Starting /dee2/code/volunteer_pipeline.sh SRR7166141 current disk space = 3112621887488 free memory = 1539772828 SRR7166141 SRAfilesize 9b7a778d5794f91c588d57aece0c48f5 SRR7166141.sra SRR7166141.sra file validated SRR7166141 is paired end SRR7166141 is conventional basespace SRR7166141 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166141_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.78925 32.0 28.0 33.0 18.0 34.0 2 32.16475 33.0 31.0 33.0 29.0 34.0 3 32.29475 33.0 33.0 33.0 29.0 34.0 4 32.72 33.0 33.0 34.0 32.0 34.0 5 32.84025 33.0 33.0 34.0 32.0 34.0 6 36.796 38.0 37.0 38.0 35.0 38.0 7 37.19525 38.0 38.0 38.0 36.0 38.0 8 37.47975 38.0 38.0 38.0 37.0 38.0 9 37.57175 38.0 38.0 38.0 38.0 38.0 10-14 37.52395 38.0 38.0 38.0 37.6 38.0 15-19 37.55305 38.0 38.0 38.0 37.4 38.0 20-24 37.5192 38.0 38.0 38.0 37.6 38.0 25-29 37.45505 38.0 38.0 38.0 37.0 38.0 30-34 37.44545 38.0 38.0 38.0 37.0 38.0 35-39 37.3912 38.0 38.0 38.0 37.0 38.0 40-44 37.3273 38.0 38.0 38.0 37.0 38.0 45-49 37.33415 38.0 38.0 38.0 37.0 38.0 50-54 37.1514 38.0 38.0 38.0 36.6 38.0 55-59 36.689550000000004 38.0 38.0 38.0 36.0 38.0 60-64 36.97005 38.0 38.0 38.0 36.0 38.0 65-69 37.111900000000006 38.0 38.0 38.0 36.0 38.0 70-74 37.1169 38.0 38.0 38.0 36.0 38.0 75-79 36.952000000000005 38.0 38.0 38.0 36.0 38.0 80-84 36.734899999999996 38.0 38.0 38.0 34.6 38.0 85-89 36.630849999999995 38.0 38.0 38.0 34.6 38.0 90-94 36.5837 38.0 38.0 38.0 34.0 38.0 95-99 36.4594 38.0 38.0 38.0 34.0 38.0 100-104 36.459950000000006 38.0 38.0 38.0 34.0 38.0 105-109 36.13575 38.0 37.6 38.0 33.2 38.0 110-114 36.15265000000001 38.0 37.4 38.0 33.4 38.0 115-119 35.90695000000001 38.0 37.2 38.0 32.0 38.0 120-124 35.628750000000004 38.0 36.6 38.0 30.8 38.0 125-129 35.5385 38.0 36.6 38.0 30.4 38.0 130-134 35.36130000000001 38.0 36.0 38.0 30.0 38.0 135-139 35.10025 38.0 36.0 38.0 28.8 38.0 140-144 34.89975 38.0 35.6 38.0 28.4 38.0 145-149 34.2406 38.0 35.0 38.0 25.8 38.0 150-151 30.834000000000003 36.5 30.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 0.0 16 0.0 17 4.0 18 2.0 19 1.0 20 3.0 21 6.0 22 1.0 23 5.0 24 11.0 25 14.0 26 20.0 27 21.0 28 21.0 29 33.0 30 45.0 31 43.0 32 82.0 33 120.0 34 190.0 35 268.0 36 641.0 37 2466.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.98348813209495 17.440660474716204 11.55830753353973 32.01754385964912 2 19.75 27.175 36.875 16.2 3 17.875 31.75 25.374999999999996 25.0 4 22.0 36.825 21.025 20.150000000000002 5 20.76038019009505 37.918959479739875 22.736368184092047 18.584292146073036 6 17.175 36.775000000000006 24.6 21.45 7 13.625000000000002 18.625 45.85 21.9 8 18.075 20.150000000000002 28.15 33.625 9 17.7 22.15 30.7 29.45 10-14 19.73 29.37 26.555 24.345 15-19 20.455000000000002 28.939999999999998 27.425 23.18 20-24 20.225 28.54 27.85 23.385 25-29 20.22 28.895 27.939999999999998 22.945 30-34 20.13 28.799999999999997 27.41 23.66 35-39 19.939999999999998 28.68 27.455000000000002 23.925 40-44 20.105 28.825 27.275 23.794999999999998 45-49 20.7 28.689999999999998 27.200000000000003 23.41 50-54 19.9779304810152 28.58504288508803 27.812609720619953 23.62441691327682 55-59 20.66568572733269 28.707696991222285 27.34283829722462 23.283778984220408 60-64 19.92579221821099 28.645206578419575 27.27637384677096 24.152627356598476 65-69 20.41 28.665000000000003 28.075 22.85 70-74 20.419999999999998 27.92 28.000000000000004 23.66 75-79 20.165 28.139999999999997 27.915 23.78 80-84 20.549999999999997 27.794999999999998 28.07 23.585 85-89 20.52 28.294999999999998 27.505000000000003 23.68 90-94 21.01 28.605000000000004 27.134999999999998 23.25 95-99 20.41 28.910000000000004 27.325 23.355 100-104 20.5 28.725 27.529999999999998 23.244999999999997 105-109 20.30897326578723 28.600090284395847 27.44645633746301 23.644480112353918 110-114 20.46 28.675 27.474999999999998 23.39 115-119 21.154999999999998 28.565 26.77 23.51 120-124 20.705000000000002 28.335 27.589999999999996 23.369999999999997 125-129 20.96104805240262 28.641432071603578 27.006350317515874 23.391169558477923 130-134 21.099999999999998 28.449999999999996 27.08 23.369999999999997 135-139 21.096054802740134 28.706435321766087 26.676333816690835 23.52117605880294 140-144 21.21 28.875 26.490000000000002 23.425 145-149 21.21 28.95 26.495 23.345 150-151 20.89066800100075 28.258694020515385 26.55741806354766 24.293219914936202 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 1.0 21 1.5 22 2.0 23 1.0 24 3.0 25 5.5 26 5.5 27 7.5 28 11.5 29 16.0 30 19.5 31 25.0 32 35.5 33 42.5 34 51.5 35 69.0 36 84.5 37 107.0 38 132.5 39 163.0 40 198.5 41 233.5 42 274.0 43 284.5 44 272.5 45 257.5 46 253.5 47 248.5 48 214.0 49 188.0 50 178.0 51 143.0 52 108.0 53 91.5 54 66.0 55 48.5 56 37.5 57 26.0 58 20.0 59 17.5 60 14.0 61 10.0 62 9.0 63 7.0 64 4.5 65 2.0 66 0.5 67 1.5 68 2.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.1 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.315 55-59 1.455 60-64 0.27999999999999997 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.315 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.005 130-134 0.0 135-139 0.005 140-144 0.0 145-149 0.0 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.325 0.0 0.0 0.0 0.0 96-97 0.38749999999999996 0.0 0.0 0.0 0.0 98-99 0.45 0.0 0.0 0.0 0.0 100-101 0.55 0.0 0.0 0.0 0.0 102-103 0.6625 0.0 0.0 0.0 0.0 104-105 0.9 0.0 0.0 0.0 0.0 106-107 1.125 0.0 0.0 0.0 0.0 108-109 1.2625 0.0 0.0 0.0 0.0 110-111 1.4 0.0 0.0 0.0 0.0 112-113 1.725 0.0 0.0 0.0 0.0 114-115 2.125 0.0 0.0 0.0 0.0 116-117 2.3125 0.0 0.0 0.0 0.0 118-119 2.775 0.0 0.0 0.0 0.0 120-121 3.1624999999999996 0.0 0.0 0.0 0.0 122-123 3.4875 0.0 0.0 0.0 0.0 124-125 3.9625000000000004 0.0 0.0 0.0 0.0 126-127 4.375 0.0 0.0 0.0 0.0 128-129 4.7875 0.0 0.0 0.0 0.0 130-131 5.2375 0.0 0.0 0.0 0.0 132-133 5.550000000000001 0.0 0.0 0.0 0.0 134-135 6.1125 0.0 0.0 0.0 0.0 136-137 6.625 0.0 0.0 0.0 0.0 138-139 7.3375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCACCT 10 0.006601011 146.64557 1 CATTGTA 10 0.0068573058 144.8125 4 >>END_MODULE SRR7166141 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166141_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8495 33.0 33.0 34.0 32.0 34.0 2 32.93425 33.0 33.0 34.0 32.0 34.0 3 33.04075 34.0 33.0 34.0 32.0 34.0 4 32.97675 34.0 33.0 34.0 32.0 34.0 5 32.9395 34.0 33.0 34.0 32.0 34.0 6 37.1115 38.0 38.0 38.0 36.0 38.0 7 37.0975 38.0 38.0 38.0 37.0 38.0 8 37.0775 38.0 38.0 38.0 36.0 38.0 9 37.19025 38.0 38.0 38.0 37.0 38.0 10-14 37.064899999999994 38.0 38.0 38.0 36.0 38.0 15-19 37.0635 38.0 38.0 38.0 36.0 38.0 20-24 37.010000000000005 38.0 38.0 38.0 36.0 38.0 25-29 36.938849999999995 38.0 38.0 38.0 36.0 38.0 30-34 36.84515 38.0 38.0 38.0 35.8 38.0 35-39 36.8035 38.0 38.0 38.0 35.8 38.0 40-44 36.7336 38.0 38.0 38.0 35.2 38.0 45-49 36.558299999999996 38.0 38.0 38.0 34.6 38.0 50-54 36.457800000000006 38.0 38.0 38.0 34.2 38.0 55-59 36.34305 38.0 38.0 38.0 34.0 38.0 60-64 36.376450000000006 38.0 38.0 38.0 34.0 38.0 65-69 36.3476 38.0 38.0 38.0 34.0 38.0 70-74 36.30045 38.0 38.0 38.0 34.0 38.0 75-79 36.1177 38.0 38.0 38.0 33.2 38.0 80-84 36.039199999999994 38.0 37.6 38.0 33.0 38.0 85-89 35.892250000000004 38.0 37.0 38.0 32.4 38.0 90-94 35.62535 38.0 37.0 38.0 30.0 38.0 95-99 35.522650000000006 38.0 37.0 38.0 30.0 38.0 100-104 35.158500000000004 38.0 36.4 38.0 28.0 38.0 105-109 35.1347 38.0 36.0 38.0 28.2 38.0 110-114 34.7343 38.0 35.6 38.0 26.6 38.0 115-119 34.511649999999996 38.0 35.0 38.0 25.6 38.0 120-124 34.08715 38.0 34.8 38.0 23.0 38.0 125-129 33.92985 38.0 34.8 38.0 22.2 38.0 130-134 33.4579 38.0 34.4 38.0 19.0 38.0 135-139 32.8407 38.0 34.0 38.0 14.6 38.0 140-144 32.55145 38.0 33.6 38.0 14.2 38.0 145-149 31.07185 37.0 31.4 38.0 6.4 38.0 150-151 26.69025 33.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 0.0 4 1.0 5 3.0 6 2.0 7 1.0 8 2.0 9 0.0 10 3.0 11 3.0 12 3.0 13 4.0 14 3.0 15 4.0 16 4.0 17 6.0 18 7.0 19 11.0 20 15.0 21 12.0 22 19.0 23 26.0 24 11.0 25 37.0 26 29.0 27 36.0 28 36.0 29 53.0 30 63.0 31 73.0 32 110.0 33 134.0 34 197.0 35 367.0 36 753.0 37 1964.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.949999999999996 15.7 12.275 30.075000000000003 2 22.425 25.0 35.425000000000004 17.150000000000002 3 20.8 26.674999999999997 30.675 21.85 4 24.625 35.4 21.224999999999998 18.75 5 24.5 37.125 21.025 17.349999999999998 6 17.09209209209209 37.76276276276276 23.3983983983984 21.746746746746748 7 16.37046307884856 15.46933667083855 46.85857321652065 21.30162703379224 8 20.30037546933667 20.72590738423029 28.410513141426787 30.563204005006256 9 21.126408010012515 23.62953692115144 28.48560700876095 26.758448060075096 10-14 22.818691214728837 28.572143285971585 26.886131679007402 21.723033820292176 15-19 23.480262170410768 27.302746785410513 28.003202081352878 21.213788962825834 20-24 22.451535340379703 28.427591043430343 27.94670139758553 21.17417221860442 25-29 22.89403874067771 28.129536012813457 27.889283747935334 21.0871414985735 30-34 23.283073686319693 28.192155487652155 28.08195161047939 20.442819215548766 35-39 22.773269211501855 27.80783488628394 28.55425308085362 20.864642821360587 40-44 23.051492686836305 27.67982368262873 28.230815467842113 21.037868162692845 45-49 22.963222767812404 27.587934662791863 28.01883956308247 21.430003006313257 50-54 22.98170884490103 27.89275870709095 28.694562766224003 20.430969681784013 55-59 23.163643651668504 27.913618599058022 27.97374486421485 20.948992885058622 60-64 23.18099819603127 27.916416115454002 28.03166967328122 20.870916015233515 65-69 22.816774387494362 27.837065985269803 27.751891377323513 21.59426824991232 70-74 23.18949531398787 27.96571944068561 28.020848995138575 20.82393625018794 75-79 22.746178902530694 27.852668504134304 28.118266098722124 21.282886494612878 80-84 23.17519162366615 28.0396773708732 27.8042182255398 20.980912779920846 85-89 23.544151548561693 28.149744412147943 28.375263105141823 19.93084093414854 90-94 23.15056134723336 27.546110665597435 28.623696872493987 20.67963111467522 95-99 23.47250764372713 28.30935792692096 27.66778607588592 20.550348353465992 100-104 23.719554976445824 28.019444722862584 27.743810764758948 20.517189535932644 105-109 23.453944071364138 28.420366843740602 28.07457151448331 20.051117570411947 110-114 23.633811290484307 28.120926501554194 27.704802968013638 20.540459239947857 115-119 24.24424725522635 28.109490148894572 27.24219180829197 20.404070787587106 120-124 23.56895600260874 27.55731701199017 28.109165705112126 20.76456128028897 125-129 24.106471502330944 28.121710361421627 27.610406536668503 20.161411599578926 130-134 23.892119510727895 28.11810707840385 27.551634249047524 20.438139161820736 135-139 24.289651716361817 28.078175895765472 27.30643948884991 20.325732899022803 140-144 24.468937875751504 27.710420841683366 27.740480961923847 20.080160320641284 145-149 24.779470729751406 28.473336006415394 26.694065757818763 20.053127506014434 150-151 24.824824824824827 27.952952952952952 26.476476476476474 20.745745745745744 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.5 4 0.5 5 0.0 6 0.0 7 0.5 8 1.0 9 1.0 10 0.5 11 0.5 12 0.5 13 0.0 14 1.0 15 1.0 16 0.5 17 0.5 18 1.0 19 1.0 20 1.5 21 2.0 22 1.5 23 2.0 24 2.5 25 3.5 26 3.5 27 4.0 28 10.0 29 14.0 30 17.5 31 21.5 32 28.0 33 35.5 34 45.0 35 57.5 36 76.0 37 104.5 38 141.5 39 171.0 40 187.0 41 200.0 42 240.5 43 278.0 44 286.0 45 289.0 46 269.0 47 246.5 48 235.0 49 208.0 50 170.5 51 143.5 52 114.5 53 91.0 54 70.5 55 53.5 56 42.5 57 31.0 58 22.5 59 15.5 60 13.0 61 13.0 62 9.0 63 6.0 64 5.0 65 2.0 66 0.5 67 0.0 68 0.5 69 1.0 70 1.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.1 7 0.125 8 0.125 9 0.125 10-14 0.06 15-19 0.065 20-24 0.185 25-29 0.105 30-34 0.185 35-39 0.19 40-44 0.18 45-49 0.21 50-54 0.22499999999999998 55-59 0.21 60-64 0.22 65-69 0.20500000000000002 70-74 0.23500000000000001 75-79 0.22499999999999998 80-84 0.19499999999999998 85-89 0.22999999999999998 90-94 0.24 95-99 0.245 100-104 0.22999999999999998 105-109 0.22999999999999998 110-114 0.27 115-119 0.265 120-124 0.335 125-129 0.255 130-134 0.26 135-139 0.22499999999999998 140-144 0.2 145-149 0.24 150-151 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72403411941796 99.375 2 0.2007024586051179 0.4 3 0.07526342197691922 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.325 0.0 0.0 0.0 0.0 96-97 0.38749999999999996 0.0 0.0 0.0 0.0 98-99 0.45 0.0 0.0 0.0 0.0 100-101 0.55 0.0 0.0 0.0 0.0 102-103 0.65 0.0 0.0 0.0 0.0 104-105 0.8875 0.0 0.0 0.0 0.0 106-107 1.125 0.0 0.0 0.0 0.0 108-109 1.2625 0.0 0.0 0.0 0.0 110-111 1.4125 0.0 0.0 0.0 0.0 112-113 1.75 0.0 0.0 0.0 0.0 114-115 2.1625 0.0 0.0 0.0 0.0 116-117 2.375 0.0 0.0 0.0 0.0 118-119 2.8 0.0 0.0 0.0 0.0 120-121 3.1875 0.0 0.0 0.0 0.0 122-123 3.5125 0.0 0.0 0.0 0.0 124-125 4.0 0.0 0.0 0.0 0.0 126-127 4.4125 0.0 0.0 0.0 0.0 128-129 4.8375 0.0 0.0 0.0 0.0 130-131 5.2875 0.0 0.0 0.0 0.0 132-133 5.625 0.0 0.0 0.0 0.0 134-135 6.175000000000001 0.0 0.0 0.0 0.0 136-137 6.65 0.0 0.0 0.0 0.0 138-139 7.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCTTAA 10 0.006830828 145.0 4 AAGCTTA 10 0.006830828 145.0 3 AATTGAG 10 0.006830828 145.0 5 GAATTGA 20 3.5877043E-4 108.75 4 >>END_MODULE Read 1071804 spots for SRR7166141.sra Written 1071804 spots for SRR7166141.sra Read 1071802 spots for SRR7166141.sra Written 1071802 spots for SRR7166141.sra Read 1071802 spots for SRR7166141.sra Written 1071802 spots for SRR7166141.sra Read 1071802 spots for SRR7166141.sra Written 1071802 spots for SRR7166141.sra Read 1071802 spots for SRR7166141.sra Written 1071802 spots for SRR7166141.sra Read 1071802 spots for SRR7166141.sra Written 1071802 spots for SRR7166141.sra Read 1071802 spots for SRR7166141.sra Written 1071802 spots for SRR7166141.sra Read 1071802 spots for SRR7166141.sra Written 1071802 spots for SRR7166141.sra Read 1071802 spots for SRR7166141.sra Written 1071802 spots for SRR7166141.sra Read 1071802 spots for SRR7166141.sra Written 1071802 spots for SRR7166141.sra Read 1071802 spots for SRR7166141.sra Written 1071802 spots for SRR7166141.sra Read 1071802 spots for SRR7166141.sra Written 1071802 spots for SRR7166141.sra Read 1071802 spots for SRR7166141.sra Written 1071802 spots for SRR7166141.sra Read 1071802 spots for SRR7166141.sra Written 1071802 spots for SRR7166141.sra Read 1071802 spots for SRR7166141.sra Written 1071802 spots for SRR7166141.sra Read 1071802 spots for SRR7166141.sra Written 1071802 spots for SRR7166141.sra Read 1071802 spots for SRR7166141.sra Written 1071802 spots for SRR7166141.sra Read 1071802 spots for SRR7166141.sra Written 1071802 spots for SRR7166141.sra Read 1071802 spots for SRR7166141.sra Written 1071802 spots for SRR7166141.sra Read 1071802 spots for SRR7166141.sra Written 1071802 spots for SRR7166141.sra SRR ids: ['SRR7166141.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_n_5764zf SRR7166141.sra spots: 21436042 blocks: [[1, 1071802], [1071803, 2143604], [2143605, 3215406], [3215407, 4287208], [4287209, 5359010], [5359011, 6430812], [6430813, 7502614], [7502615, 8574416], [8574417, 9646218], [9646219, 10718020], [10718021, 11789822], [11789823, 12861624], [12861625, 13933426], [13933427, 15005228], [15005229, 16077030], [16077031, 17148832], [17148833, 18220634], [18220635, 19292436], [19292437, 20364238], [20364239, 21436042]] SRR7166141 file size 7242270 SRR7166141 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166141 SRR7166141_1.fastq SRR7166141_2.fastq Input file: SRR7166141_1.fastq Paired file: SRR7166141_2.fastq trimmed: SRR7166141-trimmed-pair1.fastq, SRR7166141-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 15:47:12 2025 >> started Fri Feb 14 15:47:55 2025 >> done (42.695s) 21436042 read pairs processed; of these: 22395 ( 0.10%) short read pairs filtered out after trimming by size control 11021 ( 0.05%) empty read pairs filtered out after trimming by size control 21402626 (99.84%) read pairs available; of these: 9886272 (46.19%) trimmed read pairs available after processing 11516354 (53.81%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 10 0.00% 20 17 0.00% 21 8 0.00% 22 9 0.00% 23 3 0.00% 24 14 0.00% 25 4 0.00% 26 11 0.00% 27 13 0.00% 28 1 0.00% 29 6 0.00% 30 8 0.00% 31 9 0.00% 32 12 0.00% 33 10 0.00% 34 11 0.00% 35 11 0.00% 36 8 0.00% 37 14 0.00% 38 14 0.00% 39 14 0.00% 40 23 0.00% 41 21 0.00% 42 20 0.00% 43 25 0.00% 44 20 0.00% 45 35 0.00% 46 32 0.00% 47 44 0.00% 48 56 0.00% 49 58 0.00% 50 56 0.00% 51 70 0.00% 52 71 0.00% 53 89 0.00% 54 81 0.00% 55 101 0.00% 56 107 0.00% 57 134 0.00% 58 185 0.00% 59 202 0.00% 60 247 0.00% 61 271 0.00% 62 272 0.00% 63 303 0.00% 64 372 0.00% 65 441 0.00% 66 494 0.00% 67 566 0.00% 68 598 0.00% 69 734 0.00% 70 832 0.00% 71 940 0.00% 72 1094 0.01% 73 1254 0.01% 74 1427 0.01% 75 1567 0.01% 76 1850 0.01% 77 2064 0.01% 78 2216 0.01% 79 2572 0.01% 80 3022 0.01% 81 3297 0.02% 82 3891 0.02% 83 4590 0.02% 84 7003 0.03% 85 6740 0.03% 86 6828 0.03% 87 7390 0.03% 88 8103 0.04% 89 8517 0.04% 90 9489 0.04% 91 10236 0.05% 92 11160 0.05% 93 12242 0.06% 94 13089 0.06% 95 13710 0.06% 96 14784 0.07% 97 15743 0.07% 98 16742 0.08% 99 19459 0.09% 100 19032 0.09% 101 19866 0.09% 102 21836 0.10% 103 23092 0.11% 104 24283 0.11% 105 26002 0.12% 106 26851 0.13% 107 28351 0.13% 108 29801 0.14% 109 31158 0.15% 110 32738 0.15% 111 34536 0.16% 112 36981 0.17% 113 38763 0.18% 114 40898 0.19% 115 42315 0.20% 116 44216 0.21% 117 45653 0.21% 118 48026 0.22% 119 49528 0.23% 120 51024 0.24% 121 53346 0.25% 122 55199 0.26% 123 58579 0.27% 124 61301 0.29% 125 63753 0.30% 126 65870 0.31% 127 67868 0.32% 128 69935 0.33% 129 72534 0.34% 130 75714 0.35% 131 78541 0.37% 132 82795 0.39% 133 87005 0.41% 134 91028 0.43% 135 95254 0.45% 136 99767 0.47% 137 104885 0.49% 138 110848 0.52% 139 117390 0.55% 140 124917 0.58% 141 135043 0.63% 142 147848 0.69% 143 163815 0.77% 144 186839 0.87% 145 216678 1.01% 146 263684 1.23% 147 347577 1.62% 148 505832 2.36% 149 937979 4.38% 150 4411705 20.61% 151 11516354 53.81% 21402626 reads passed initial QC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=29 prefix-density=0.32 prefix-fanout=2.1 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=38.10 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=6.3 sequence=GATATCATAATGACTGAAAAACATCTTACATTGCTTAATCAAACACACGCTAGCTCGCTTATAAGCGCCCCTAGTTAAGGGAAACCTTTATTTAATAAAGTCACAAACAAAAGCGGGCTTAGCTAAAATCAATTCTGCTCCATCGTAATTAAGAGACCATGAGCACATCAACAAGCAACTTTGTCTCGCTAATTAGTAGTTATAATTAGCAGTAGTACTTGGCCTTGGTTCAAAATCATCCGAAGACGATTTTTTTCCTTTAAGCCCGACACCATCATCATAAACTGATATGTTAGGTCCTGGTTCGAAGTCCTCCTGAAAAGATTTTTCTCCTTTAAGAGTAGCGTCGTCGTGGTAAACGGACACATTAGGCCTCGGCTCAACATCTTCAGCGAAGGATCTCTCTCCTTTAACGTCACCATCATTGTAAAGGAACAACTGAGAGTTTGGGTGGAAATGTTTCGAAAAGGACTTATCTTTTGCTGGTTTTATACCATTGTCATAAGATGTA criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=2.34 fanout-score-rank=24 prefix-density=0.40 prefix-fanout=2.2 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.14 sequence-density-rank=18 fanout-score=21.64 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=8.7 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7166141 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 15:48:41 Started mapping on | Feb 14 15:48:41 Finished on | Feb 14 15:51:18 Mapping speed, Million of reads per hour | 490.76 Number of input reads | 21402626 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 19985266 Uniquely mapped reads % | 93.38% Average mapped length | 293.04 Number of splices: Total | 19114638 Number of splices: Annotated (sjdb) | 18757032 Number of splices: GT/AG | 18806323 Number of splices: GC/AG | 240915 Number of splices: AT/AC | 14601 Number of splices: Non-canonical | 52799 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.04% Deletion average length | 2.31 Insertion rate per base | 0.02% Insertion average length | 2.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 563710 % of reads mapped to multiple loci | 2.63% Number of reads mapped to too many loci | 56383 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.65% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 873571 873571 873571 N_multimapping 563710 563710 563710 N_noFeature 639648 19706525 820516 N_ambiguous 198095 1719 98801 UnstrandedReadsAssigned:19147523 PositiveStrandReadsAssigned:277022 NegativeStrandReadsAssigned:19065949 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7166141 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166141-trimmed-pair1.fastq SRR7166141-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,402,626 reads, 18,991,276 reads pseudoaligned [quant] estimated average fragment length: 235.94 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,148 rounds 52401 SRR7166141.ke.tsv 34699 SRR7166141.se.tsv 87100 total ==> SRR7166141.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1783.06 2031 60.3496 Potri.005G024800.1.v4.1 1035 800.06 389 25.7607 Potri.004G059700.1.v4.1 961 726.097 42 3.06468 Potri.007G009000.2.v4.1 1416 1181.06 0 0 Potri.003G141000.2.v4.1 2943 2708.06 723.177 14.1487 Potri.016G087400.1.v4.1 270 85.1498 1157 719.913 Potri.015G069301.1.v4.1 564 335.524 0 0 Potri.010G195200.1.v4.1 1773 1538.06 505.895 17.4268 Potri.012G127500.1.v4.1 977 742.081 9514 679.269 ==> SRR7166141.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 48 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 609 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 348 SRR7166141 completed mapping pipeline successfully