Starting /dee2/code/volunteer_pipeline.sh SRR7166144 current disk space = 3112529440768 free memory = 1290083448 SRR7166144 SRAfilesize fb7c375709d45727e801adba09d01e08 SRR7166144.sra SRR7166144.sra file validated SRR7166144 is paired end SRR7166144 is conventional basespace SRR7166144 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166144_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.47775 33.0 30.0 33.0 18.0 34.0 2 31.91225 33.0 31.0 33.0 28.0 34.0 3 31.5455 33.0 31.0 33.0 29.0 34.0 4 31.85225 33.0 32.0 33.0 31.0 33.0 5 32.8175 33.0 33.0 33.0 32.0 34.0 6 36.5165 38.0 37.0 38.0 34.0 38.0 7 37.319 38.0 38.0 38.0 36.0 38.0 8 37.492 38.0 38.0 38.0 37.0 38.0 9 37.65675 38.0 38.0 38.0 38.0 38.0 10-14 37.611749999999994 38.0 38.0 38.0 38.0 38.0 15-19 37.57885 38.0 38.0 38.0 38.0 38.0 20-24 37.5783 38.0 38.0 38.0 38.0 38.0 25-29 37.5736 38.0 38.0 38.0 38.0 38.0 30-34 37.557249999999996 38.0 38.0 38.0 38.0 38.0 35-39 37.53165 38.0 38.0 38.0 37.6 38.0 40-44 37.5131 38.0 38.0 38.0 37.8 38.0 45-49 37.52065 38.0 38.0 38.0 37.6 38.0 50-54 37.48745 38.0 38.0 38.0 37.0 38.0 55-59 37.23415000000001 38.0 38.0 38.0 37.0 38.0 60-64 37.290549999999996 38.0 38.0 38.0 36.8 38.0 65-69 37.32005 38.0 38.0 38.0 37.0 38.0 70-74 37.25015 38.0 38.0 38.0 36.8 38.0 75-79 37.150999999999996 38.0 38.0 38.0 36.4 38.0 80-84 37.07345 38.0 38.0 38.0 36.0 38.0 85-89 36.93044999999999 38.0 38.0 38.0 35.8 38.0 90-94 36.83385 38.0 38.0 38.0 35.4 38.0 95-99 36.78875 38.0 38.0 38.0 35.0 38.0 100-104 36.69705 38.0 38.0 38.0 34.8 38.0 105-109 36.575300000000006 38.0 38.0 38.0 34.4 38.0 110-114 36.5843 38.0 38.0 38.0 34.0 38.0 115-119 36.35025 38.0 37.8 38.0 33.8 38.0 120-124 36.1172 38.0 37.4 38.0 33.4 38.0 125-129 35.96565 38.0 37.0 38.0 33.0 38.0 130-134 35.796749999999996 38.0 36.6 38.0 32.2 38.0 135-139 35.6055 38.0 36.2 38.0 31.2 38.0 140-144 35.2947 38.0 35.8 38.0 30.4 38.0 145-149 34.914899999999996 38.0 35.8 38.0 29.6 38.0 150-151 31.805500000000002 36.5 31.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 1.0 15 2.0 16 1.0 17 1.0 18 1.0 19 1.0 20 4.0 21 4.0 22 3.0 23 2.0 24 7.0 25 6.0 26 11.0 27 12.0 28 19.0 29 23.0 30 26.0 31 44.0 32 52.0 33 85.0 34 142.0 35 228.0 36 632.0 37 2692.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.50306748466258 15.51635991820041 11.273006134969325 36.70756646216769 2 19.7 24.175 40.675 15.45 3 17.8 28.575 28.499999999999996 25.124999999999996 4 21.375 35.6 21.75 21.275 5 20.33558727773604 37.51565239168545 23.541197094916104 18.607563235662408 6 16.025 35.35 27.200000000000003 21.425 7 13.825000000000001 17.9 47.3 20.974999999999998 8 18.275 20.825 28.249999999999996 32.65 9 18.95 20.549999999999997 31.825 28.675 10-14 19.685 29.935000000000002 26.450000000000003 23.93 15-19 20.25 28.46 27.555000000000003 23.735 20-24 19.81 28.57 28.044999999999998 23.575 25-29 20.24 28.544999999999998 28.23 22.985 30-34 19.965 29.345 27.589999999999996 23.1 35-39 20.93 28.02 28.244999999999997 22.805 40-44 20.419999999999998 29.15 26.97 23.46 45-49 20.215 28.425 27.884999999999998 23.474999999999998 50-54 20.41 28.904999999999998 27.72 22.965 55-59 20.49040297457542 28.791076273741332 27.384182494221687 23.33433825746156 60-64 20.09605282905598 28.765821201660913 27.585171844514484 23.552954124768622 65-69 20.53 28.67 27.555000000000003 23.244999999999997 70-74 20.69 29.07 27.275 22.965 75-79 21.099999999999998 28.215 27.279999999999998 23.405 80-84 20.794999999999998 28.565 27.47 23.169999999999998 85-89 20.745 28.52 27.779999999999998 22.955000000000002 90-94 20.555 28.49 28.055000000000003 22.900000000000002 95-99 20.825 28.294999999999998 27.715 23.165 100-104 20.906498574215817 28.125469007954372 27.975386462554404 22.9926459552754 105-109 21.122954511334633 28.28904568883551 27.583445929039684 23.004553870790172 110-114 20.945 28.67 27.810000000000002 22.575 115-119 20.82 29.04 27.250000000000004 22.89 120-124 20.225 28.57 27.900000000000002 23.305 125-129 21.035 28.505000000000003 27.735 22.725 130-134 20.669999999999998 28.485 27.529999999999998 23.315 135-139 21.025 28.735 26.995 23.244999999999997 140-144 21.005 28.349999999999998 27.075 23.57 145-149 21.45 29.005 26.44 23.105 150-151 20.841683366733466 29.158316633266534 26.13977955911824 23.86022044088176 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 4.5 24 5.5 25 1.5 26 2.0 27 5.5 28 7.0 29 12.5 30 22.5 31 33.0 32 31.5 33 39.0 34 55.5 35 66.5 36 92.5 37 118.5 38 146.5 39 174.5 40 192.5 41 225.5 42 248.5 43 265.0 44 279.0 45 282.0 46 284.5 47 256.0 48 220.0 49 203.0 50 166.0 51 128.5 52 111.0 53 82.5 54 60.5 55 49.0 56 35.0 57 24.5 58 20.0 59 11.5 60 6.5 61 8.0 62 4.0 63 0.5 64 2.5 65 3.5 66 2.5 67 1.0 68 1.5 69 2.0 70 0.5 71 0.5 72 1.5 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.1999999999999997 2 0.0 3 0.0 4 0.0 5 0.17500000000000002 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.49 60-64 0.055 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.055 105-109 0.08499999999999999 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.2 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.30000000000000004 0.0 0.0 0.0 0.0 96-97 0.3625 0.0 0.0 0.0 0.0 98-99 0.42500000000000004 0.0 0.0 0.0 0.0 100-101 0.525 0.0 0.0 0.0 0.0 102-103 0.6375 0.0 0.0 0.0 0.0 104-105 0.75 0.0 0.0 0.0 0.0 106-107 0.825 0.0 0.0 0.0 0.0 108-109 1.075 0.0 0.0 0.0 0.0 110-111 1.2375 0.0 0.0 0.0 0.0 112-113 1.3625 0.0 0.0 0.0 0.0 114-115 1.5 0.0 0.0 0.0 0.0 116-117 1.8125 0.0 0.0 0.0 0.0 118-119 2.0375 0.0 0.0 0.0 0.0 120-121 2.2750000000000004 0.0 0.0 0.0 0.0 122-123 2.575 0.0 0.0 0.0 0.0 124-125 2.825 0.0 0.0 0.0 0.0 126-127 3.2249999999999996 0.0 0.0 0.0 0.0 128-129 3.625 0.0 0.0 0.0 0.0 130-131 3.9625000000000004 0.0 0.0 0.0 0.0 132-133 4.375 0.0 0.0 0.0 0.0 134-135 4.9125 0.0 0.0 0.0 0.0 136-137 5.525 0.0 0.0 0.0 0.0 138-139 6.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAAAAC 10 0.006367584 148.39743 1 >>END_MODULE SRR7166144 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166144_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.92225 33.0 33.0 34.0 32.0 34.0 2 33.015 33.0 33.0 34.0 32.0 34.0 3 33.04475 34.0 33.0 34.0 32.0 34.0 4 33.08025 34.0 33.0 34.0 32.0 34.0 5 33.05825 34.0 33.0 34.0 32.0 34.0 6 37.24025 38.0 38.0 38.0 36.0 38.0 7 37.29675 38.0 38.0 38.0 37.0 38.0 8 37.21575 38.0 38.0 38.0 37.0 38.0 9 37.2775 38.0 38.0 38.0 37.0 38.0 10-14 37.233999999999995 38.0 38.0 38.0 37.0 38.0 15-19 37.2552 38.0 38.0 38.0 36.8 38.0 20-24 37.18155 38.0 38.0 38.0 36.6 38.0 25-29 37.12185 38.0 38.0 38.0 36.0 38.0 30-34 37.11765 38.0 38.0 38.0 36.2 38.0 35-39 37.041999999999994 38.0 38.0 38.0 36.0 38.0 40-44 36.952600000000004 38.0 38.0 38.0 36.0 38.0 45-49 36.890299999999996 38.0 38.0 38.0 35.6 38.0 50-54 36.681400000000004 38.0 38.0 38.0 34.8 38.0 55-59 36.65475 38.0 38.0 38.0 34.6 38.0 60-64 36.5577 38.0 38.0 38.0 34.2 38.0 65-69 36.56345 38.0 38.0 38.0 34.0 38.0 70-74 36.4206 38.0 38.0 38.0 34.0 38.0 75-79 36.2909 38.0 38.0 38.0 33.6 38.0 80-84 36.1435 38.0 37.0 38.0 33.2 38.0 85-89 36.0341 38.0 37.0 38.0 32.8 38.0 90-94 35.8132 38.0 37.0 38.0 31.2 38.0 95-99 35.6638 38.0 36.6 38.0 30.2 38.0 100-104 35.4738 38.0 36.4 38.0 29.4 38.0 105-109 35.294200000000004 38.0 36.0 38.0 29.0 38.0 110-114 34.95425 38.0 35.8 38.0 27.8 38.0 115-119 34.69545 38.0 35.0 38.0 26.6 38.0 120-124 34.2879 38.0 34.6 38.0 23.6 38.0 125-129 34.041199999999996 38.0 34.2 38.0 22.6 38.0 130-134 33.44755 38.0 33.8 38.0 19.0 38.0 135-139 33.062349999999995 38.0 33.8 38.0 14.8 38.0 140-144 32.08815 37.0 32.8 38.0 14.0 38.0 145-149 30.80885 36.4 31.0 38.0 8.6 38.0 150-151 26.419125 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 1.0 4 0.0 5 0.0 6 1.0 7 1.0 8 0.0 9 0.0 10 0.0 11 2.0 12 1.0 13 2.0 14 1.0 15 4.0 16 5.0 17 5.0 18 8.0 19 5.0 20 12.0 21 14.0 22 14.0 23 14.0 24 16.0 25 18.0 26 25.0 27 33.0 28 39.0 29 57.0 30 52.0 31 70.0 32 119.0 33 170.0 34 248.0 35 459.0 36 904.0 37 1698.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.275 14.374999999999998 14.475 35.875 2 22.125 23.875 37.724999999999994 16.275000000000002 3 20.549999999999997 26.325 30.4 22.725 4 22.825 36.675000000000004 20.3 20.200000000000003 5 22.775000000000002 37.574999999999996 21.8 17.849999999999998 6 16.975 39.15 24.075 19.8 7 15.775 14.274999999999999 47.725 22.225 8 19.175 20.25 28.825 31.75 9 21.75 22.375 28.849999999999998 27.025 10-14 22.509999999999998 28.74 26.705000000000002 22.045 15-19 22.53 27.55 28.544999999999998 21.375 20-24 22.13 28.46 27.98 21.43 25-29 22.355 28.18 28.78 20.685000000000002 30-34 22.919999999999998 27.950000000000003 27.91 21.22 35-39 22.55 28.615000000000002 27.66 21.175 40-44 23.09 28.199999999999996 28.449999999999996 20.26 45-49 22.535 28.075 28.499999999999996 20.89 50-54 22.32 27.79 28.65 21.240000000000002 55-59 23.115 28.08 28.355000000000004 20.45 60-64 22.805 27.839999999999996 28.615000000000002 20.74 65-69 23.32 26.875 28.78 21.025 70-74 23.355 28.175 27.66 20.810000000000002 75-79 23.355 27.79 28.155 20.7 80-84 23.44 28.360000000000003 28.13 20.07 85-89 23.575 28.38 27.51 20.535 90-94 22.935 28.660000000000004 28.000000000000004 20.405 95-99 23.119999999999997 27.57 28.24 21.07 100-104 23.41 27.91 28.225 20.455000000000002 105-109 22.96 28.185 28.575 20.28 110-114 23.09 28.225 28.095 20.59 115-119 23.715 28.115000000000002 28.249999999999996 19.919999999999998 120-124 23.849999999999998 28.54 27.915 19.695 125-129 23.630000000000003 27.93 27.61 20.830000000000002 130-134 24.115000000000002 27.87 27.725 20.29 135-139 24.48 28.43 27.284999999999997 19.805 140-144 24.560000000000002 28.675 27.555000000000003 19.21 145-149 25.105 27.744999999999997 27.41 19.74 150-151 25.13763763763764 27.740240240240237 26.926926926926924 20.195195195195197 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.5 20 1.0 21 1.0 22 2.0 23 4.5 24 4.5 25 3.0 26 1.5 27 3.0 28 7.0 29 9.5 30 12.5 31 16.5 32 27.0 33 37.5 34 52.5 35 70.5 36 82.5 37 110.0 38 141.5 39 165.5 40 202.0 41 241.0 42 263.0 43 274.5 44 288.0 45 291.5 46 275.5 47 244.5 48 221.0 49 206.5 50 171.5 51 128.5 52 105.0 53 78.0 54 54.0 55 49.5 56 44.5 57 33.0 58 19.0 59 13.0 60 10.5 61 7.5 62 6.0 63 5.0 64 3.0 65 2.0 66 2.5 67 2.0 68 0.5 69 0.0 70 0.5 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.30000000000000004 0.0 0.0 0.0 0.0 96-97 0.3625 0.0 0.0 0.0 0.0 98-99 0.42500000000000004 0.0 0.0 0.0 0.0 100-101 0.525 0.0 0.0 0.0 0.0 102-103 0.6375 0.0 0.0 0.0 0.0 104-105 0.75 0.0 0.0 0.0 0.0 106-107 0.825 0.0 0.0 0.0 0.0 108-109 1.0875 0.0 0.0 0.0 0.0 110-111 1.2375 0.0 0.0 0.0 0.0 112-113 1.3625 0.0 0.0 0.0 0.0 114-115 1.4875 0.0 0.0 0.0 0.0 116-117 1.7875 0.0 0.0 0.0 0.0 118-119 2.0375 0.0 0.0 0.0 0.0 120-121 2.2750000000000004 0.0 0.0 0.0 0.0 122-123 2.55 0.0 0.0 0.0 0.0 124-125 2.8 0.0 0.0 0.0 0.0 126-127 3.2125 0.0 0.0 0.0 0.0 128-129 3.6 0.0 0.0 0.0 0.0 130-131 3.9625000000000004 0.0 0.0 0.0 0.0 132-133 4.4 0.0 0.0 0.0 0.0 134-135 4.925 0.0 0.0 0.0 0.0 136-137 5.5125 0.0 0.0 0.0 0.0 138-139 6.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAGCAAC 10 0.006830828 145.0 1 TCTCAAC 10 0.006830828 145.0 2 >>END_MODULE Read 755793 spots for SRR7166144.sra Written 755793 spots for SRR7166144.sra Read 755793 spots for SRR7166144.sra Written 755793 spots for SRR7166144.sra Read 755793 spots for SRR7166144.sra Written 755793 spots for SRR7166144.sra Read 755793 spots for SRR7166144.sra Written 755793 spots for SRR7166144.sra Read 755793 spots for SRR7166144.sra Written 755793 spots for SRR7166144.sra Read 755793 spots for SRR7166144.sra Written 755793 spots for SRR7166144.sra Read 755793 spots for SRR7166144.sra Written 755793 spots for SRR7166144.sra Read 755793 spots for SRR7166144.sra Written 755793 spots for SRR7166144.sra Read 755793 spots for SRR7166144.sra Written 755793 spots for SRR7166144.sra Read 755793 spots for SRR7166144.sra Written 755793 spots for SRR7166144.sra Read 755793 spots for SRR7166144.sra Written 755793 spots for SRR7166144.sra Read 755793 spots for SRR7166144.sra Written 755793 spots for SRR7166144.sra Read 755793 spots for SRR7166144.sra Written 755793 spots for SRR7166144.sra Read 755793 spots for SRR7166144.sra Written 755793 spots for SRR7166144.sra Read 755793 spots for SRR7166144.sra Written 755793 spots for SRR7166144.sra Read 755793 spots for SRR7166144.sra Written 755793 spots for SRR7166144.sra Read 755793 spots for SRR7166144.sra Written 755793 spots for SRR7166144.sra Read 755793 spots for SRR7166144.sra Written 755793 spots for SRR7166144.sra Read 755793 spots for SRR7166144.sra Written 755793 spots for SRR7166144.sra Read 755799 spots for SRR7166144.sra Written 755799 spots for SRR7166144.sra SRR ids: ['SRR7166144.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_r66ylb0k SRR7166144.sra spots: 15115866 blocks: [[1, 755793], [755794, 1511586], [1511587, 2267379], [2267380, 3023172], [3023173, 3778965], [3778966, 4534758], [4534759, 5290551], [5290552, 6046344], [6046345, 6802137], [6802138, 7557930], [7557931, 8313723], [8313724, 9069516], [9069517, 9825309], [9825310, 10581102], [10581103, 11336895], [11336896, 12092688], [12092689, 12848481], [12848482, 13604274], [13604275, 14360067], [14360068, 15115866]] SRR7166144 file size 5100570 SRR7166144 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166144 SRR7166144_1.fastq SRR7166144_2.fastq Input file: SRR7166144_1.fastq Paired file: SRR7166144_2.fastq trimmed: SRR7166144-trimmed-pair1.fastq, SRR7166144-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 15:21:31 2025 >> started Fri Feb 14 15:21:54 2025 >> done (23.455s) 15115866 read pairs processed; of these: 4705 ( 0.03%) short read pairs filtered out after trimming by size control 4639 ( 0.03%) empty read pairs filtered out after trimming by size control 15106522 (99.94%) read pairs available; of these: 7210851 (47.73%) trimmed read pairs available after processing 7895671 (52.27%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 7 0.00% 21 8 0.00% 22 11 0.00% 23 5 0.00% 24 5 0.00% 25 4 0.00% 26 3 0.00% 27 3 0.00% 28 6 0.00% 29 6 0.00% 30 4 0.00% 31 5 0.00% 32 8 0.00% 33 5 0.00% 34 4 0.00% 35 7 0.00% 36 10 0.00% 37 10 0.00% 38 14 0.00% 39 17 0.00% 40 16 0.00% 41 14 0.00% 42 13 0.00% 43 17 0.00% 44 21 0.00% 45 17 0.00% 46 15 0.00% 47 21 0.00% 48 30 0.00% 49 26 0.00% 50 39 0.00% 51 39 0.00% 52 50 0.00% 53 62 0.00% 54 48 0.00% 55 56 0.00% 56 70 0.00% 57 82 0.00% 58 82 0.00% 59 127 0.00% 60 106 0.00% 61 127 0.00% 62 139 0.00% 63 153 0.00% 64 182 0.00% 65 205 0.00% 66 240 0.00% 67 295 0.00% 68 313 0.00% 69 352 0.00% 70 436 0.00% 71 499 0.00% 72 506 0.00% 73 593 0.00% 74 676 0.00% 75 769 0.01% 76 863 0.01% 77 979 0.01% 78 1096 0.01% 79 1259 0.01% 80 1453 0.01% 81 1576 0.01% 82 1873 0.01% 83 2145 0.01% 84 2482 0.02% 85 3026 0.02% 86 3213 0.02% 87 3489 0.02% 88 3918 0.03% 89 4190 0.03% 90 4540 0.03% 91 5037 0.03% 92 5461 0.04% 93 5992 0.04% 94 6518 0.04% 95 7062 0.05% 96 7548 0.05% 97 7938 0.05% 98 8935 0.06% 99 9457 0.06% 100 9735 0.06% 101 10286 0.07% 102 11021 0.07% 103 11982 0.08% 104 12624 0.08% 105 13598 0.09% 106 14030 0.09% 107 14717 0.10% 108 15706 0.10% 109 16624 0.11% 110 17470 0.12% 111 18195 0.12% 112 19537 0.13% 113 20520 0.14% 114 21607 0.14% 115 22997 0.15% 116 23792 0.16% 117 24741 0.16% 118 26341 0.17% 119 26812 0.18% 120 28371 0.19% 121 29885 0.20% 122 30849 0.20% 123 32769 0.22% 124 34465 0.23% 125 35881 0.24% 126 37801 0.25% 127 39371 0.26% 128 40830 0.27% 129 43378 0.29% 130 45247 0.30% 131 47841 0.32% 132 50277 0.33% 133 53671 0.36% 134 56341 0.37% 135 60209 0.40% 136 63752 0.42% 137 67765 0.45% 138 72950 0.48% 139 79299 0.52% 140 85440 0.57% 141 93183 0.62% 142 105104 0.70% 143 116784 0.77% 144 135769 0.90% 145 163137 1.08% 146 200775 1.33% 147 269212 1.78% 148 401975 2.66% 149 768186 5.09% 150 3461365 22.91% 151 7895671 52.27% 15106522 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.59 fanout-score-rank=26 prefix-density=0.20 prefix-fanout=2.3 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.07 sequence-density-rank=20 fanout-score=431.73 fanout-score-rank=1 prefix-density=0.93 prefix-fanout=34.3 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.43 fanout-score-rank=32 prefix-density=0.26 prefix-fanout=2.3 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.06 sequence-density-rank=24 fanout-score=292.75 fanout-score-rank=1 prefix-density=0.79 prefix-fanout=23.1 sequence=AGAAGAAGAGAGG SRR7166144 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 15:23:08 Started mapping on | Feb 14 15:23:08 Finished on | Feb 14 15:24:54 Mapping speed, Million of reads per hour | 513.05 Number of input reads | 15106522 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 14444750 Uniquely mapped reads % | 95.62% Average mapped length | 294.48 Number of splices: Total | 14779631 Number of splices: Annotated (sjdb) | 14550133 Number of splices: GT/AG | 14549324 Number of splices: GC/AG | 183731 Number of splices: AT/AC | 10515 Number of splices: Non-canonical | 36061 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.45 Insertion rate per base | 0.02% Insertion average length | 2.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 388797 % of reads mapped to multiple loci | 2.57% Number of reads mapped to too many loci | 34877 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.52% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 278583 278583 278583 N_multimapping 388797 388797 388797 N_noFeature 359292 14273780 467726 N_ambiguous 127889 1077 64571 UnstrandedReadsAssigned:13957569 PositiveStrandReadsAssigned:169893 NegativeStrandReadsAssigned:13912453 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7166144 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166144-trimmed-pair1.fastq SRR7166144-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,106,522 reads, 13,801,542 reads pseudoaligned [quant] estimated average fragment length: 237.761 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,039 rounds 52401 SRR7166144.ke.tsv 34699 SRR7166144.se.tsv 87100 total ==> SRR7166144.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1781.24 718 29.9965 Potri.005G024800.1.v4.1 1035 798.239 253 23.5861 Potri.004G059700.1.v4.1 961 724.281 49 5.03451 Potri.007G009000.2.v4.1 1416 1179.24 0 0 Potri.003G141000.2.v4.1 2943 2706.24 452.215 12.435 Potri.016G087400.1.v4.1 270 80.3707 1062 983.32 Potri.015G069301.1.v4.1 564 331.876 0 0 Potri.010G195200.1.v4.1 1773 1536.24 111 5.3769 Potri.012G127500.1.v4.1 977 740.26 2114 212.514 ==> SRR7166144.se.tsv <== Potri.001G166300.v4.1 6 Potri.001G448400.v4.1 21 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 264 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 60 SRR7166144 completed mapping pipeline successfully