Starting /dee2/code/volunteer_pipeline.sh SRR7166139 current disk space = 3112544313344 free memory = 1571531196 SRR7166139 SRAfilesize 5350bd06ee4895c9e50342064084f6b9 SRR7166139.sra SRR7166139.sra file validated SRR7166139 is paired end SRR7166139 is conventional basespace SRR7166139 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166139_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.545 33.0 32.0 33.0 27.0 34.0 2 32.085 33.0 31.0 34.0 29.0 34.0 3 31.7955 33.0 31.0 34.0 28.0 34.0 4 32.126 33.0 32.0 34.0 30.0 34.0 5 32.29475 33.0 33.0 34.0 31.0 34.0 6 36.3715 38.0 37.0 38.0 34.0 38.0 7 36.924 38.0 37.0 38.0 35.0 38.0 8 36.9815 38.0 38.0 38.0 35.0 38.0 9 37.012 38.0 38.0 38.0 36.0 38.0 10-14 36.8506 38.0 38.0 38.0 34.8 38.0 15-19 36.64325 38.0 38.0 38.0 34.0 38.0 20-24 36.884 38.0 38.0 38.0 35.2 38.0 25-29 36.48675 38.0 38.0 38.0 33.8 38.0 30-34 36.22135 38.0 37.0 38.0 32.6 38.0 35-39 36.0801 38.0 37.0 38.0 31.8 38.0 40-44 36.0309 38.0 37.0 38.0 31.4 38.0 45-49 35.8736 38.0 37.0 38.0 31.0 38.0 50-54 35.7975 38.0 36.6 38.0 29.8 38.0 55-59 35.72 38.0 36.4 38.0 29.8 38.0 60-64 35.34615 38.0 36.0 38.0 28.6 38.0 65-69 35.481100000000005 38.0 36.0 38.0 29.0 38.0 70-74 35.326499999999996 38.0 36.0 38.0 29.0 38.0 75-79 34.78795 38.0 35.8 38.0 27.4 38.0 80-84 34.39205 38.0 35.0 38.0 25.2 38.0 85-89 34.28535 38.0 34.2 38.0 24.6 38.0 90-94 34.56564999999999 38.0 34.8 38.0 25.6 38.0 95-99 33.85395 37.6 33.6 38.0 19.2 38.0 100-104 33.3729 37.2 33.0 38.0 16.6 38.0 105-109 33.1422 37.0 32.8 38.0 15.0 38.0 110-114 32.1126 37.0 29.2 38.0 15.0 38.0 115-119 32.3404 37.0 30.6 38.0 15.0 38.0 120-124 31.617 36.4 28.6 38.0 15.0 38.0 125-129 31.286399999999997 36.0 28.6 38.0 14.6 38.0 130-134 29.8 35.0 24.2 38.0 13.2 38.0 135-139 28.5665 33.4 22.2 38.0 10.8 38.0 140-144 27.079250000000002 33.6 17.0 38.0 2.0 38.0 145-149 25.45745 32.6 10.8 38.0 2.0 38.0 150-151 19.277625 16.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 4.0 14 6.0 15 2.0 16 4.0 17 6.0 18 4.0 19 7.0 20 13.0 21 16.0 22 28.0 23 30.0 24 46.0 25 66.0 26 76.0 27 102.0 28 116.0 29 146.0 30 156.0 31 205.0 32 245.0 33 309.0 34 418.0 35 593.0 36 828.0 37 571.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.679918966827046 19.650544441630792 11.040769815143074 33.62876677639909 2 19.125 25.474999999999998 37.2 18.2 3 16.475 32.475 28.549999999999997 22.5 4 19.950000000000003 38.725 21.975 19.35 5 20.125 37.425000000000004 23.75 18.7 6 16.225 37.95 24.5 21.325 7 12.9 21.3 45.725 20.075000000000003 8 18.325 21.7 27.425 32.550000000000004 9 17.175 23.724999999999998 29.675 29.425 10-14 18.775 30.855 26.435 23.935000000000002 15-19 19.005 30.085 27.27 23.64 20-24 19.2 29.965000000000003 27.32 23.515 25-29 19.415 30.005 27.435 23.145 30-34 19.375 29.98 28.08 22.564999999999998 35-39 19.55 29.675 27.555000000000003 23.22 40-44 19.505 29.735 27.694999999999997 23.064999999999998 45-49 19.52 29.29 27.255000000000003 23.935000000000002 50-54 19.2 29.805 27.715 23.28 55-59 19.59 29.4 27.295 23.715 60-64 19.744999999999997 29.134999999999998 27.185 23.935000000000002 65-69 19.475 29.255 27.765 23.505000000000003 70-74 20.28840376527138 28.980572801922694 28.029240937312238 22.701782495493692 75-79 19.785634461038303 28.944427511937416 28.024992380371838 23.244945646652443 80-84 20.267725352471118 29.07823077314603 26.950679493052377 23.703364381330484 85-89 19.905 28.849999999999998 28.410000000000004 22.835 90-94 19.965 28.79 27.805000000000003 23.44 95-99 19.865 29.335 27.79 23.01 100-104 20.369999999999997 29.12 27.694999999999997 22.814999999999998 105-109 19.725 28.939999999999998 27.29 24.044999999999998 110-114 20.525 28.605000000000004 27.284999999999997 23.585 115-119 20.57 28.87 26.919999999999998 23.64 120-124 20.172060221077377 28.72005201820637 27.349572350322614 23.75831541039364 125-129 20.497547302032235 29.117028731604766 26.794473921313443 23.590950045049556 130-134 20.833333333333336 28.6773607748184 26.94713478611784 23.54217110573043 135-139 21.287673976169017 28.462000600781018 26.749774707119258 23.50055071593071 140-144 20.76934620579261 28.23770696813566 26.997148716922613 23.995798109149117 145-149 20.66389209246352 27.92458506744221 26.716141001855288 24.69538183823898 150-151 20.90169067000626 26.900438321853475 26.81277395115842 25.38509705698184 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 1.5 21 1.0 22 0.5 23 2.5 24 6.5 25 7.5 26 10.0 27 15.5 28 17.0 29 22.0 30 32.0 31 45.5 32 55.0 33 63.0 34 82.5 35 102.0 36 121.0 37 141.0 38 155.0 39 186.5 40 211.5 41 222.5 42 245.5 43 253.5 44 241.5 45 241.5 46 233.5 47 219.5 48 206.5 49 166.5 50 135.5 51 121.0 52 108.5 53 78.5 54 58.0 55 55.5 56 38.0 57 29.0 58 25.0 59 13.0 60 5.5 61 3.5 62 1.5 63 3.0 64 5.5 65 4.0 66 1.0 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.275 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.13999999999999999 75-79 1.5699999999999998 80-84 1.765 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.034999999999999996 125-129 0.11 130-134 0.88 135-139 0.13 140-144 0.045 145-149 0.28500000000000003 150-151 0.1875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39592247671784 98.725 2 0.5285678328718851 1.05 3 0.07550969041026932 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.6000000000000001 0.0 0.0 0.0 0.0 96-97 0.7 0.0 0.0 0.0 0.0 98-99 0.7875000000000001 0.0 0.0 0.0 0.0 100-101 0.9125 0.0 0.0 0.0 0.0 102-103 1.1125 0.0 0.0 0.0 0.0 104-105 1.3375 0.0 0.0 0.0 0.0 106-107 1.5750000000000002 0.0 0.0 0.0 0.0 108-109 1.7374999999999998 0.0 0.0 0.0 0.0 110-111 1.9749999999999999 0.0 0.0 0.0 0.0 112-113 2.275 0.0 0.0 0.0 0.0 114-115 2.425 0.0 0.0 0.0 0.0 116-117 2.675 0.0 0.0 0.0 0.0 118-119 3.225 0.0 0.0 0.0 0.0 120-121 3.4749999999999996 0.0 0.0 0.0 0.0 122-123 3.85 0.0 0.0 0.0 0.0 124-125 4.324999999999999 0.0 0.0 0.0 0.0 126-127 4.775 0.0 0.0 0.0 0.0 128-129 5.175 0.0 0.0 0.0 0.0 130-131 5.6875 0.0 0.0 0.0 0.0 132-133 6.05 0.0 0.0 0.0 0.0 134-135 6.637499999999999 0.0 0.0 0.0 0.0 136-137 7.1625 0.0 0.0 0.0 0.0 138-139 7.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7166139 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166139_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.63025 33.0 33.0 34.0 32.0 34.0 2 32.73975 33.0 33.0 34.0 32.0 34.0 3 32.72975 33.0 33.0 34.0 32.0 34.0 4 32.74075 33.0 33.0 34.0 32.0 34.0 5 32.74325 34.0 33.0 34.0 32.0 34.0 6 36.795 38.0 38.0 38.0 35.0 38.0 7 36.78325 38.0 38.0 38.0 35.0 38.0 8 36.85125 38.0 38.0 38.0 36.0 38.0 9 36.7765 38.0 38.0 38.0 35.0 38.0 10-14 36.7174 38.0 38.0 38.0 34.6 38.0 15-19 36.6198 38.0 38.0 38.0 34.2 38.0 20-24 36.471849999999996 38.0 38.0 38.0 33.8 38.0 25-29 36.5426 38.0 38.0 38.0 34.2 38.0 30-34 36.526300000000006 38.0 38.0 38.0 34.0 38.0 35-39 36.4547 38.0 38.0 38.0 34.0 38.0 40-44 36.28145 38.0 38.0 38.0 33.4 38.0 45-49 36.0721 38.0 37.8 38.0 32.2 38.0 50-54 35.95425 38.0 37.0 38.0 31.0 38.0 55-59 36.064750000000004 38.0 37.4 38.0 32.2 38.0 60-64 35.90605 38.0 37.0 38.0 31.2 38.0 65-69 35.97755 38.0 37.0 38.0 31.4 38.0 70-74 35.72765 38.0 37.0 38.0 29.6 38.0 75-79 35.616699999999994 38.0 37.0 38.0 29.0 38.0 80-84 35.578050000000005 38.0 37.0 38.0 29.0 38.0 85-89 35.41895 38.0 36.6 38.0 29.0 38.0 90-94 35.14815 38.0 36.0 38.0 28.2 38.0 95-99 34.73625 38.0 35.4 38.0 26.4 38.0 100-104 34.5056 38.0 35.0 38.0 24.8 38.0 105-109 34.53605 38.0 35.0 38.0 25.4 38.0 110-114 34.242149999999995 38.0 34.6 38.0 23.6 38.0 115-119 33.71855000000001 38.0 34.2 38.0 21.0 38.0 120-124 33.081599999999995 38.0 33.6 38.0 15.0 38.0 125-129 32.42365 37.8 31.0 38.0 15.0 38.0 130-134 31.391999999999996 36.8 29.6 38.0 13.6 38.0 135-139 30.863799999999998 36.0 29.0 38.0 13.2 38.0 140-144 29.984200000000005 36.0 27.4 38.0 7.8 38.0 145-149 27.823050000000002 34.6 19.0 38.0 2.0 38.0 150-151 21.87075 27.0 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 2.0 4 1.0 5 2.0 6 3.0 7 3.0 8 3.0 9 2.0 10 1.0 11 2.0 12 0.0 13 3.0 14 3.0 15 5.0 16 5.0 17 9.0 18 10.0 19 18.0 20 16.0 21 18.0 22 20.0 23 24.0 24 25.0 25 35.0 26 45.0 27 73.0 28 65.0 29 101.0 30 112.0 31 121.0 32 179.0 33 205.0 34 305.0 35 432.0 36 802.0 37 1346.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.075 16.725 13.25 29.95 2 24.224999999999998 23.599999999999998 34.4 17.775 3 20.974999999999998 26.6 31.8 20.625 4 24.23105776444111 35.35883970992748 20.180045011252815 20.230057514378593 5 22.650000000000002 39.85 21.0 16.5 6 17.9 39.900000000000006 23.775 18.425 7 17.95 16.150000000000002 44.75 21.15 8 21.325 21.3 27.0 30.375000000000004 9 23.075000000000003 25.275 27.875 23.775 10-14 23.07 28.845 26.655 21.43 15-19 23.355 28.04 27.71 20.895 20-24 23.294999999999998 29.215000000000003 26.995 20.495 25-29 23.435 27.79 27.765 21.01 30-34 23.28 28.16 28.215 20.345 35-39 22.634999999999998 28.305000000000003 28.54 20.52 40-44 23.225 28.09 28.315 20.369999999999997 45-49 23.41 28.050000000000004 28.22 20.32 50-54 22.645 27.865000000000002 28.825 20.665 55-59 23.705000000000002 27.29 28.415000000000003 20.59 60-64 23.23 28.01 28.395 20.365 65-69 23.46 27.855 28.43 20.255000000000003 70-74 23.485 27.944999999999997 28.07 20.5 75-79 23.68 28.43 28.205000000000002 19.685 80-84 23.145 28.105000000000004 28.38 20.369999999999997 85-89 23.54 27.615000000000002 28.915000000000003 19.93 90-94 24.349999999999998 27.245 28.075 20.330000000000002 95-99 23.830000000000002 28.04 28.49 19.64 100-104 23.70355553333 27.849177376606495 28.004200630094516 20.443066459968996 105-109 23.530588764944223 27.73247961582712 28.80796358361263 19.928968035616027 110-114 23.5008752188047 28.08702175543886 28.652163040760193 19.75993998499625 115-119 24.215 27.705000000000002 28.59 19.49 120-124 24.654999999999998 27.589999999999996 28.425 19.33 125-129 24.125 27.955000000000002 28.585 19.335 130-134 25.05 27.595 27.87 19.485 135-139 24.945 28.194999999999997 27.915 18.945 140-144 25.035 28.16 27.900000000000002 18.905 145-149 25.845000000000002 27.810000000000002 26.995 19.35 150-151 25.6125 27.275 27.650000000000002 19.4625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 1.5 24 1.0 25 1.0 26 2.0 27 5.5 28 9.5 29 10.5 30 17.5 31 24.5 32 30.0 33 44.0 34 47.0 35 57.5 36 78.5 37 109.5 38 150.0 39 169.5 40 182.5 41 225.5 42 269.5 43 283.0 44 281.0 45 281.0 46 277.0 47 266.5 48 226.5 49 186.5 50 170.5 51 142.5 52 111.0 53 88.5 54 68.5 55 48.0 56 38.5 57 30.0 58 22.5 59 11.0 60 6.0 61 7.5 62 4.5 63 1.5 64 3.0 65 3.5 66 1.5 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.025 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.015 105-109 0.045 110-114 0.025 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47009841029522 98.55000000000001 2 0.32803431743628564 0.65 3 0.1514004542013626 0.44999999999999996 4 0.025233409033560434 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025233409033560434 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCCTATTTT 10 0.25 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.625 0.0 0.0 0.0 0.0 96-97 0.7124999999999999 0.0 0.0 0.0 0.0 98-99 0.7875000000000001 0.0 0.0 0.0 0.0 100-101 0.9125 0.0 0.0 0.0 0.0 102-103 1.1 0.0 0.0 0.0 0.0 104-105 1.3625 0.0 0.0 0.0 0.0 106-107 1.625 0.0 0.0 0.0 0.0 108-109 1.8125 0.0 0.0 0.0 0.0 110-111 2.075 0.0 0.0 0.0 0.0 112-113 2.375 0.0 0.0 0.0 0.0 114-115 2.5250000000000004 0.0 0.0 0.0 0.0 116-117 2.75 0.0 0.0 0.0 0.0 118-119 3.3125 0.0 0.0 0.0 0.0 120-121 3.5875 0.0 0.0 0.0 0.0 122-123 4.0 0.0 0.0 0.0 0.0 124-125 4.475 0.0 0.0 0.0 0.0 126-127 4.975 0.0 0.0 0.0 0.0 128-129 5.4125 0.0 0.0 0.0 0.0 130-131 6.0375 0.0 0.0 0.0 0.0 132-133 6.487500000000001 0.0 0.0 0.0 0.0 134-135 7.125 0.0 0.0 0.0 0.0 136-137 7.6625 0.0 0.0 0.0 0.0 138-139 8.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 785800 spots for SRR7166139.sra Written 785800 spots for SRR7166139.sra Read 785800 spots for SRR7166139.sra Written 785800 spots for SRR7166139.sra Read 785800 spots for SRR7166139.sra Written 785800 spots for SRR7166139.sra Read 785800 spots for SRR7166139.sra Written 785800 spots for SRR7166139.sra Read 785800 spots for SRR7166139.sra Written 785800 spots for SRR7166139.sra Read 785800 spots for SRR7166139.sra Written 785800 spots for SRR7166139.sra Read 785800 spots for SRR7166139.sra Written 785800 spots for SRR7166139.sra Read 785800 spots for SRR7166139.sra Written 785800 spots for SRR7166139.sra Read 785800 spots for SRR7166139.sra Written 785800 spots for SRR7166139.sra Read 785800 spots for SRR7166139.sra Written 785800 spots for SRR7166139.sra Read 785800 spots for SRR7166139.sra Written 785800 spots for SRR7166139.sra Read 785800 spots for SRR7166139.sra Written 785800 spots for SRR7166139.sra Read 785800 spots for SRR7166139.sra Written 785800 spots for SRR7166139.sra Read 785800 spots for SRR7166139.sra Written 785800 spots for SRR7166139.sra Read 785800 spots for SRR7166139.sra Written 785800 spots for SRR7166139.sra Read 785800 spots for SRR7166139.sra Written 785800 spots for SRR7166139.sra Read 785800 spots for SRR7166139.sra Written 785800 spots for SRR7166139.sra Read 785819 spots for SRR7166139.sra Written 785819 spots for SRR7166139.sra Read 785800 spots for SRR7166139.sra Written 785800 spots for SRR7166139.sra Read 785800 spots for SRR7166139.sra Written 785800 spots for SRR7166139.sra SRR ids: ['SRR7166139.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_iwwgu3zj SRR7166139.sra spots: 15716019 blocks: [[1, 785800], [785801, 1571600], [1571601, 2357400], [2357401, 3143200], [3143201, 3929000], [3929001, 4714800], [4714801, 5500600], [5500601, 6286400], [6286401, 7072200], [7072201, 7858000], [7858001, 8643800], [8643801, 9429600], [9429601, 10215400], [10215401, 11001200], [11001201, 11787000], [11787001, 12572800], [12572801, 13358600], [13358601, 14144400], [14144401, 14930200], [14930201, 15716019]] SRR7166139 file size 5303942 SRR7166139 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166139 SRR7166139_1.fastq SRR7166139_2.fastq Input file: SRR7166139_1.fastq Paired file: SRR7166139_2.fastq trimmed: SRR7166139-trimmed-pair1.fastq, SRR7166139-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 15:55:54 2025 >> started Fri Feb 14 15:56:11 2025 >> done (17.558s) 15716019 read pairs processed; of these: 12762 ( 0.08%) short read pairs filtered out after trimming by size control 9165 ( 0.06%) empty read pairs filtered out after trimming by size control 15694092 (99.86%) read pairs available; of these: 10388798 (66.20%) trimmed read pairs available after processing 5305294 (33.80%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 8 0.00% 21 6 0.00% 22 5 0.00% 23 8 0.00% 24 6 0.00% 25 5 0.00% 26 5 0.00% 27 4 0.00% 28 10 0.00% 29 8 0.00% 30 8 0.00% 31 7 0.00% 32 6 0.00% 33 9 0.00% 34 8 0.00% 35 11 0.00% 36 8 0.00% 37 18 0.00% 38 13 0.00% 39 20 0.00% 40 19 0.00% 41 20 0.00% 42 24 0.00% 43 20 0.00% 44 20 0.00% 45 27 0.00% 46 27 0.00% 47 50 0.00% 48 46 0.00% 49 53 0.00% 50 51 0.00% 51 66 0.00% 52 72 0.00% 53 77 0.00% 54 86 0.00% 55 98 0.00% 56 105 0.00% 57 147 0.00% 58 152 0.00% 59 176 0.00% 60 224 0.00% 61 248 0.00% 62 295 0.00% 63 344 0.00% 64 358 0.00% 65 440 0.00% 66 448 0.00% 67 476 0.00% 68 599 0.00% 69 718 0.00% 70 774 0.00% 71 909 0.01% 72 1114 0.01% 73 1225 0.01% 74 1415 0.01% 75 1497 0.01% 76 1753 0.01% 77 1814 0.01% 78 2131 0.01% 79 2349 0.01% 80 2801 0.02% 81 3214 0.02% 82 3722 0.02% 83 4337 0.03% 84 5197 0.03% 85 5738 0.04% 86 6135 0.04% 87 6738 0.04% 88 7123 0.05% 89 7541 0.05% 90 8327 0.05% 91 9086 0.06% 92 10275 0.07% 93 11179 0.07% 94 12066 0.08% 95 12791 0.08% 96 13408 0.09% 97 14009 0.09% 98 14835 0.09% 99 15689 0.10% 100 16795 0.11% 101 18089 0.12% 102 19237 0.12% 103 20883 0.13% 104 22794 0.15% 105 24400 0.16% 106 24876 0.16% 107 25816 0.16% 108 26769 0.17% 109 27506 0.18% 110 28995 0.18% 111 30797 0.20% 112 33039 0.21% 113 35594 0.23% 114 37584 0.24% 115 40167 0.26% 116 41492 0.26% 117 42380 0.27% 118 44668 0.28% 119 45294 0.29% 120 47418 0.30% 121 49829 0.32% 122 52646 0.34% 123 56134 0.36% 124 60325 0.38% 125 64217 0.41% 126 67971 0.43% 127 70145 0.45% 128 73177 0.47% 129 77642 0.49% 130 80395 0.51% 131 86434 0.55% 132 92497 0.59% 133 99546 0.63% 134 107498 0.68% 135 117054 0.75% 136 123070 0.78% 137 128635 0.82% 138 139146 0.89% 139 154324 0.98% 140 176294 1.12% 141 171505 1.09% 142 190372 1.21% 143 210449 1.34% 144 246435 1.57% 145 297047 1.89% 146 376217 2.40% 147 499361 3.18% 148 692957 4.42% 149 1213931 7.73% 150 3764095 23.98% 151 5305294 33.80% 15694092 reads passed initial QC criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=2.50 fanout-score-rank=29 prefix-density=0.80 prefix-fanout=2.1 sequence=CATCTCAGACCTCTC criterion=fanout-score sequence-density=0.10 sequence-density-rank=21 fanout-score=36.72 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=10.7 sequence=CCTTCCTTGTCCTGGATCTTGGCCTTCACGTTGTCAATGGT criterion=sequence-density sequence-density=0.98 sequence-density-rank=1 fanout-score=2.28 fanout-score-rank=24 prefix-density=1.00 prefix-fanout=2.2 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.18 sequence-density-rank=15 fanout-score=12.29 fanout-score-rank=1 prefix-density=0.79 prefix-fanout=2.9 sequence=TGCAAGTGCGGATCAAACTG SRR7166139 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 15:57:35 Started mapping on | Feb 14 15:57:40 Finished on | Feb 14 16:00:44 Mapping speed, Million of reads per hour | 307.06 Number of input reads | 15694092 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 14134865 Uniquely mapped reads % | 90.06% Average mapped length | 289.68 Number of splices: Total | 13078026 Number of splices: Annotated (sjdb) | 12828880 Number of splices: GT/AG | 12865759 Number of splices: GC/AG | 166555 Number of splices: AT/AC | 9620 Number of splices: Non-canonical | 36092 Mismatch rate per base, % | 0.46% Deletion rate per base | 0.04% Deletion average length | 2.34 Insertion rate per base | 0.02% Insertion average length | 2.17 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 401678 % of reads mapped to multiple loci | 2.56% Number of reads mapped to too many loci | 30125 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.08% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1170791 1170791 1170791 N_multimapping 401678 401678 401678 N_noFeature 427217 13959561 510835 N_ambiguous 159436 1193 67025 UnstrandedReadsAssigned:13548212 PositiveStrandReadsAssigned:174111 NegativeStrandReadsAssigned:13557005 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=143 echo kmer=139 SRR7166139 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166139-trimmed-pair1.fastq SRR7166139-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,694,092 reads, 13,462,708 reads pseudoaligned [quant] estimated average fragment length: 229.195 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,088 rounds 52401 SRR7166139.ke.tsv 34699 SRR7166139.se.tsv 87100 total ==> SRR7166139.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1789.81 974 32.9233 Potri.005G024800.1.v4.1 1035 806.805 408 30.5943 Potri.004G059700.1.v4.1 961 732.811 27 2.22906 Potri.007G009000.2.v4.1 1416 1187.81 0 0 Potri.003G141000.2.v4.1 2943 2714.81 612 13.6384 Potri.016G087400.1.v4.1 270 85.8198 1328.2 936.32 Potri.015G069301.1.v4.1 564 338.576 0 0 Potri.010G195200.1.v4.1 1773 1544.81 735.915 28.8207 Potri.012G127500.1.v4.1 977 748.811 3227 260.721 ==> SRR7166139.se.tsv <== Potri.001G166300.v4.1 2 Potri.001G448400.v4.1 28 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 612 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 263 SRR7166139 completed mapping pipeline successfully