Starting /dee2/code/volunteer_pipeline.sh SRR7166143 current disk space = 3112672825344 free memory = 1448343144 SRR7166143 SRAfilesize 7d894763cc78cef086564f19f43759b9 SRR7166143.sra SRR7166143.sra file validated SRR7166143 is paired end SRR7166143 is conventional basespace SRR7166143 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166143_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.6445 28.0 18.0 32.0 18.0 33.0 2 31.4945 32.0 32.0 33.0 27.0 33.0 3 31.96475 33.0 31.0 33.0 29.0 33.0 4 32.344 33.0 33.0 33.0 31.0 34.0 5 32.91975 33.0 33.0 34.0 32.0 34.0 6 37.0885 38.0 37.0 38.0 36.0 38.0 7 37.3815 38.0 38.0 38.0 37.0 38.0 8 37.53875 38.0 38.0 38.0 37.0 38.0 9 37.5245 38.0 38.0 38.0 37.0 38.0 10-14 37.4838 38.0 38.0 38.0 37.2 38.0 15-19 37.45545 38.0 38.0 38.0 37.0 38.0 20-24 37.4528 38.0 38.0 38.0 37.0 38.0 25-29 37.400000000000006 38.0 38.0 38.0 37.0 38.0 30-34 37.367450000000005 38.0 38.0 38.0 37.0 38.0 35-39 37.327749999999995 38.0 38.0 38.0 37.0 38.0 40-44 37.3277 38.0 38.0 38.0 37.0 38.0 45-49 37.316250000000004 38.0 38.0 38.0 37.0 38.0 50-54 37.10039999999999 38.0 38.0 38.0 36.6 38.0 55-59 36.5634 38.0 38.0 38.0 35.8 38.0 60-64 36.81705000000001 38.0 38.0 38.0 35.8 38.0 65-69 36.9828 38.0 38.0 38.0 36.0 38.0 70-74 36.954950000000004 38.0 38.0 38.0 36.0 38.0 75-79 36.8806 38.0 38.0 38.0 35.6 38.0 80-84 36.80315 38.0 38.0 38.0 35.4 38.0 85-89 36.642250000000004 38.0 38.0 38.0 34.8 38.0 90-94 36.493849999999995 38.0 38.0 38.0 34.0 38.0 95-99 36.46575 38.0 38.0 38.0 34.0 38.0 100-104 36.429899999999996 38.0 38.0 38.0 34.0 38.0 105-109 36.0965 38.0 38.0 38.0 34.0 38.0 110-114 36.09615 38.0 37.8 38.0 33.2 38.0 115-119 35.88305 38.0 37.0 38.0 32.6 38.0 120-124 35.702799999999996 38.0 37.0 38.0 31.4 38.0 125-129 35.50625 38.0 36.4 38.0 31.2 38.0 130-134 35.309400000000004 38.0 36.0 38.0 30.0 38.0 135-139 35.120850000000004 38.0 36.0 38.0 28.2 38.0 140-144 34.772999999999996 38.0 35.8 38.0 27.8 38.0 145-149 34.431850000000004 38.0 35.4 38.0 26.8 38.0 150-151 31.23075 36.5 31.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 1.0 7 0.0 8 0.0 9 0.0 10 2.0 11 0.0 12 1.0 13 1.0 14 3.0 15 2.0 16 1.0 17 2.0 18 4.0 19 5.0 20 5.0 21 6.0 22 5.0 23 7.0 24 7.0 25 7.0 26 16.0 27 19.0 28 28.0 29 51.0 30 35.0 31 65.0 32 77.0 33 98.0 34 158.0 35 270.0 36 587.0 37 2536.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.19979402677652 17.147270854788875 11.946446961894953 34.70648815653965 2 19.6 24.175 36.775000000000006 19.45 3 17.724999999999998 30.5 27.025 24.75 4 22.15 35.525 22.900000000000002 19.425 5 20.4352176088044 38.56928464232116 22.98649324662331 18.009004502251123 6 16.425 36.925000000000004 25.974999999999998 20.674999999999997 7 12.675 22.05 44.75 20.525 8 17.1 22.725 28.625 31.55 9 17.4 23.875 30.5 28.225 10-14 19.42 30.669999999999998 26.845000000000002 23.064999999999998 15-19 19.545 29.62 27.224999999999998 23.61 20-24 18.884999999999998 29.285 28.09 23.74 25-29 19.415 29.615000000000002 28.15 22.82 30-34 19.005 30.15 27.279999999999998 23.565 35-39 19.42 29.325000000000003 28.275 22.98 40-44 19.53 30.145 27.13 23.195 45-49 19.139999999999997 29.755 27.85 23.255 50-54 19.61424481390326 29.31337586016374 27.86679391230097 23.205585413632026 55-59 19.803791999186704 29.639607583998373 27.545366746302037 23.011233670512883 60-64 19.474451087775712 29.4528463045772 27.257197407426016 23.81550520022107 65-69 19.731637710909727 29.509838281680267 27.38697241275722 23.371551594652782 70-74 19.54 29.659999999999997 27.465 23.335 75-79 20.064999999999998 29.195 27.55 23.189999999999998 80-84 19.99 29.349999999999998 26.57 24.09 85-89 20.005 29.39 27.015 23.59 90-94 20.11 29.62 27.355 22.915 95-99 20.285 28.825 27.315 23.575 100-104 20.300225168876658 29.18188641481111 27.405554165624217 23.112334250688015 105-109 19.872438730413823 29.65548413017276 26.88830855765368 23.583768581759742 110-114 20.09105007754265 29.406173395367453 26.994847165941266 23.507929361148634 115-119 20.52270565263105 28.653682471336307 26.946377609773194 23.87723426625945 120-124 21.26244185464913 28.429950482668936 26.859400790276595 23.448206872405343 125-129 20.275000000000002 28.705000000000002 26.840000000000003 24.18 130-134 20.585 28.7 26.88 23.835 135-139 20.4 28.275 26.82 24.505 140-144 20.585 29.104999999999997 26.405 23.905 145-149 20.525 28.955 26.345000000000002 24.175 150-151 20.20012507817386 29.168230143839903 25.86616635397123 24.765478424015008 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 1.0 22 2.5 23 3.5 24 5.0 25 5.5 26 7.5 27 12.0 28 18.5 29 21.5 30 28.0 31 43.5 32 51.5 33 64.5 34 78.0 35 93.5 36 122.5 37 143.0 38 159.0 39 177.5 40 196.5 41 219.5 42 232.0 43 257.0 44 268.5 45 253.0 46 244.0 47 227.0 48 210.0 49 193.0 50 167.0 51 126.0 52 90.0 53 69.5 54 48.5 55 29.0 56 24.5 57 29.0 58 19.5 59 11.0 60 8.5 61 4.5 62 7.5 63 7.5 64 3.5 65 3.0 66 2.5 67 1.5 68 2.0 69 1.0 70 0.0 71 0.5 72 1.0 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.9000000000000004 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.455 55-59 1.635 60-64 0.485 65-69 0.135 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.075 105-109 0.44 110-114 0.055 115-119 0.135 120-124 0.034999999999999996 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0125 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.6 0.0 0.0 0.0 0.0 98-99 0.75 0.0 0.0 0.0 0.0 100-101 0.8875 0.0 0.0 0.0 0.0 102-103 1.1625 0.0 0.0 0.0 0.0 104-105 1.4249999999999998 0.0 0.0 0.0 0.0 106-107 1.725 0.0 0.0 0.0 0.0 108-109 1.975 0.0 0.0 0.0 0.0 110-111 2.2125 0.0 0.0 0.0 0.0 112-113 2.475 0.0 0.0 0.0 0.0 114-115 2.8 0.0 0.0 0.0 0.0 116-117 3.175 0.0 0.0 0.0 0.0 118-119 3.55 0.0 0.0 0.0 0.0 120-121 4.125 0.0 0.0 0.0 0.0 122-123 4.625 0.0 0.0 0.0 0.0 124-125 5.1 0.0 0.0 0.0 0.0 126-127 5.737500000000001 0.0 0.0 0.0 0.0 128-129 6.375 0.0 0.0 0.0 0.0 130-131 6.887499999999999 0.0 0.0 0.0 0.0 132-133 7.375 0.0 0.0 0.0 0.0 134-135 8.0375 0.0 0.0 0.0 0.0 136-137 8.825 0.0 0.0 0.0 0.0 138-139 9.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7166143 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166143_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.93425 33.0 33.0 34.0 32.0 34.0 2 33.00625 34.0 33.0 34.0 32.0 34.0 3 33.0705 34.0 33.0 34.0 32.0 34.0 4 33.036 34.0 33.0 34.0 32.0 34.0 5 32.9685 34.0 33.0 34.0 32.0 34.0 6 37.1635 38.0 38.0 38.0 36.0 38.0 7 37.1825 38.0 38.0 38.0 37.0 38.0 8 37.1295 38.0 38.0 38.0 37.0 38.0 9 37.147 38.0 38.0 38.0 37.0 38.0 10-14 37.11794999999999 38.0 38.0 38.0 36.6 38.0 15-19 37.05795 38.0 38.0 38.0 36.8 38.0 20-24 37.0601 38.0 38.0 38.0 36.6 38.0 25-29 37.0096 38.0 38.0 38.0 36.2 38.0 30-34 36.9762 38.0 38.0 38.0 36.2 38.0 35-39 36.903800000000004 38.0 38.0 38.0 36.0 38.0 40-44 36.864 38.0 38.0 38.0 36.0 38.0 45-49 36.7748 38.0 38.0 38.0 35.4 38.0 50-54 36.635149999999996 38.0 38.0 38.0 34.6 38.0 55-59 36.547399999999996 38.0 38.0 38.0 34.6 38.0 60-64 36.64385 38.0 38.0 38.0 35.0 38.0 65-69 36.55215 38.0 38.0 38.0 34.6 38.0 70-74 36.4269 38.0 38.0 38.0 34.0 38.0 75-79 36.29025 38.0 38.0 38.0 34.0 38.0 80-84 36.21894999999999 38.0 38.0 38.0 33.8 38.0 85-89 36.17315 38.0 38.0 38.0 33.8 38.0 90-94 36.04805 38.0 37.4 38.0 33.2 38.0 95-99 35.727349999999994 38.0 37.2 38.0 31.0 38.0 100-104 35.718900000000005 38.0 37.0 38.0 31.8 38.0 105-109 35.525549999999996 38.0 37.0 38.0 30.2 38.0 110-114 35.38805 38.0 37.0 38.0 29.4 38.0 115-119 35.08845 38.0 36.2 38.0 28.2 38.0 120-124 34.80675 38.0 36.0 38.0 27.0 38.0 125-129 34.51649999999999 38.0 35.0 38.0 25.6 38.0 130-134 34.170649999999995 38.0 35.0 38.0 23.4 38.0 135-139 33.9388 38.0 35.0 38.0 22.6 38.0 140-144 33.337700000000005 38.0 34.2 38.0 17.4 38.0 145-149 32.6022 38.0 33.8 38.0 13.8 38.0 150-151 28.136875 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 2.0 4 1.0 5 2.0 6 1.0 7 3.0 8 2.0 9 1.0 10 3.0 11 5.0 12 4.0 13 2.0 14 2.0 15 4.0 16 1.0 17 2.0 18 10.0 19 4.0 20 5.0 21 11.0 22 14.0 23 20.0 24 20.0 25 20.0 26 22.0 27 29.0 28 36.0 29 44.0 30 59.0 31 79.0 32 70.0 33 99.0 34 168.0 35 296.0 36 698.0 37 2254.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.35 17.150000000000002 15.275 27.224999999999998 2 24.525 23.474999999999998 35.425000000000004 16.575 3 21.075 25.974999999999998 32.824999999999996 20.125 4 25.05 33.074999999999996 22.025 19.85 5 24.3 36.075 23.0 16.625 6 18.929732433108278 36.90922730682671 24.5311327831958 19.629907476869217 7 18.229557389347338 16.90422605651413 44.236059014753685 20.630157539384847 8 21.705426356589147 20.880220055013755 28.582145536384097 28.832208052013 9 21.80545136284071 23.85596399099775 29.00725181295324 25.331332833208304 10-14 22.940735183795947 28.502125531382845 26.701675418854716 21.85546386596649 15-19 23.079615923184637 27.860572114422883 28.455691138227646 20.60412082416483 20-24 23.00460092018404 27.48049609921984 28.14062812562512 21.374274854970995 25-29 22.83799329765418 27.924773670784774 28.88510978842595 20.352123243135097 30-34 23.44586146536634 27.646911727931982 28.49212303075769 20.415103775943987 35-39 23.42585646411603 27.67691922980745 27.956989247311824 20.940235058764692 40-44 23.120780195048763 27.536884221055264 28.762190547636905 20.580145036259065 45-49 23.036911073321996 28.053416024807444 28.628588576572973 20.281084325297588 50-54 22.89759367652209 27.45510030516784 29.03596978338086 20.61133623492921 55-59 23.798329415295353 27.949782423848347 27.939778922622914 20.31210923823338 60-64 23.165791447861967 27.611902975743934 28.712178044511127 20.510127531882972 65-69 22.940735183795947 28.127031757939484 28.22205551387847 20.710177544386095 70-74 23.527645734300727 27.81085814360771 28.691518638979236 19.969977483112334 75-79 23.627720790592946 27.555666750062546 28.73154866149612 20.085063797848388 80-84 23.550307700005003 27.29274028118277 29.0188622604693 20.13808975834292 85-89 23.575893973493372 27.9869967491873 27.926981745436358 20.510127531882972 90-94 23.749499799919967 27.71608643457383 28.276310524209684 20.258103241296517 95-99 23.83930358214929 27.46147688613168 28.301981188713228 20.397238343005803 100-104 23.964585834333736 27.78611444577831 28.64145658263305 19.607843137254903 105-109 23.84215264579374 27.163148944683407 29.058717615284586 19.935980794238272 110-114 23.77688844422211 27.99399699849925 28.339169584792394 19.889944972486244 115-119 24.180553470449883 27.718560776660162 28.359105239453537 19.74178051343642 120-124 24.104283426741393 27.18174539631705 28.552842273819056 20.161128903122496 125-129 24.84238967277094 28.019613729610725 27.7944561192835 19.343540478334834 130-134 24.68487394957983 28.011204481792717 28.586434573829532 18.71748699479792 135-139 24.872461738521558 28.148444533360006 27.72331699509853 19.255776733019907 140-144 25.32133033258315 27.73693423355839 27.521880470117527 19.419854963740935 145-149 25.63140785196299 28.652163040760193 27.11177794448612 18.6046511627907 150-151 25.378172271533945 28.19102387798475 27.428428553569194 19.002375296912113 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 1.5 20 1.5 21 1.0 22 0.5 23 0.5 24 1.5 25 3.0 26 3.5 27 5.0 28 9.0 29 12.5 30 18.5 31 28.5 32 31.0 33 36.0 34 55.0 35 68.0 36 83.0 37 110.5 38 129.5 39 146.0 40 187.5 41 233.0 42 261.5 43 278.0 44 273.5 45 281.0 46 285.0 47 262.0 48 238.0 49 197.5 50 166.5 51 141.0 52 112.0 53 86.5 54 58.5 55 44.5 56 38.5 57 31.0 58 18.5 59 13.5 60 10.5 61 6.5 62 8.0 63 5.5 64 2.5 65 3.5 66 2.0 67 1.5 68 1.5 69 0.0 70 0.0 71 0.5 72 0.5 73 1.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.025 8 0.025 9 0.025 10-14 0.025 15-19 0.02 20-24 0.02 25-29 0.034999999999999996 30-34 0.025 35-39 0.025 40-44 0.025 45-49 0.03 50-54 0.055 55-59 0.034999999999999996 60-64 0.025 65-69 0.025 70-74 0.075 75-79 0.075 80-84 0.065 85-89 0.025 90-94 0.04 95-99 0.06 100-104 0.04 105-109 0.03 110-114 0.05 115-119 0.08499999999999999 120-124 0.08 125-129 0.06999999999999999 130-134 0.04 135-139 0.03 140-144 0.025 145-149 0.025 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62349397590361 99.225 2 0.3514056224899598 0.7000000000000001 3 0.0251004016064257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0125 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.07500000000000001 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.575 0.0 0.0 0.0 0.0 98-99 0.7250000000000001 0.0 0.0 0.0 0.0 100-101 0.8625 0.0 0.0 0.0 0.0 102-103 1.1375 0.0 0.0 0.0 0.0 104-105 1.4 0.0 0.0 0.0 0.0 106-107 1.7 0.0 0.0 0.0 0.0 108-109 1.9375 0.0 0.0 0.0 0.0 110-111 2.1625 0.0 0.0 0.0 0.0 112-113 2.425 0.0 0.0 0.0 0.0 114-115 2.7375 0.0 0.0 0.0 0.0 116-117 3.125 0.0 0.0 0.0 0.0 118-119 3.5 0.0 0.0 0.0 0.0 120-121 4.074999999999999 0.0 0.0 0.0 0.0 122-123 4.55 0.0 0.0 0.0 0.0 124-125 5.0125 0.0 0.0 0.0 0.0 126-127 5.65 0.0 0.0 0.0 0.0 128-129 6.325 0.0 0.0 0.0 0.0 130-131 6.8375 0.0 0.0 0.0 0.0 132-133 7.324999999999999 0.0 0.0 0.0 0.0 134-135 7.987500000000001 0.0 0.0 0.0 0.0 136-137 8.75 0.0 0.0 0.0 0.0 138-139 9.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTCAAC 10 0.006830828 145.0 5 AGTTGTG 10 0.006830828 145.0 5 >>END_MODULE Read 786759 spots for SRR7166143.sra Written 786759 spots for SRR7166143.sra Read 786759 spots for SRR7166143.sra Written 786759 spots for SRR7166143.sra Read 786759 spots for SRR7166143.sra Written 786759 spots for SRR7166143.sra Read 786759 spots for SRR7166143.sra Written 786759 spots for SRR7166143.sra Read 786759 spots for SRR7166143.sra Written 786759 spots for SRR7166143.sra Read 786759 spots for SRR7166143.sra Written 786759 spots for SRR7166143.sra Read 786759 spots for SRR7166143.sra Written 786759 spots for SRR7166143.sra Read 786759 spots for SRR7166143.sra Written 786759 spots for SRR7166143.sra Read 786759 spots for SRR7166143.sra Written 786759 spots for SRR7166143.sra Read 786759 spots for SRR7166143.sra Written 786759 spots for SRR7166143.sra Read 786759 spots for SRR7166143.sra Written 786759 spots for SRR7166143.sra Read 786759 spots for SRR7166143.sra Written 786759 spots for SRR7166143.sra Read 786759 spots for SRR7166143.sra Written 786759 spots for SRR7166143.sra Read 786759 spots for SRR7166143.sra Written 786759 spots for SRR7166143.sra Read 786759 spots for SRR7166143.sra Written 786759 spots for SRR7166143.sra Read 786759 spots for SRR7166143.sra Written 786759 spots for SRR7166143.sra Read 786759 spots for SRR7166143.sra Written 786759 spots for SRR7166143.sra Read 786759 spots for SRR7166143.sra Written 786759 spots for SRR7166143.sra Read 786759 spots for SRR7166143.sra Written 786759 spots for SRR7166143.sra Read 786759 spots for SRR7166143.sra Written 786759 spots for SRR7166143.sra SRR ids: ['SRR7166143.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_uy993f9z SRR7166143.sra spots: 15735180 blocks: [[1, 786759], [786760, 1573518], [1573519, 2360277], [2360278, 3147036], [3147037, 3933795], [3933796, 4720554], [4720555, 5507313], [5507314, 6294072], [6294073, 7080831], [7080832, 7867590], [7867591, 8654349], [8654350, 9441108], [9441109, 10227867], [10227868, 11014626], [11014627, 11801385], [11801386, 12588144], [12588145, 13374903], [13374904, 14161662], [14161663, 14948421], [14948422, 15735180]] SRR7166143 file size 5310435 SRR7166143 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166143 SRR7166143_1.fastq SRR7166143_2.fastq Input file: SRR7166143_1.fastq Paired file: SRR7166143_2.fastq trimmed: SRR7166143-trimmed-pair1.fastq, SRR7166143-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 15:33:32 2025 >> started Fri Feb 14 15:33:58 2025 >> done (25.601s) 15735180 read pairs processed; of these: 16615 ( 0.11%) short read pairs filtered out after trimming by size control 11179 ( 0.07%) empty read pairs filtered out after trimming by size control 15707386 (99.82%) read pairs available; of these: 7383782 (47.01%) trimmed read pairs available after processing 8323604 (52.99%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 4 0.00% 21 7 0.00% 22 7 0.00% 23 4 0.00% 24 4 0.00% 25 7 0.00% 26 6 0.00% 27 5 0.00% 28 1 0.00% 29 7 0.00% 30 8 0.00% 31 6 0.00% 32 1 0.00% 33 11 0.00% 34 5 0.00% 35 7 0.00% 36 10 0.00% 37 4 0.00% 38 9 0.00% 39 13 0.00% 40 6 0.00% 41 13 0.00% 42 17 0.00% 43 17 0.00% 44 16 0.00% 45 25 0.00% 46 28 0.00% 47 39 0.00% 48 45 0.00% 49 40 0.00% 50 53 0.00% 51 67 0.00% 52 69 0.00% 53 64 0.00% 54 69 0.00% 55 103 0.00% 56 103 0.00% 57 145 0.00% 58 140 0.00% 59 210 0.00% 60 238 0.00% 61 216 0.00% 62 292 0.00% 63 339 0.00% 64 374 0.00% 65 406 0.00% 66 454 0.00% 67 478 0.00% 68 604 0.00% 69 699 0.00% 70 842 0.01% 71 1005 0.01% 72 1155 0.01% 73 1367 0.01% 74 1405 0.01% 75 1693 0.01% 76 1974 0.01% 77 2145 0.01% 78 2373 0.02% 79 2660 0.02% 80 3022 0.02% 81 3634 0.02% 82 4094 0.03% 83 4678 0.03% 84 6236 0.04% 85 6545 0.04% 86 6863 0.04% 87 7592 0.05% 88 7932 0.05% 89 8612 0.05% 90 9403 0.06% 91 10556 0.07% 92 11431 0.07% 93 12814 0.08% 94 13558 0.09% 95 14460 0.09% 96 15166 0.10% 97 15848 0.10% 98 16898 0.11% 99 18130 0.12% 100 18749 0.12% 101 20043 0.13% 102 21978 0.14% 103 23414 0.15% 104 24821 0.16% 105 26132 0.17% 106 27152 0.17% 107 27763 0.18% 108 28864 0.18% 109 30006 0.19% 110 31289 0.20% 111 33281 0.21% 112 35317 0.22% 113 37245 0.24% 114 38826 0.25% 115 41124 0.26% 116 41734 0.27% 117 43687 0.28% 118 44384 0.28% 119 45266 0.29% 120 46280 0.29% 121 48323 0.31% 122 50513 0.32% 123 53196 0.34% 124 56191 0.36% 125 57575 0.37% 126 59350 0.38% 127 60502 0.39% 128 61543 0.39% 129 63306 0.40% 130 65101 0.41% 131 67615 0.43% 132 70406 0.45% 133 74057 0.47% 134 77354 0.49% 135 80203 0.51% 136 83850 0.53% 137 87150 0.55% 138 90658 0.58% 139 94749 0.60% 140 99475 0.63% 141 105323 0.67% 142 114237 0.73% 143 124293 0.79% 144 140137 0.89% 145 160962 1.02% 146 192903 1.23% 147 244942 1.56% 148 350800 2.23% 149 638449 4.06% 150 3003673 19.12% 151 8323604 52.99% 15707386 reads passed initial QC criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=24 prefix-density=0.60 prefix-fanout=2.0 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.02 sequence-density-rank=29 fanout-score=50.73 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=9.8 sequence=GAAAATCAAAGTACTTCACACCATGAAAAATCACACACTAAGCAAACCATGCATGATGGAATAAAAATGCTTTTAGGCGCACTGGAAATCTTTGGGGACCTTCTTTCCACAGACATTGAGAAGCAAGCTTAGAGATACAGGGATATTAAGGTTGATGCCCAAGATGTTAGCTTTGATGGCAGTGCAAAGGCAAACAGCAGCCTCGAGATCAAGAAGGCCTTGAATGA criterion=sequence-density sequence-density=0.78 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=28 prefix-density=0.79 prefix-fanout=2.1 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.19 sequence-density-rank=12 fanout-score=8.50 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=5.1 sequence=CAAGGATTTTGGCCCACAGCCTACTGCTACATCTTATGACAA SRR7166143 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 15:34:44 Started mapping on | Feb 14 15:34:44 Finished on | Feb 14 15:36:30 Mapping speed, Million of reads per hour | 533.46 Number of input reads | 15707386 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 14994758 Uniquely mapped reads % | 95.46% Average mapped length | 291.19 Number of splices: Total | 13563393 Number of splices: Annotated (sjdb) | 13300410 Number of splices: GT/AG | 13335741 Number of splices: GC/AG | 172565 Number of splices: AT/AC | 10724 Number of splices: Non-canonical | 44363 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.04% Deletion average length | 2.31 Insertion rate per base | 0.03% Insertion average length | 2.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 416828 % of reads mapped to multiple loci | 2.65% Number of reads mapped to too many loci | 58779 % of reads mapped to too many loci | 0.37% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.42% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 309949 309949 309949 N_multimapping 416828 416828 416828 N_noFeature 470346 14787890 583644 N_ambiguous 164695 1280 70196 UnstrandedReadsAssigned:14359717 PositiveStrandReadsAssigned:205588 NegativeStrandReadsAssigned:14340918 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7166143 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166143-trimmed-pair1.fastq SRR7166143-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,707,386 reads, 14,251,880 reads pseudoaligned [quant] estimated average fragment length: 227.255 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,083 rounds 52401 SRR7166143.ke.tsv 34699 SRR7166143.se.tsv 87100 total ==> SRR7166143.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1791.74 836 27.7474 Potri.005G024800.1.v4.1 1035 808.745 189 13.8977 Potri.004G059700.1.v4.1 961 734.769 52 4.20867 Potri.007G009000.2.v4.1 1416 1189.74 0 0 Potri.003G141000.2.v4.1 2943 2716.74 466 10.2007 Potri.016G087400.1.v4.1 270 90.286 1027 676.461 Potri.015G069301.1.v4.1 564 342.775 0 0 Potri.010G195200.1.v4.1 1773 1546.74 272 10.4579 Potri.012G127500.1.v4.1 977 750.755 4368 346.001 ==> SRR7166143.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 55 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 574 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 280 SRR7166143 completed mapping pipeline successfully