for SRR7166137.sra Written 650224 spots for SRR7166137.sra Read 650224 spots for SRR7166137.sra Written 650224 spots for SRR7166137.sra Read 650224 spots for SRR7166137.sra Written 650224 spots for SRR7166137.sra Read 650224 spots for SRR7166137.sra Written 650224 spots for SRR7166137.sra Read 650224 spots for SRR7166137.sra Written 650224 spots for SRR7166137.sra Read 650224 spots for SRR7166137.sra Written 650224 spots for SRR7166137.sra Read 650224 spots for SRR7166137.sra Written 650224 spots for SRR7166137.sra Read 650224 spots for SRR7166137.sra Written 650224 spots for SRR7166137.sra Read 650224 spots for SRR7166137.sra Written 650224 spots for SRR7166137.sra Read 650224 spots for SRR7166137.sra Written 650224 spots for SRR7166137.sra Read 650224 spots for SRR7166137.sra Written 650224 spots for SRR7166137.sra Read 650224 spots for SRR7166137.sra Written 650224 spots for SRR7166137.sra Read 650224 spots for SRR7166137.sra Written 650224 spots for SRR7166137.sra Read 650224 spots for SRR7166137.sra Written 650224 spots for SRR7166137.sra Read 650224 spots for SRR7166137.sra Written 650224 spots for SRR7166137.sra Read 650233 spots for SRR7166137.sra Written 650233 spots for SRR7166137.sra SRR ids: ['SRR7166137.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ue0_k5ht SRR7166137.sra spots: 13004489 blocks: [[1, 650224], [650225, 1300448], [1300449, 1950672], [1950673, 2600896], [2600897, 3251120], [3251121, 3901344], [3901345, 4551568], [4551569, 5201792], [5201793, 5852016], [5852017, 6502240], [6502241, 7152464], [7152465, 7802688], [7802689, 8452912], [8452913, 9103136], [9103137, 9753360], [9753361, 10403584], [10403585, 11053808], [11053809, 11704032], [11704033, 12354256], [12354257, 13004489]] SRR7166137 file size 4385094 SRR7166137 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166137 SRR7166137_1.fastq SRR7166137_2.fastq Input file: SRR7166137_1.fastq Paired file: SRR7166137_2.fastq trimmed: SRR7166137-trimmed-pair1.fastq, SRR7166137-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 13:57:56 2025 >> started Fri Feb 14 13:58:12 2025 >> done (16.407s) 13004489 read pairs processed; of these: 14849 ( 0.11%) short read pairs filtered out after trimming by size control 12976 ( 0.10%) empty read pairs filtered out after trimming by size control 12976664 (99.79%) read pairs available; of these: 8665376 (66.78%) trimmed read pairs available after processing 4311288 (33.22%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 6 0.00% 20 1 0.00% 21 2 0.00% 22 7 0.00% 23 5 0.00% 24 5 0.00% 25 6 0.00% 26 5 0.00% 27 6 0.00% 28 5 0.00% 29 2 0.00% 30 3 0.00% 31 5 0.00% 32 7 0.00% 33 9 0.00% 34 4 0.00% 35 14 0.00% 36 12 0.00% 37 10 0.00% 38 14 0.00% 39 14 0.00% 40 12 0.00% 41 22 0.00% 42 21 0.00% 43 17 0.00% 44 23 0.00% 45 40 0.00% 46 33 0.00% 47 35 0.00% 48 46 0.00% 49 43 0.00% 50 59 0.00% 51 69 0.00% 52 72 0.00% 53 75 0.00% 54 102 0.00% 55 125 0.00% 56 119 0.00% 57 167 0.00% 58 166 0.00% 59 204 0.00% 60 264 0.00% 61 262 0.00% 62 297 0.00% 63 372 0.00% 64 396 0.00% 65 472 0.00% 66 482 0.00% 67 568 0.00% 68 622 0.00% 69 753 0.01% 70 905 0.01% 71 956 0.01% 72 1192 0.01% 73 1415 0.01% 74 1499 0.01% 75 1679 0.01% 76 1843 0.01% 77 2100 0.02% 78 2282 0.02% 79 2618 0.02% 80 2867 0.02% 81 3458 0.03% 82 4079 0.03% 83 4710 0.04% 84 5592 0.04% 85 6228 0.05% 86 6691 0.05% 87 7340 0.06% 88 7944 0.06% 89 8365 0.06% 90 9280 0.07% 91 10237 0.08% 92 11244 0.09% 93 12476 0.10% 94 13390 0.10% 95 14229 0.11% 96 15122 0.12% 97 15384 0.12% 98 16379 0.13% 99 17312 0.13% 100 18637 0.14% 101 20040 0.15% 102 21247 0.16% 103 22856 0.18% 104 24296 0.19% 105 26556 0.20% 106 26594 0.20% 107 26973 0.21% 108 28535 0.22% 109 29313 0.23% 110 30593 0.24% 111 32429 0.25% 112 34866 0.27% 113 38199 0.29% 114 39857 0.31% 115 41760 0.32% 116 43320 0.33% 117 43673 0.34% 118 45651 0.35% 119 45823 0.35% 120 46903 0.36% 121 49585 0.38% 122 52765 0.41% 123 55522 0.43% 124 59143 0.46% 125 62619 0.48% 126 65119 0.50% 127 66512 0.51% 128 68457 0.53% 129 71524 0.55% 130 73960 0.57% 131 77879 0.60% 132 83249 0.64% 133 88656 0.68% 134 95521 0.74% 135 102861 0.79% 136 107740 0.83% 137 110959 0.86% 138 118373 0.91% 139 129622 1.00% 140 145845 1.12% 141 140697 1.08% 142 154746 1.19% 143 169026 1.30% 144 196827 1.52% 145 235180 1.81% 146 296295 2.28% 147 389858 3.00% 148 538953 4.15% 149 946426 7.29% 150 3008437 23.18% 151 4311288 33.22% 12976664 reads passed initial QC criterion=sequence-density sequence-density=1.19 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=34 prefix-density=1.26 prefix-fanout=2.1 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=51.64 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=10.9 sequence=TTTTTTTTTACGTTTCATCAATGGCACTCTCTCACAGCCAATAACTTCAACAACTTCCCTATCTTTAATCCTCTCACTCCACAAATTCATAAGCTTCACCATTTTACTTCACCAATTCCTTAGAGATGTAATAGCCCATAACAATAGGAAATATCAGAAATCCAATAAGAATCAGCAATTCAGGAAGAAATATGACAAGGAGTAGTAGTGTGGATGTTGTTGTTAGACACTTCTTTTTGTCTTTAAATATAAGGCGTGGTAGAATTACTGGCACTCCAATGATTCCATATAACGGCCATAATGGAGCTATAGAATACAACACCAACGTCGCAAAAAACCAGCAAAAATTCTTAACATTATTTTTAGAAATCCCATACTGCCACCGAATATTCAGTCCTTTAAGAAATCGAACAGCATACCCAACATAGTAAAAACCATCAATAATGCAAATACCGTTACCACAAGTGCAAATACTCCCATTCCTACCTCTCCAAAG criterion=sequence-density sequence-density=1.41 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=19 prefix-density=1.43 prefix-fanout=2.2 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=26.33 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.5 sequence=GCTTCAACAATAACGTCTCTTTCAGAAGGCATTGGTATCTTTTCCCCACTTCCAAGCATTTTTTCAACTAATCTTATGTTATTAACCATTTCCTTAAATTCTTCTGGGTCTGCTGACAAAGCATGATCAGGACCTTCCATATTTTTATCTAAGGTAAAGTGCTTCTCAATAACATCCGCTCCTAAGGCAACAGAAACTACTGGGGCGAGTATTCCCAATGTATGGTCAGAATATCCCACAGGGATATTGAATATACTTTTCAAGGTTTTAATAGCGTTTAAATTGACATCTTCATAAGGGGTTGGGTAAGATGAAATACAATGCAATAAAATAATATCCCTGCATCCATTATTTTCTAAAACTTTAACTGCTTCCCAAATTTCCCCAATATCAGACATTCCTGTAGATAAAATCACCGGCTTGCCTGTTTTTGCCACTTTTTCTAATAAGGGATAAAAGGTTAAA SRR7166137 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 14:00:03 Started mapping on | Feb 14 14:00:03 Finished on | Feb 14 14:04:30 Mapping speed, Million of reads per hour | 174.97 Number of input reads | 12976664 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 11010036 Uniquely mapped reads % | 84.84% Average mapped length | 287.68 Number of splices: Total | 8513545 Number of splices: Annotated (sjdb) | 8318939 Number of splices: GT/AG | 8364587 Number of splices: GC/AG | 110102 Number of splices: AT/AC | 6417 Number of splices: Non-canonical | 32439 Mismatch rate per base, % | 0.46% Deletion rate per base | 0.05% Deletion average length | 2.58 Insertion rate per base | 0.03% Insertion average length | 2.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 299102 % of reads mapped to multiple loci | 2.30% Number of reads mapped to too many loci | 24077 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 12.58% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1680331 1680331 1680331 N_multimapping 299102 299102 299102 N_noFeature 387070 10863069 442649 N_ambiguous 143559 778 51818 UnstrandedReadsAssigned:10479407 PositiveStrandReadsAssigned:146189 NegativeStrandReadsAssigned:10515569 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=141 echo kmer=137 SRR7166137 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166137-trimmed-pair1.fastq SRR7166137-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,976,664 reads, 10,419,248 reads pseudoaligned [quant] estimated average fragment length: 215.543 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,103 rounds 52401 SRR7166137.ke.tsv 34699 SRR7166137.se.tsv 87100 total ==> SRR7166137.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1803.46 1023 40.2725 Potri.005G024800.1.v4.1 1035 820.457 266 23.0178 Potri.004G059700.1.v4.1 961 746.461 39 3.70933 Potri.007G009000.2.v4.1 1416 1201.46 0 0 Potri.003G141000.2.v4.1 2943 2728.46 499.285 12.9918 Potri.016G087400.1.v4.1 270 91.4128 917.544 712.62 Potri.015G069301.1.v4.1 564 351.174 0 0 Potri.010G195200.1.v4.1 1773 1558.46 325 14.8056 Potri.012G127500.1.v4.1 977 762.457 3628 337.824 ==> SRR7166137.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 27 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 641 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 293 SRR7166137 completed mapping pipeline successfully