Starting /dee2/code/volunteer_pipeline.sh SRR7166142 current disk space = 3112238436352 free memory = 1574787432 SRR7166142 SRAfilesize 8126e4d6b8b0c77ebbf7838819d6a3cd SRR7166142.sra SRR7166142.sra file validated SRR7166142 is paired end SRR7166142 is conventional basespace SRR7166142 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166142_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.197 33.0 25.0 33.0 18.0 34.0 2 30.6785 31.0 29.0 33.0 27.0 34.0 3 32.292 33.0 31.0 33.0 30.0 34.0 4 32.021 33.0 31.0 33.0 31.0 34.0 5 32.00225 33.0 32.0 33.0 31.0 33.0 6 36.192 38.0 36.0 38.0 33.0 38.0 7 36.92675 38.0 37.0 38.0 35.0 38.0 8 37.1645 38.0 38.0 38.0 36.0 38.0 9 37.549 38.0 38.0 38.0 37.0 38.0 10-14 37.53255 38.0 38.0 38.0 37.2 38.0 15-19 37.5775 38.0 38.0 38.0 37.6 38.0 20-24 37.61815 38.0 38.0 38.0 38.0 38.0 25-29 37.5932 38.0 38.0 38.0 38.0 38.0 30-34 37.55755 38.0 38.0 38.0 38.0 38.0 35-39 37.5297 38.0 38.0 38.0 37.4 38.0 40-44 37.49375 38.0 38.0 38.0 37.2 38.0 45-49 37.48065 38.0 38.0 38.0 37.2 38.0 50-54 37.1796 38.0 38.0 38.0 36.8 38.0 55-59 36.86435 38.0 38.0 38.0 36.2 38.0 60-64 37.05805 38.0 38.0 38.0 36.2 38.0 65-69 37.2495 38.0 38.0 38.0 36.2 38.0 70-74 37.1348 38.0 38.0 38.0 36.2 38.0 75-79 37.04875 38.0 38.0 38.0 36.0 38.0 80-84 36.92525 38.0 38.0 38.0 35.8 38.0 85-89 36.905899999999995 38.0 38.0 38.0 35.8 38.0 90-94 36.7898 38.0 38.0 38.0 35.2 38.0 95-99 36.70864999999999 38.0 38.0 38.0 35.0 38.0 100-104 36.5407 38.0 38.0 38.0 34.4 38.0 105-109 36.247749999999996 38.0 37.8 38.0 33.8 38.0 110-114 36.33215 38.0 38.0 38.0 34.0 38.0 115-119 36.1764 38.0 37.0 38.0 33.8 38.0 120-124 35.9323 38.0 37.0 38.0 33.0 38.0 125-129 35.77305 38.0 36.8 38.0 32.2 38.0 130-134 35.61525 38.0 36.0 38.0 31.4 38.0 135-139 35.27355 38.0 36.0 38.0 29.8 38.0 140-144 35.01655 38.0 35.8 38.0 28.8 38.0 145-149 34.607749999999996 38.0 35.2 38.0 27.8 38.0 150-151 31.31225 36.5 31.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 1.0 13 0.0 14 2.0 15 0.0 16 2.0 17 1.0 18 3.0 19 2.0 20 0.0 21 2.0 22 3.0 23 8.0 24 4.0 25 5.0 26 13.0 27 15.0 28 22.0 29 31.0 30 36.0 31 49.0 32 60.0 33 106.0 34 143.0 35 267.0 36 722.0 37 2502.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.80653329956951 21.245885034185868 13.066599139022536 29.880982527222084 2 18.675 26.650000000000002 35.0 19.675 3 16.925 33.35 28.075 21.65 4 19.475 38.45 22.725 19.35 5 20.806209313970957 38.83324987481222 23.059589384076116 17.300951427140713 6 16.575 37.85 24.4 21.175 7 12.575 21.5 45.074999999999996 20.849999999999998 8 17.474999999999998 22.5 27.35 32.675 9 17.25 23.375 30.5 28.875 10-14 19.27 30.855 26.445 23.43 15-19 19.505 29.265 27.750000000000004 23.48 20-24 19.235 30.220000000000002 27.165 23.380000000000003 25-29 19.6 30.240000000000002 27.200000000000003 22.96 30-34 19.39 30.020000000000003 27.675 22.915 35-39 19.830000000000002 29.95 27.334999999999997 22.884999999999998 40-44 19.939999999999998 29.26 27.779999999999998 23.02 45-49 19.869999999999997 29.195 27.595 23.34 50-54 19.66520886744081 29.88488413009601 27.547378474840396 22.90252852762278 55-59 19.951424378889847 29.87906694327784 27.349086677123918 22.820422000708398 60-64 19.69666532744074 28.776617115307353 27.60646846122941 23.9202490960225 65-69 19.830000000000002 29.244999999999997 27.395000000000003 23.53 70-74 20.19504876219055 28.56714178544636 28.24206051512878 22.99574893723431 75-79 19.650000000000002 29.49 27.529999999999998 23.330000000000002 80-84 20.13 29.020000000000003 27.334999999999997 23.515 85-89 19.814999999999998 29.904999999999998 26.93 23.35 90-94 20.01 29.185 27.295 23.51 95-99 19.685 28.87 27.894999999999996 23.549999999999997 100-104 20.80997196635963 29.074889867841406 27.6031237484982 22.51201441730076 105-109 20.579214641258986 29.021066921413848 27.477500125697624 22.922218311629543 110-114 20.794999999999998 28.939999999999998 27.515 22.75 115-119 20.071074628359778 29.375844636868713 27.54392111717303 23.009159617598478 120-124 20.669999999999998 28.87 27.35 23.11 125-129 20.819778789850357 29.04759521545468 26.8254842099995 23.30714178469546 130-134 21.21 28.82 26.740000000000002 23.23 135-139 20.495 29.360000000000003 26.715 23.43 140-144 20.62 29.145 26.06 24.175 145-149 20.95 29.265 25.874999999999996 23.91 150-151 20.391026444416593 28.474746208798095 26.632410076450686 24.501817270334627 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.5 19 1.5 20 0.5 21 1.0 22 1.0 23 2.5 24 3.0 25 2.0 26 7.0 27 12.5 28 14.5 29 16.0 30 20.0 31 34.0 32 50.0 33 63.5 34 76.0 35 95.0 36 120.5 37 143.0 38 181.0 39 199.0 40 201.0 41 225.0 42 254.5 43 264.0 44 260.5 45 263.5 46 245.5 47 219.5 48 188.5 49 171.5 50 160.5 51 129.5 52 99.5 53 72.5 54 54.0 55 38.0 56 27.5 57 23.5 58 16.5 59 11.0 60 9.0 61 6.0 62 4.0 63 2.5 64 1.5 65 1.0 66 0.5 67 2.0 68 1.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.275 2 0.0 3 0.0 4 0.0 5 0.15 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.5349999999999999 55-59 1.185 60-64 0.44 65-69 0.0 70-74 0.025 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.12 105-109 0.555 110-114 0.0 115-119 0.105 120-124 0.0 125-129 0.095 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.2625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64850615114236 99.225 2 0.2761737383881496 0.5499999999999999 3 0.07532011046949535 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.55 0.0 0.0 0.0 0.0 96-97 0.65 0.0 0.0 0.0 0.0 98-99 0.7625 0.0 0.0 0.0 0.0 100-101 0.9375 0.0 0.0 0.0 0.0 102-103 1.2125 0.0 0.0 0.0 0.0 104-105 1.4875 0.0 0.0 0.0 0.0 106-107 1.8625 0.0 0.0 0.0 0.0 108-109 2.0625 0.0 0.0 0.0 0.0 110-111 2.375 0.0 0.0 0.0 0.0 112-113 2.725 0.0 0.0 0.0 0.0 114-115 3.2125 0.0 0.0 0.0 0.0 116-117 3.5875 0.0 0.0 0.0 0.0 118-119 4.1125 0.0 0.0 0.0 0.0 120-121 4.6625 0.0 0.0 0.0 0.0 122-123 5.175 0.0 0.0 0.0 0.0 124-125 5.95 0.0 0.0 0.0 0.0 126-127 6.425000000000001 0.0 0.0 0.0 0.0 128-129 7.05 0.0 0.0 0.0 0.0 130-131 7.7125 0.0 0.0 0.0 0.0 132-133 8.35 0.0 0.0 0.0 0.0 134-135 8.8875 0.0 0.0 0.0 0.0 136-137 9.4625 0.0 0.0 0.0 0.0 138-139 10.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCAGTG 10 0.006843168 144.91249 7 GATCATC 10 0.006843168 144.91249 1 >>END_MODULE SRR7166142 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166142_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.69325 33.0 33.0 34.0 32.0 34.0 2 32.8725 33.0 33.0 34.0 32.0 34.0 3 32.90875 33.0 33.0 34.0 32.0 34.0 4 32.88325 33.0 33.0 34.0 32.0 34.0 5 32.916 33.0 33.0 34.0 32.0 34.0 6 37.1575 38.0 38.0 38.0 36.0 38.0 7 37.15375 38.0 38.0 38.0 36.0 38.0 8 37.18125 38.0 38.0 38.0 36.0 38.0 9 37.0765 38.0 38.0 38.0 36.0 38.0 10-14 37.0746 38.0 38.0 38.0 36.0 38.0 15-19 37.05365 38.0 38.0 38.0 36.0 38.0 20-24 37.0206 38.0 38.0 38.0 36.0 38.0 25-29 36.90605 38.0 38.0 38.0 36.0 38.0 30-34 36.86735 38.0 38.0 38.0 35.8 38.0 35-39 36.76805 38.0 38.0 38.0 35.4 38.0 40-44 36.7034 38.0 38.0 38.0 35.0 38.0 45-49 36.559250000000006 38.0 38.0 38.0 34.2 38.0 50-54 36.3546 38.0 37.8 38.0 34.0 38.0 55-59 36.23955 38.0 37.4 38.0 33.2 38.0 60-64 36.2399 38.0 37.2 38.0 33.4 38.0 65-69 36.10705 38.0 37.0 38.0 33.0 38.0 70-74 35.94835 38.0 37.0 38.0 32.4 38.0 75-79 35.748000000000005 38.0 37.0 38.0 31.0 38.0 80-84 35.5972 38.0 37.0 38.0 29.4 38.0 85-89 35.390350000000005 38.0 36.0 38.0 29.0 38.0 90-94 35.0916 38.0 36.0 38.0 28.6 38.0 95-99 34.8675 38.0 35.8 38.0 27.2 38.0 100-104 34.66975 38.0 35.0 38.0 26.6 38.0 105-109 34.4332 38.0 35.0 38.0 25.4 38.0 110-114 33.849199999999996 38.0 34.2 38.0 21.4 38.0 115-119 33.3663 38.0 34.0 38.0 15.0 38.0 120-124 32.95385 37.6 33.0 38.0 15.0 38.0 125-129 32.5687 37.2 32.6 38.0 15.0 38.0 130-134 31.9818 36.4 31.0 38.0 14.6 38.0 135-139 31.1741 36.2 29.2 38.0 13.8 38.0 140-144 29.93145 35.2 26.2 38.0 10.8 38.0 145-149 28.18275 34.6 20.6 38.0 2.0 38.0 150-151 23.296875 30.5 2.0 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 4.0 4 1.0 5 0.0 6 1.0 7 2.0 8 1.0 9 2.0 10 0.0 11 1.0 12 6.0 13 2.0 14 1.0 15 3.0 16 2.0 17 6.0 18 7.0 19 15.0 20 10.0 21 16.0 22 19.0 23 22.0 24 21.0 25 25.0 26 29.0 27 50.0 28 52.0 29 77.0 30 84.0 31 138.0 32 158.0 33 239.0 34 352.0 35 556.0 36 951.0 37 1140.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.585396349087276 15.328832208052013 15.528882220555138 27.556889222305575 2 24.875 22.575 35.725 16.825000000000003 3 20.424999999999997 26.75 32.6 20.225 4 24.025 34.875 21.9 19.2 5 23.080770192548137 38.65966491622906 21.905476369092273 16.35408852213053 6 17.299999999999997 39.225 24.075 19.400000000000002 7 17.175 15.725 45.300000000000004 21.8 8 19.400000000000002 22.650000000000002 28.349999999999998 29.599999999999998 9 22.2 25.224999999999998 26.174999999999997 26.400000000000002 10-14 22.84 29.205 26.99 20.965 15-19 23.13 27.685 28.494999999999997 20.69 20-24 23.07 28.165000000000003 28.7 20.064999999999998 25-29 22.695 28.215 28.435 20.655 30-34 22.795 27.74 28.655 20.810000000000002 35-39 22.884999999999998 28.04 28.599999999999998 20.474999999999998 40-44 23.29 28.235 28.725 19.75 45-49 22.865 28.15 28.634999999999998 20.349999999999998 50-54 23.265 27.839999999999996 28.685 20.21 55-59 23.765 27.450000000000003 28.754999999999995 20.03 60-64 23.04 28.549999999999997 28.249999999999996 20.16 65-69 23.385 27.97 28.055000000000003 20.59 70-74 23.125 27.639999999999997 28.76 20.474999999999998 75-79 23.61 27.52 28.82 20.05 80-84 23.435 28.16 27.87 20.535 85-89 23.400000000000002 27.87 28.285 20.445 90-94 23.080000000000002 28.15 28.38 20.39 95-99 23.380000000000003 27.834999999999997 28.68 20.105 100-104 23.59 27.355 29.085 19.97 105-109 23.255 28.005000000000003 28.435 20.305 110-114 23.635 28.565 28.134999999999998 19.665 115-119 24.224999999999998 27.57 28.17 20.035 120-124 23.875 27.589999999999996 28.395 20.14 125-129 23.830000000000002 27.98 27.975 20.215 130-134 24.73 28.110000000000003 28.189999999999998 18.970000000000002 135-139 24.755 28.065 27.900000000000002 19.28 140-144 25.205 27.68 27.655 19.46 145-149 25.505 28.17 27.08 19.245 150-151 25.856892669502123 26.882661996497376 27.88341255941956 19.377032774580936 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.5 17 0.5 18 0.5 19 0.5 20 0.5 21 1.0 22 1.0 23 1.0 24 2.0 25 2.0 26 3.5 27 6.0 28 9.5 29 13.5 30 21.0 31 24.5 32 29.5 33 43.5 34 57.5 35 79.0 36 97.5 37 108.0 38 158.0 39 187.5 40 188.0 41 229.0 42 253.5 43 274.5 44 284.0 45 277.0 46 269.0 47 243.0 48 218.0 49 190.0 50 153.0 51 122.0 52 109.0 53 86.0 54 66.0 55 54.0 56 34.5 57 27.0 58 23.5 59 14.5 60 10.5 61 8.0 62 2.5 63 2.5 64 4.0 65 3.0 66 1.0 67 1.0 68 1.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39561823218332 98.675 2 0.503651473180559 1.0 3 0.07554772097708386 0.22499999999999998 4 0.02518257365902795 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0125 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0125 0.0 0.0 0.025 0.0 72-73 0.025 0.0 0.0 0.025 0.0 74-75 0.075 0.0 0.0 0.025 0.0 76-77 0.0875 0.0 0.0 0.025 0.0 78-79 0.125 0.0 0.0 0.025 0.0 80-81 0.125 0.0 0.0 0.025 0.0 82-83 0.15 0.0 0.0 0.025 0.0 84-85 0.16249999999999998 0.0 0.0 0.025 0.0 86-87 0.175 0.0 0.0 0.025 0.0 88-89 0.225 0.0 0.0 0.025 0.0 90-91 0.30000000000000004 0.0 0.0 0.025 0.0 92-93 0.38749999999999996 0.0 0.0 0.025 0.0 94-95 0.475 0.0 0.0 0.025 0.0 96-97 0.575 0.0 0.0 0.025 0.0 98-99 0.6875 0.0 0.0 0.025 0.0 100-101 0.8625 0.0 0.0 0.025 0.0 102-103 1.15 0.0 0.0 0.025 0.0 104-105 1.4375 0.0 0.0 0.025 0.0 106-107 1.7625 0.0 0.0 0.025 0.0 108-109 1.9625 0.0 0.0 0.025 0.0 110-111 2.2625 0.0 0.0 0.025 0.0 112-113 2.575 0.0 0.0 0.025 0.0 114-115 3.05 0.0 0.0 0.025 0.0 116-117 3.4125 0.0 0.0 0.025 0.0 118-119 3.9625000000000004 0.0 0.0 0.025 0.0 120-121 4.475 0.0 0.0 0.025 0.0 122-123 4.949999999999999 0.0 0.0 0.025 0.0 124-125 5.675 0.0 0.0 0.025 0.0 126-127 6.125 0.0 0.0 0.025 0.0 128-129 6.6875 0.0 0.0 0.025 0.0 130-131 7.3125 0.0 0.0 0.025 0.0 132-133 7.949999999999999 0.0 0.0 0.025 0.0 134-135 8.412500000000001 0.0 0.0 0.025 0.0 136-137 8.925 0.0 0.0 0.025 0.0 138-139 9.725 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GACATCC 10 0.006830828 145.0 3 CACCACC 10 0.006830828 145.0 6 >>END_MODULE Read 672344 spots for SRR7166142.sra Written 672344 spots for SRR7166142.sra Read 672344 spots for SRR7166142.sra Written 672344 spots for SRR7166142.sra Read 672344 spots for SRR7166142.sra Written 672344 spots for SRR7166142.sra Read 672344 spots for SRR7166142.sra Written 672344 spots for SRR7166142.sra Read 672344 spots for SRR7166142.sra Written 672344 spots for SRR7166142.sra Read 672344 spots for SRR7166142.sra Written 672344 spots for SRR7166142.sra Read 672344 spots for SRR7166142.sra Written 672344 spots for SRR7166142.sra Read 672344 spots for SRR7166142.sra Written 672344 spots for SRR7166142.sra Read 672344 spots for SRR7166142.sra Written 672344 spots for SRR7166142.sra Read 672344 spots for SRR7166142.sra Written 672344 spots for SRR7166142.sra Read 672344 spots for SRR7166142.sra Written 672344 spots for SRR7166142.sra Read 672344 spots for SRR7166142.sra Written 672344 spots for SRR7166142.sra Read 672344 spots for SRR7166142.sra Written 672344 spots for SRR7166142.sra Read 672344 spots for SRR7166142.sra Written 672344 spots for SRR7166142.sra Read 672344 spots for SRR7166142.sra Written 672344 spots for SRR7166142.sra Read 672344 spots for SRR7166142.sra Written 672344 spots for SRR7166142.sra Read 672344 spots for SRR7166142.sra Written 672344 spots for SRR7166142.sra Read 672350 spots for SRR7166142.sra Written 672350 spots for SRR7166142.sra Read 672344 spots for SRR7166142.sra Written 672344 spots for SRR7166142.sra Read 672344 spots for SRR7166142.sra Written 672344 spots for SRR7166142.sra SRR ids: ['SRR7166142.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7zb2_pvr SRR7166142.sra spots: 13446886 blocks: [[1, 672344], [672345, 1344688], [1344689, 2017032], [2017033, 2689376], [2689377, 3361720], [3361721, 4034064], [4034065, 4706408], [4706409, 5378752], [5378753, 6051096], [6051097, 6723440], [6723441, 7395784], [7395785, 8068128], [8068129, 8740472], [8740473, 9412816], [9412817, 10085160], [10085161, 10757504], [10757505, 11429848], [11429849, 12102192], [12102193, 12774536], [12774537, 13446886]] SRR7166142 file size 4535008 SRR7166142 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166142 SRR7166142_1.fastq SRR7166142_2.fastq Input file: SRR7166142_1.fastq Paired file: SRR7166142_2.fastq trimmed: SRR7166142-trimmed-pair1.fastq, SRR7166142-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 16:17:04 2025 >> started Fri Feb 14 16:17:18 2025 >> done (13.878s) 13446886 read pairs processed; of these: 9396 ( 0.07%) short read pairs filtered out after trimming by size control 8457 ( 0.06%) empty read pairs filtered out after trimming by size control 13429033 (99.87%) read pairs available; of these: 6157651 (45.85%) trimmed read pairs available after processing 7271382 (54.15%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 3 0.00% 20 5 0.00% 21 3 0.00% 22 5 0.00% 23 9 0.00% 24 5 0.00% 25 6 0.00% 26 7 0.00% 27 6 0.00% 28 3 0.00% 29 8 0.00% 30 1 0.00% 31 6 0.00% 32 5 0.00% 33 8 0.00% 34 7 0.00% 35 9 0.00% 36 5 0.00% 37 5 0.00% 38 7 0.00% 39 12 0.00% 40 20 0.00% 41 20 0.00% 42 14 0.00% 43 13 0.00% 44 18 0.00% 45 19 0.00% 46 18 0.00% 47 26 0.00% 48 32 0.00% 49 43 0.00% 50 43 0.00% 51 47 0.00% 52 48 0.00% 53 71 0.00% 54 66 0.00% 55 80 0.00% 56 108 0.00% 57 130 0.00% 58 138 0.00% 59 143 0.00% 60 170 0.00% 61 215 0.00% 62 245 0.00% 63 272 0.00% 64 277 0.00% 65 284 0.00% 66 350 0.00% 67 392 0.00% 68 440 0.00% 69 512 0.00% 70 643 0.00% 71 715 0.01% 72 845 0.01% 73 1041 0.01% 74 1219 0.01% 75 1273 0.01% 76 1461 0.01% 77 1507 0.01% 78 1768 0.01% 79 1886 0.01% 80 2219 0.02% 81 2600 0.02% 82 3100 0.02% 83 3564 0.03% 84 4159 0.03% 85 4837 0.04% 86 5199 0.04% 87 5804 0.04% 88 6094 0.05% 89 6519 0.05% 90 7120 0.05% 91 7996 0.06% 92 8828 0.07% 93 9558 0.07% 94 10644 0.08% 95 11178 0.08% 96 11566 0.09% 97 12446 0.09% 98 13152 0.10% 99 13988 0.10% 100 14104 0.11% 101 15578 0.12% 102 16884 0.13% 103 18366 0.14% 104 19181 0.14% 105 20591 0.15% 106 21171 0.16% 107 21492 0.16% 108 22294 0.17% 109 23347 0.17% 110 24379 0.18% 111 25610 0.19% 112 27398 0.20% 113 29180 0.22% 114 30932 0.23% 115 32485 0.24% 116 33358 0.25% 117 33878 0.25% 118 34861 0.26% 119 35453 0.26% 120 36599 0.27% 121 37521 0.28% 122 39585 0.29% 123 41558 0.31% 124 43684 0.33% 125 45518 0.34% 126 47082 0.35% 127 48164 0.36% 128 48643 0.36% 129 49917 0.37% 130 51853 0.39% 131 53657 0.40% 132 56382 0.42% 133 58558 0.44% 134 61797 0.46% 135 64659 0.48% 136 68056 0.51% 137 71015 0.53% 138 73257 0.55% 139 77372 0.58% 140 81378 0.61% 141 87107 0.65% 142 94802 0.71% 143 103641 0.77% 144 116077 0.86% 145 135059 1.01% 146 163583 1.22% 147 208316 1.55% 148 300191 2.24% 149 545274 4.06% 150 2579490 19.21% 151 7271382 54.15% 13429033 reads passed initial QC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=23 prefix-density=0.59 prefix-fanout=2.1 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=142.09 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=13.3 sequence=CATCAATGGCACTCTCTCACAGCCAATAACTTCAACAACTTCCCTATCTTTAATCCTCTCACTCCACAAATTCATAAGCTTCACCATTTTACTTCACCAATTCCTTAGAGATGTAATAGCCCATAACAATAGGAAATATCAGAAATCCAATAAGAATCAGCAATTCAGGAAGAAATATGACAAGGAGTAGTAGTGTGGATGTTGTTGTTAGACACTTCTTTTTGTCTTTAAATATAAGGCGTGGTAGAATTACTGGCACTCCAATGATTCCATATAACGGCCATAATGGAGCTATAGAATACAACACCAACGTCGCAAAAAACCAGCAAAAATTCTTAACATTATTTTTAGAAATCCCATACTGCCACCGAATATTCAGTCCTTTAAGAAATCGAACAGCATACCCAACATAGTAAAAACCATCAATAATGCAAATACCGTTACCACAAGTGCAAATAC criterion=sequence-density sequence-density=0.77 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=26 prefix-density=0.79 prefix-fanout=2.1 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=116.55 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=10.5 sequence=CTTCCATTTCCGCCCAAGCTGCTCACAGTATACGGGCGTCGGCATCCAGACCGTCGGCTGATCGTGGTTTTACTAGGCTAGACTAGCGTACGAGCACTATGGTCAGTAATTCCTGGAGGAATAGGTACCAAGAAAAAAACGAACCTTTGGGTTCCAGAGCTGTACGGTCGCACTGAACTCGGATAGGTCTCAGAAAAACGAAATATAGGCTTACGGTAGGTCCGAATGGCACAAAGCTTGTTCCGTTAGCTGGCATAAGATTCCATGCCTAGATGTGATACACGTTTCTGGAAACTGCCTCGTCATGCGACTGTTCCCCGGGGTCAGGGCCGCTGGTATTTGCTGT SRR7166142 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 16:18:51 Started mapping on | Feb 14 16:18:51 Finished on | Feb 14 16:20:52 Mapping speed, Million of reads per hour | 399.54 Number of input reads | 13429033 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 12476970 Uniquely mapped reads % | 92.91% Average mapped length | 291.92 Number of splices: Total | 12011735 Number of splices: Annotated (sjdb) | 11758943 Number of splices: GT/AG | 11808892 Number of splices: GC/AG | 155753 Number of splices: AT/AC | 9679 Number of splices: Non-canonical | 37411 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.04% Deletion average length | 2.33 Insertion rate per base | 0.02% Insertion average length | 2.17 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 355700 % of reads mapped to multiple loci | 2.65% Number of reads mapped to too many loci | 33625 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.12% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 606131 606131 606131 N_multimapping 355700 355700 355700 N_noFeature 432060 12324635 516511 N_ambiguous 130786 1107 62227 UnstrandedReadsAssigned:11914124 PositiveStrandReadsAssigned:151228 NegativeStrandReadsAssigned:11898232 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7166142 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166142-trimmed-pair1.fastq SRR7166142-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,429,033 reads, 11,832,127 reads pseudoaligned [quant] estimated average fragment length: 227.015 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,103 rounds 52401 SRR7166142.ke.tsv 34699 SRR7166142.se.tsv 87100 total ==> SRR7166142.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1791.98 1269 51.7005 Potri.005G024800.1.v4.1 1035 808.985 423 38.174 Potri.004G059700.1.v4.1 961 735 48 4.76784 Potri.007G009000.2.v4.1 1416 1189.98 0 0 Potri.003G141000.2.v4.1 2943 2716.98 469.198 12.6077 Potri.016G087400.1.v4.1 270 89.0217 986 808.627 Potri.015G069301.1.v4.1 564 342.341 0 0 Potri.010G195200.1.v4.1 1773 1546.98 571 26.9474 Potri.012G127500.1.v4.1 977 751 3774 366.885 ==> SRR7166142.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 29 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 550 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 232 SRR7166142 completed mapping pipeline successfully