Starting /dee2/code/volunteer_pipeline.sh SRR7166138 current disk space = 3112297316352 free memory = 1448597748 SRR7166138 SRAfilesize 9f14dea796de16a0fd06a2eec716474e SRR7166138.sra SRR7166138.sra file validated SRR7166138 is paired end SRR7166138 is conventional basespace SRR7166138 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166138_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.51425 33.0 30.0 33.0 18.0 34.0 2 31.9975 33.0 31.0 34.0 29.0 34.0 3 32.06475 33.0 31.0 33.0 29.0 34.0 4 32.16575 33.0 32.0 33.0 31.0 34.0 5 32.79875 33.0 33.0 33.0 32.0 34.0 6 36.85875 38.0 37.0 38.0 35.0 38.0 7 37.2735 38.0 38.0 38.0 36.0 38.0 8 37.52575 38.0 38.0 38.0 37.0 38.0 9 37.61 38.0 38.0 38.0 38.0 38.0 10-14 37.62915 38.0 38.0 38.0 38.0 38.0 15-19 37.62675 38.0 38.0 38.0 38.0 38.0 20-24 37.62329999999999 38.0 38.0 38.0 38.0 38.0 25-29 37.597500000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.57684999999999 38.0 38.0 38.0 38.0 38.0 35-39 37.53960000000001 38.0 38.0 38.0 37.8 38.0 40-44 37.539500000000004 38.0 38.0 38.0 38.0 38.0 45-49 37.55 38.0 38.0 38.0 38.0 38.0 50-54 37.507549999999995 38.0 38.0 38.0 37.6 38.0 55-59 37.1093 38.0 38.0 38.0 37.0 38.0 60-64 37.280649999999994 38.0 38.0 38.0 37.0 38.0 65-69 37.36285 38.0 38.0 38.0 37.0 38.0 70-74 37.24974999999999 38.0 38.0 38.0 36.6 38.0 75-79 37.210049999999995 38.0 38.0 38.0 36.4 38.0 80-84 37.14095 38.0 38.0 38.0 36.0 38.0 85-89 37.012600000000006 38.0 38.0 38.0 36.0 38.0 90-94 36.897000000000006 38.0 38.0 38.0 35.4 38.0 95-99 36.883050000000004 38.0 38.0 38.0 35.8 38.0 100-104 36.69285 38.0 38.0 38.0 35.0 38.0 105-109 36.5928 38.0 38.0 38.0 34.8 38.0 110-114 36.59155 38.0 38.0 38.0 34.2 38.0 115-119 36.361349999999995 38.0 37.8 38.0 34.0 38.0 120-124 36.14934999999999 38.0 37.6 38.0 33.6 38.0 125-129 36.03895 38.0 37.0 38.0 33.4 38.0 130-134 35.880399999999995 38.0 37.0 38.0 33.0 38.0 135-139 35.7566 38.0 36.2 38.0 32.2 38.0 140-144 35.4229 38.0 36.0 38.0 31.0 38.0 145-149 34.959799999999994 38.0 36.0 38.0 29.4 38.0 150-151 31.663249999999998 36.5 32.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 2.0 12 0.0 13 0.0 14 1.0 15 0.0 16 2.0 17 1.0 18 2.0 19 3.0 20 1.0 21 5.0 22 3.0 23 3.0 24 5.0 25 8.0 26 8.0 27 6.0 28 14.0 29 21.0 30 32.0 31 41.0 32 57.0 33 70.0 34 132.0 35 237.0 36 612.0 37 2734.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.659131774980736 17.724120215771897 10.8656563061906 32.751091703056765 2 20.674999999999997 24.55 38.875 15.9 3 17.825 31.175000000000004 27.625 23.375 4 21.475 36.275 21.2 21.05 5 18.989241931448586 37.32799599699775 24.818613960470355 18.864148111083313 6 17.075000000000003 35.8 26.025 21.099999999999998 7 12.6 19.225 47.099999999999994 21.075 8 18.475 20.625 28.025 32.875 9 17.775 22.325 30.575000000000003 29.325000000000003 10-14 19.485 29.270000000000003 27.534999999999997 23.71 15-19 20.36 28.49 27.61 23.54 20-24 19.564999999999998 28.939999999999998 28.265 23.23 25-29 20.325 28.71 27.57 23.395 30-34 19.945 29.175 27.655 23.225 35-39 19.98 28.875 27.88 23.265 40-44 20.169999999999998 28.860000000000003 27.74 23.23 45-49 19.975 29.07 27.22 23.735 50-54 20.244999999999997 28.43 28.155 23.169999999999998 55-59 20.307614725163894 28.840141200201714 27.8315683308119 23.02067574382249 60-64 20.503453107797018 28.921028926033433 27.34961465318787 23.225903312981682 65-69 20.405 29.455 27.250000000000004 22.89 70-74 19.715 29.285 27.639999999999997 23.36 75-79 19.785 29.215000000000003 27.439999999999998 23.56 80-84 20.31 29.255 27.045 23.39 85-89 20.355 29.185 27.52 22.939999999999998 90-94 20.71 28.73 27.515 23.044999999999998 95-99 20.275000000000002 27.92 28.33 23.474999999999998 100-104 20.242205874993743 29.10974328178952 27.763599059200324 22.884451784016413 105-109 20.454659255921083 28.76671173201142 27.5148966000701 23.263732411997395 110-114 21.224999999999998 28.660000000000004 27.560000000000002 22.555 115-119 21.375 29.07 26.895000000000003 22.66 120-124 20.87 28.62 27.395000000000003 23.115 125-129 21.315 29.025000000000002 26.474999999999998 23.185 130-134 21.46 28.689999999999998 26.88 22.97 135-139 20.630000000000003 28.810000000000002 26.75 23.810000000000002 140-144 21.21 28.110000000000003 26.88 23.799999999999997 145-149 20.835 28.994999999999997 26.26 23.91 150-151 20.67109052209841 28.871916864905472 25.604106673344184 24.852885939651934 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 1.0 15 0.5 16 0.0 17 0.5 18 1.0 19 1.5 20 3.0 21 2.0 22 0.0 23 1.5 24 2.0 25 2.5 26 3.5 27 4.0 28 8.5 29 12.5 30 20.5 31 33.5 32 37.5 33 50.0 34 75.5 35 92.5 36 109.5 37 125.5 38 150.0 39 182.5 40 198.5 41 221.0 42 242.0 43 261.5 44 276.5 45 275.0 46 260.0 47 244.0 48 213.5 49 187.5 50 155.0 51 121.0 52 103.5 53 68.5 54 51.5 55 44.0 56 36.5 57 27.5 58 20.5 59 16.5 60 12.0 61 10.5 62 9.5 63 7.5 64 3.5 65 1.0 66 1.5 67 2.0 68 2.0 69 2.0 70 1.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.675 2 0.0 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.8500000000000001 60-64 0.09 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.08499999999999999 105-109 0.145 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.1625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67377666248431 99.3 2 0.27603513174404015 0.5499999999999999 3 0.05018820577164366 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.025 0.0 0.0 0.0 32-33 0.0 0.025 0.0 0.0 0.0 34-35 0.0 0.025 0.0 0.0 0.0 36-37 0.0 0.025 0.0 0.0 0.0 38-39 0.0 0.025 0.0 0.0 0.0 40-41 0.0 0.025 0.0 0.0 0.0 42-43 0.0 0.025 0.0 0.0 0.0 44-45 0.0 0.025 0.0 0.0 0.0 46-47 0.0 0.025 0.0 0.0 0.0 48-49 0.0 0.025 0.0 0.0 0.0 50-51 0.0 0.025 0.0 0.0 0.0 52-53 0.0 0.025 0.0 0.0 0.0 54-55 0.0 0.025 0.0 0.0 0.0 56-57 0.0 0.025 0.0 0.0 0.0 58-59 0.0 0.025 0.0 0.0 0.0 60-61 0.0 0.025 0.0 0.0 0.0 62-63 0.0125 0.025 0.0 0.0 0.0 64-65 0.025 0.025 0.0 0.0 0.0 66-67 0.025 0.025 0.0 0.0 0.0 68-69 0.025 0.025 0.0 0.0 0.0 70-71 0.037500000000000006 0.025 0.0 0.0 0.0 72-73 0.1 0.025 0.0 0.0 0.0 74-75 0.1125 0.025 0.0 0.0 0.0 76-77 0.125 0.025 0.0 0.0 0.0 78-79 0.15 0.025 0.0 0.0 0.0 80-81 0.16249999999999998 0.025 0.0 0.0 0.0 82-83 0.21250000000000002 0.025 0.0 0.0 0.0 84-85 0.2875 0.025 0.0 0.0 0.0 86-87 0.3375 0.025 0.0 0.0 0.0 88-89 0.4375 0.025 0.0 0.0 0.0 90-91 0.55 0.025 0.0 0.0 0.0 92-93 0.6 0.025 0.0 0.0 0.0 94-95 0.825 0.025 0.0 0.0 0.0 96-97 1.0 0.025 0.0 0.0 0.0 98-99 1.075 0.025 0.0 0.0 0.0 100-101 1.2999999999999998 0.025 0.0 0.0 0.0 102-103 1.5375 0.025 0.0 0.0 0.0 104-105 1.8125 0.025 0.0 0.0 0.0 106-107 2.0875 0.025 0.0 0.0 0.0 108-109 2.325 0.025 0.0 0.0 0.0 110-111 2.4875 0.025 0.0 0.0 0.0 112-113 3.0 0.025 0.0 0.0 0.0 114-115 3.4375 0.025 0.0 0.0 0.0 116-117 3.8375000000000004 0.025 0.0 0.0 0.0 118-119 4.4375 0.025 0.0 0.0 0.0 120-121 4.925 0.025 0.0 0.0 0.0 122-123 5.625 0.025 0.0 0.0 0.0 124-125 6.300000000000001 0.025 0.0 0.0 0.0 126-127 6.5625 0.025 0.0 0.0 0.0 128-129 7.15 0.025 0.0 0.0 0.0 130-131 7.625 0.025 0.0 0.0 0.0 132-133 8.275 0.025 0.0 0.0 0.0 134-135 8.925 0.025 0.0 0.0 0.0 136-137 9.6375 0.025 0.0 0.0 0.0 138-139 10.6375 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTACT 10 0.006830828 145.0 1 TTTACTA 10 0.006830828 145.0 2 >>END_MODULE SRR7166138 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166138_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.981 33.0 33.0 34.0 32.0 34.0 2 33.0295 33.0 33.0 34.0 32.0 34.0 3 33.112 34.0 33.0 34.0 32.0 34.0 4 33.1895 34.0 33.0 34.0 33.0 34.0 5 33.12775 34.0 33.0 34.0 32.0 34.0 6 37.38075 38.0 38.0 38.0 37.0 38.0 7 37.3455 38.0 38.0 38.0 37.0 38.0 8 37.383 38.0 38.0 38.0 37.0 38.0 9 37.41875 38.0 38.0 38.0 37.0 38.0 10-14 37.37365 38.0 38.0 38.0 37.0 38.0 15-19 37.34145 38.0 38.0 38.0 37.0 38.0 20-24 37.3438 38.0 38.0 38.0 37.0 38.0 25-29 37.324349999999995 38.0 38.0 38.0 37.0 38.0 30-34 37.277300000000004 38.0 38.0 38.0 36.8 38.0 35-39 37.2119 38.0 38.0 38.0 36.2 38.0 40-44 37.141000000000005 38.0 38.0 38.0 36.4 38.0 45-49 37.1444 38.0 38.0 38.0 36.0 38.0 50-54 36.97675 38.0 38.0 38.0 35.6 38.0 55-59 36.85695 38.0 38.0 38.0 35.0 38.0 60-64 36.873599999999996 38.0 38.0 38.0 35.2 38.0 65-69 36.83135 38.0 38.0 38.0 35.0 38.0 70-74 36.722300000000004 38.0 38.0 38.0 34.6 38.0 75-79 36.56965 38.0 38.0 38.0 34.0 38.0 80-84 36.43685000000001 38.0 37.6 38.0 34.0 38.0 85-89 36.34265 38.0 37.2 38.0 33.8 38.0 90-94 36.1983 38.0 37.0 38.0 33.4 38.0 95-99 35.930099999999996 38.0 37.0 38.0 32.2 38.0 100-104 35.83605 38.0 37.0 38.0 31.8 38.0 105-109 35.5708 38.0 36.4 38.0 30.2 38.0 110-114 35.345650000000006 38.0 36.0 38.0 28.8 38.0 115-119 35.0651 38.0 35.6 38.0 28.0 38.0 120-124 34.77195 38.0 35.4 38.0 26.8 38.0 125-129 34.53555 38.0 35.0 38.0 25.8 38.0 130-134 33.906349999999996 38.0 34.2 38.0 22.2 38.0 135-139 33.3557 38.0 34.0 38.0 18.6 38.0 140-144 32.482800000000005 37.4 33.2 38.0 14.2 38.0 145-149 31.460749999999997 36.8 31.0 38.0 10.8 38.0 150-151 26.679625 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 1.0 9 0.0 10 1.0 11 0.0 12 1.0 13 2.0 14 1.0 15 1.0 16 2.0 17 3.0 18 4.0 19 5.0 20 3.0 21 7.0 22 14.0 23 5.0 24 13.0 25 12.0 26 20.0 27 24.0 28 43.0 29 51.0 30 68.0 31 72.0 32 109.0 33 142.0 34 242.0 35 396.0 36 945.0 37 1812.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.475 16.725 13.675 29.125 2 22.875 24.925 36.4 15.8 3 20.25 26.625 32.475 20.65 4 22.6 35.725 22.525000000000002 19.15 5 23.0 39.125 21.25 16.625 6 18.15 38.324999999999996 23.75 19.775000000000002 7 16.275000000000002 14.75 46.949999999999996 22.025 8 20.5 22.075 28.175 29.25 9 21.725 23.65 28.000000000000004 26.625 10-14 22.46 29.154999999999998 26.99 21.395 15-19 23.064999999999998 27.744999999999997 28.205000000000002 20.985 20-24 23.11 28.494999999999997 27.965 20.43 25-29 22.545 28.215 28.575 20.665 30-34 23.07 28.134999999999998 28.205000000000002 20.59 35-39 22.6 28.199999999999996 28.599999999999998 20.599999999999998 40-44 22.895 28.285 28.575 20.244999999999997 45-49 22.770000000000003 27.97 28.360000000000003 20.9 50-54 22.79 27.98 28.78 20.45 55-59 23.445 27.925 27.705000000000002 20.925 60-64 23.095 27.955000000000002 28.51 20.44 65-69 23.880000000000003 27.534999999999997 28.494999999999997 20.09 70-74 23.44 28.475 28.110000000000003 19.975 75-79 23.599999999999998 27.41 28.544999999999998 20.445 80-84 22.96 28.525 28.32 20.195 85-89 23.435 28.015 28.360000000000003 20.19 90-94 23.03 28.294999999999998 28.084999999999997 20.59 95-99 23.630000000000003 28.305000000000003 28.04 20.025000000000002 100-104 23.65 27.744999999999997 28.485 20.119999999999997 105-109 23.919999999999998 27.77 27.950000000000003 20.36 110-114 23.225 28.615000000000002 28.28 19.88 115-119 24.09 28.03 27.76 20.119999999999997 120-124 23.849999999999998 28.185 27.544999999999998 20.419999999999998 125-129 24.47 28.16 27.63 19.74 130-134 24.295 28.43 27.905 19.37 135-139 24.884999999999998 28.375 27.3 19.439999999999998 140-144 24.705 28.515 27.21 19.57 145-149 26.085 28.444999999999997 26.415 19.055 150-151 25.87543771885943 27.188594297148573 27.66383191595798 19.27213606803402 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 2.0 22 3.0 23 3.0 24 2.5 25 3.5 26 7.0 27 6.0 28 4.5 29 11.0 30 13.0 31 16.5 32 27.5 33 41.0 34 58.0 35 78.5 36 88.5 37 107.5 38 151.5 39 189.5 40 213.5 41 244.5 42 261.0 43 263.5 44 284.5 45 289.5 46 282.5 47 234.5 48 205.5 49 198.0 50 151.5 51 119.0 52 101.5 53 87.0 54 64.5 55 46.0 56 33.5 57 24.5 58 17.5 59 15.0 60 13.0 61 9.0 62 6.5 63 5.5 64 3.5 65 1.5 66 3.5 67 2.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57232704402516 98.95 2 0.3522012578616352 0.7000000000000001 3 0.025157232704402514 0.075 4 0.0 0.0 5 0.025157232704402514 0.125 6 0.025157232704402514 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCCTATTT 6 0.15 No Hit GCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCCTATTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.6 0.0 0.0 0.0 0.0 94-95 0.825 0.0 0.0 0.0 0.0 96-97 1.0 0.0 0.0 0.0 0.0 98-99 1.075 0.0 0.0 0.0 0.0 100-101 1.2999999999999998 0.0 0.0 0.0 0.0 102-103 1.5375 0.0 0.0 0.0 0.0 104-105 1.8125 0.0 0.0 0.0 0.0 106-107 2.0999999999999996 0.0 0.0 0.0 0.0 108-109 2.35 0.0 0.0 0.0 0.0 110-111 2.5125 0.0 0.0 0.0 0.0 112-113 3.025 0.0 0.0 0.0 0.0 114-115 3.4625 0.0 0.0 0.0 0.0 116-117 3.9125 0.0 0.0 0.0 0.0 118-119 4.512499999999999 0.0 0.0 0.0 0.0 120-121 5.0 0.0 0.0 0.0 0.0 122-123 5.699999999999999 0.0 0.0 0.0 0.0 124-125 6.35 0.0 0.0 0.0 0.0 126-127 6.637499999999999 0.0 0.0 0.0 0.0 128-129 7.225 0.0 0.0 0.0 0.0 130-131 7.6875 0.0 0.0 0.0 0.0 132-133 8.3125 0.0 0.0 0.0 0.0 134-135 8.95 0.0 0.0 0.0 0.0 136-137 9.675 0.0 0.0 0.0 0.0 138-139 10.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 768423 spots for SRR7166138.sra Written 768423 spots for SRR7166138.sra Read 768423 spots for SRR7166138.sra Written 768423 spots for SRR7166138.sra Read 768423 spots for SRR7166138.sra Written 768423 spots for SRR7166138.sra Read 768423 spots for SRR7166138.sra Written 768423 spots for SRR7166138.sra Read 768426 spots for SRR7166138.sra Written 768426 spots for SRR7166138.sra Read 768423 spots for SRR7166138.sra Written 768423 spots for SRR7166138.sra Read 768423 spots for SRR7166138.sra Written 768423 spots for SRR7166138.sra Read 768423 spots for SRR7166138.sra Written 768423 spots for SRR7166138.sra Read 768423 spots for SRR7166138.sra Written 768423 spots for SRR7166138.sra Read 768423 spots for SRR7166138.sra Written 768423 spots for SRR7166138.sra Read 768423 spots for SRR7166138.sra Written 768423 spots for SRR7166138.sra Read 768423 spots for SRR7166138.sra Written 768423 spots for SRR7166138.sra Read 768423 spots for SRR7166138.sra Written 768423 spots for SRR7166138.sra Read 768423 spots for SRR7166138.sra Written 768423 spots for SRR7166138.sra Read 768423 spots for SRR7166138.sra Written 768423 spots for SRR7166138.sra Read 768423 spots for SRR7166138.sra Written 768423 spots for SRR7166138.sra Read 768423 spots for SRR7166138.sra Written 768423 spots for SRR7166138.sra Read 768423 spots for SRR7166138.sra Written 768423 spots for SRR7166138.sra Read 768423 spots for SRR7166138.sra Written 768423 spots for SRR7166138.sra Read 768423 spots for SRR7166138.sra Written 768423 spots for SRR7166138.sra SRR ids: ['SRR7166138.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ex_78nsg SRR7166138.sra spots: 15368463 blocks: [[1, 768423], [768424, 1536846], [1536847, 2305269], [2305270, 3073692], [3073693, 3842115], [3842116, 4610538], [4610539, 5378961], [5378962, 6147384], [6147385, 6915807], [6915808, 7684230], [7684231, 8452653], [8452654, 9221076], [9221077, 9989499], [9989500, 10757922], [10757923, 11526345], [11526346, 12294768], [12294769, 13063191], [13063192, 13831614], [13831615, 14600037], [14600038, 15368463]] SRR7166138 file size 5186167 SRR7166138 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166138 SRR7166138_1.fastq SRR7166138_2.fastq Input file: SRR7166138_1.fastq Paired file: SRR7166138_2.fastq trimmed: SRR7166138-trimmed-pair1.fastq, SRR7166138-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 14:38:17 2025 >> started Fri Feb 14 14:38:42 2025 >> done (24.762s) 15368463 read pairs processed; of these: 4463 ( 0.03%) short read pairs filtered out after trimming by size control 3894 ( 0.03%) empty read pairs filtered out after trimming by size control 15360106 (99.95%) read pairs available; of these: 7727149 (50.31%) trimmed read pairs available after processing 7632957 (49.69%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 4 0.00% 20 3 0.00% 21 5 0.00% 22 5 0.00% 23 5 0.00% 24 8 0.00% 25 8 0.00% 26 5 0.00% 27 2 0.00% 28 3 0.00% 29 6 0.00% 30 7 0.00% 31 5 0.00% 32 8 0.00% 33 9 0.00% 34 5 0.00% 35 6 0.00% 36 8 0.00% 37 6 0.00% 38 15 0.00% 39 15 0.00% 40 16 0.00% 41 12 0.00% 42 15 0.00% 43 20 0.00% 44 19 0.00% 45 18 0.00% 46 28 0.00% 47 29 0.00% 48 25 0.00% 49 47 0.00% 50 50 0.00% 51 55 0.00% 52 54 0.00% 53 79 0.00% 54 78 0.00% 55 86 0.00% 56 98 0.00% 57 102 0.00% 58 129 0.00% 59 129 0.00% 60 178 0.00% 61 185 0.00% 62 220 0.00% 63 270 0.00% 64 297 0.00% 65 300 0.00% 66 392 0.00% 67 382 0.00% 68 517 0.00% 69 551 0.00% 70 673 0.00% 71 781 0.01% 72 879 0.01% 73 987 0.01% 74 1115 0.01% 75 1249 0.01% 76 1496 0.01% 77 1606 0.01% 78 1753 0.01% 79 2011 0.01% 80 2300 0.01% 81 2715 0.02% 82 3076 0.02% 83 3583 0.02% 84 4223 0.03% 85 4709 0.03% 86 5096 0.03% 87 5572 0.04% 88 5957 0.04% 89 6711 0.04% 90 7364 0.05% 91 8045 0.05% 92 9020 0.06% 93 10254 0.07% 94 11337 0.07% 95 11830 0.08% 96 12503 0.08% 97 13079 0.09% 98 14208 0.09% 99 15301 0.10% 100 15872 0.10% 101 17097 0.11% 102 18622 0.12% 103 19890 0.13% 104 20936 0.14% 105 22526 0.15% 106 23765 0.15% 107 24268 0.16% 108 24877 0.16% 109 26148 0.17% 110 26925 0.18% 111 28923 0.19% 112 30637 0.20% 113 32316 0.21% 114 34321 0.22% 115 36633 0.24% 116 37604 0.24% 117 38536 0.25% 118 39401 0.26% 119 40360 0.26% 120 41002 0.27% 121 42854 0.28% 122 44538 0.29% 123 47249 0.31% 124 50185 0.33% 125 51396 0.33% 126 53509 0.35% 127 54878 0.36% 128 55828 0.36% 129 57954 0.38% 130 59390 0.39% 131 61345 0.40% 132 64428 0.42% 133 68348 0.44% 134 72345 0.47% 135 75862 0.49% 136 78819 0.51% 137 83188 0.54% 138 86634 0.56% 139 91272 0.59% 140 96971 0.63% 141 104933 0.68% 142 115462 0.75% 143 126748 0.83% 144 146083 0.95% 145 171575 1.12% 146 208925 1.36% 147 273122 1.78% 148 400876 2.61% 149 750877 4.89% 150 3356939 21.85% 151 7632957 49.69% 15360106 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=4.38 fanout-score-rank=22 prefix-density=0.72 prefix-fanout=1.7 sequence=TTCTCAGCACCGAAGTCCATCTCAGACCTCTCATAGAACATCTTAACTGGTGCAACACCTGCAATGATTGTCTCAGTTGTGGTGTTCTCTGAGAAACCTAAGTCAGGGTACATGCCACATTTGCAGCCACTGCC criterion=fanout-score sequence-density=0.02 sequence-density-rank=40 fanout-score=187.08 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=18.8 sequence=ATCATCAACTCCACATAGTTCAAGTTTCCAAGCATACATGAAAACACCTTGAAAGTTGAAGCAGCCAACAAAGCAGTGACGCGTACACAAGACAAAGGATTTATAGGAACCCTTTGCTGTTTATTATTATTTAACAACAAGCACCATTATACAAACATGAGCTGACCAACTGATAGATTAACTACTGCTTTGTTGGAACCATGTCCATGTGTCCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACACTTGCAGCCATTCTCAGCACC criterion=sequence-density sequence-density=0.72 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=33 prefix-density=0.73 prefix-fanout=2.0 sequence=GGCAGTGGCTGCAAATGTGGCATGTACCCTGACTTAGGTTTCTCAGAGAACACCACAACTGAGACAATCATTGCAGGTGTTGCACCAGTTAAGATGTTCTATGAGAGGTCTGAGATGGACTTCGGTGCTGAGAA criterion=fanout-score sequence-density=0.09 sequence-density-rank=25 fanout-score=37.87 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=11.0 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7166138 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 14:39:40 Started mapping on | Feb 14 14:39:41 Finished on | Feb 14 14:42:14 Mapping speed, Million of reads per hour | 361.41 Number of input reads | 15360106 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 14315536 Uniquely mapped reads % | 93.20% Average mapped length | 292.06 Number of splices: Total | 13133211 Number of splices: Annotated (sjdb) | 12829632 Number of splices: GT/AG | 12904606 Number of splices: GC/AG | 172750 Number of splices: AT/AC | 10500 Number of splices: Non-canonical | 45355 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.04% Deletion average length | 2.21 Insertion rate per base | 0.02% Insertion average length | 2.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 378487 % of reads mapped to multiple loci | 2.46% Number of reads mapped to too many loci | 58924 % of reads mapped to too many loci | 0.38% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.85% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 671563 671563 671563 N_multimapping 378487 378487 378487 N_noFeature 575123 14147764 675307 N_ambiguous 144127 1060 75766 UnstrandedReadsAssigned:13596286 PositiveStrandReadsAssigned:166712 NegativeStrandReadsAssigned:13564463 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7166138 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166138-trimmed-pair1.fastq SRR7166138-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,360,106 reads, 13,476,678 reads pseudoaligned [quant] estimated average fragment length: 226.903 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,013 rounds 52401 SRR7166138.ke.tsv 34699 SRR7166138.se.tsv 87100 total ==> SRR7166138.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1792.1 1259 52.1685 Potri.005G024800.1.v4.1 1035 809.097 190 17.438 Potri.004G059700.1.v4.1 961 735.102 5 0.505088 Potri.007G009000.2.v4.1 1416 1190.1 0 0 Potri.003G141000.2.v4.1 2943 2717.1 434.375 11.8715 Potri.016G087400.1.v4.1 270 88.694 613 513.228 Potri.015G069301.1.v4.1 564 341.765 0 0 Potri.010G195200.1.v4.1 1773 1547.1 477 22.8952 Potri.012G127500.1.v4.1 977 751.102 17995 1779.09 ==> SRR7166138.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 17 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 336 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 593 SRR7166138 completed mapping pipeline successfully