Starting /dee2/code/volunteer_pipeline.sh SRR7166145 current disk space = 3111832035328 free memory = 1575235416 SRR7166145 SRAfilesize 2af23be980d7a222b38c9f2c18150c6d SRR7166145.sra SRR7166145.sra file validated SRR7166145 is paired end SRR7166145 is conventional basespace SRR7166145 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166145_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.891 33.0 32.0 34.0 30.0 34.0 2 32.23425 33.0 33.0 34.0 29.0 34.0 3 32.1525 33.0 32.0 34.0 30.0 34.0 4 32.08275 33.0 32.0 34.0 30.0 34.0 5 32.38775 33.0 33.0 34.0 31.0 34.0 6 36.27525 38.0 37.0 38.0 33.0 38.0 7 36.6825 38.0 37.0 38.0 34.0 38.0 8 36.74025 38.0 38.0 38.0 34.0 38.0 9 36.85 38.0 38.0 38.0 35.0 38.0 10-14 36.8938 38.0 38.0 38.0 35.0 38.0 15-19 36.83575 38.0 38.0 38.0 34.6 38.0 20-24 36.88824999999999 38.0 38.0 38.0 35.2 38.0 25-29 36.7191 38.0 38.0 38.0 34.4 38.0 30-34 36.48440000000001 38.0 38.0 38.0 34.0 38.0 35-39 36.3009 38.0 37.0 38.0 33.2 38.0 40-44 36.25025 38.0 37.2 38.0 33.2 38.0 45-49 36.20985 38.0 37.0 38.0 33.0 38.0 50-54 36.0531 38.0 37.0 38.0 32.6 38.0 55-59 35.85035 38.0 37.0 38.0 30.6 38.0 60-64 35.951800000000006 38.0 37.0 38.0 31.4 38.0 65-69 35.601350000000004 38.0 36.0 38.0 29.8 38.0 70-74 35.63875 38.0 36.0 38.0 29.4 38.0 75-79 35.007799999999996 38.0 36.0 38.0 28.0 38.0 80-84 34.80605 38.0 35.8 38.0 27.6 38.0 85-89 34.982 38.0 35.4 38.0 27.6 38.0 90-94 34.8914 38.0 35.0 38.0 27.6 38.0 95-99 34.4459 38.0 34.2 38.0 25.0 38.0 100-104 34.1856 38.0 34.2 38.0 23.0 38.0 105-109 33.65715 37.8 33.8 38.0 19.4 38.0 110-114 33.45775 37.2 33.6 38.0 16.6 38.0 115-119 32.719899999999996 37.0 31.0 38.0 15.0 38.0 120-124 32.4137 36.8 30.6 38.0 15.0 38.0 125-129 31.7524 37.0 30.4 38.0 14.6 38.0 130-134 29.9635 34.6 25.6 38.0 13.2 38.0 135-139 28.474850000000004 33.0 21.4 38.0 12.2 38.0 140-144 27.799649999999996 33.0 19.6 38.0 2.0 38.0 145-149 25.49455 33.0 8.8 38.0 2.0 38.0 150-151 19.554125 17.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 2.0 15 2.0 16 3.0 17 5.0 18 5.0 19 8.0 20 10.0 21 20.0 22 32.0 23 24.0 24 39.0 25 54.0 26 69.0 27 84.0 28 102.0 29 121.0 30 140.0 31 180.0 32 225.0 33 297.0 34 408.0 35 628.0 36 869.0 37 672.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.737108190091 18.98382204246714 9.150657229524771 32.128412537917086 2 18.45 25.3 37.525 18.725 3 16.950000000000003 31.874999999999996 27.325 23.849999999999998 4 20.7 38.074999999999996 22.475 18.75 5 20.525 38.550000000000004 22.725 18.2 6 17.775 35.875 24.325 22.025 7 13.350000000000001 21.15 44.800000000000004 20.7 8 17.724999999999998 21.75 27.700000000000003 32.824999999999996 9 17.925 22.025 30.125 29.925 10-14 19.395 30.43 26.495 23.68 15-19 19.634999999999998 29.07 28.03 23.265 20-24 19.46 28.865000000000002 27.87 23.805 25-29 19.545 29.575000000000003 27.794999999999998 23.085 30-34 19.59 29.485 27.665 23.26 35-39 19.59 29.235 28.084999999999997 23.09 40-44 19.73 29.13 27.744999999999997 23.395 45-49 19.89 28.77 28.185 23.155 50-54 19.33 29.509999999999998 27.63 23.53 55-59 19.564999999999998 29.03 27.55 23.855 60-64 19.365 29.59 27.525 23.52 65-69 19.98 29.485 27.279999999999998 23.255 70-74 19.521952195219523 29.94799479947995 27.602760276027606 22.927292729272928 75-79 20.1953243598826 29.060823803258778 27.552879263232466 23.19097257362615 80-84 19.36154041043831 28.700278692677983 28.006080567519636 23.932100329364072 85-89 19.675 28.615000000000002 28.09 23.62 90-94 19.96 29.145 27.685 23.21 95-99 20.025000000000002 29.049999999999997 27.93 22.994999999999997 100-104 20.62 28.735 27.715 22.93 105-109 20.23 28.87 27.625 23.275000000000002 110-114 20.13 28.775000000000002 27.515 23.580000000000002 115-119 20.41 28.615000000000002 27.865000000000002 23.11 120-124 20.55116534960488 28.513554066219864 27.448234470341106 23.48704611383415 125-129 20.18201820182018 29.122912291229124 27.10771077107711 23.587358735873586 130-134 20.921575531968408 28.45716585341315 26.70657477740329 23.91468383721515 135-139 20.771617293835067 28.66793434747798 27.00160128102482 23.55884707766213 140-144 20.700350175087546 28.69934967483742 26.948474237118557 23.65182591295648 145-149 20.72699924793181 28.829280521433944 26.66833792930559 23.775382301328655 150-151 21.102756892230577 26.81704260651629 27.769423558897245 24.31077694235589 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.5 19 0.5 20 0.5 21 1.0 22 2.5 23 3.0 24 4.0 25 4.5 26 4.5 27 9.0 28 13.5 29 16.5 30 21.5 31 27.5 32 35.5 33 47.5 34 65.5 35 84.0 36 103.0 37 136.5 38 162.5 39 188.0 40 214.0 41 239.5 42 266.5 43 280.5 44 281.5 45 270.5 46 266.0 47 245.0 48 209.5 49 184.0 50 147.5 51 114.5 52 93.5 53 72.5 54 55.0 55 40.5 56 26.0 57 17.5 58 14.5 59 7.0 60 4.0 61 2.5 62 1.5 63 2.0 64 2.0 65 2.0 66 2.5 67 2.0 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0999999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.01 75-79 1.1900000000000002 80-84 1.325 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.03 125-129 0.01 130-134 0.605 135-139 0.08 140-144 0.05 145-149 0.27499999999999997 150-151 0.25 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72410333584149 99.4 2 0.2257336343115124 0.44999999999999996 3 0.05016302984700275 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.3875 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.625 0.0 0.0 0.0 0.0 98-99 0.775 0.0 0.0 0.0 0.0 100-101 0.875 0.0 0.0 0.0 0.0 102-103 1.075 0.0 0.0 0.0 0.0 104-105 1.4249999999999998 0.0 0.0 0.0 0.0 106-107 1.65 0.0 0.0 0.0 0.0 108-109 1.8625 0.0 0.0 0.0 0.0 110-111 2.1125 0.0 0.0 0.0 0.0 112-113 2.4375 0.0 0.0 0.0 0.0 114-115 2.75 0.0 0.0 0.0 0.0 116-117 3.0 0.0 0.0 0.0 0.0 118-119 3.4000000000000004 0.0 0.0 0.0 0.0 120-121 3.7375 0.0 0.0 0.0 0.0 122-123 4.2375 0.0 0.0 0.0 0.0 124-125 4.6375 0.0 0.0 0.0 0.0 126-127 5.1 0.0 0.0 0.0 0.0 128-129 5.6375 0.0 0.0 0.0 0.0 130-131 6.15 0.0 0.0 0.0 0.0 132-133 6.6625 0.0 0.0 0.0 0.0 134-135 7.25 0.0 0.0 0.0 0.0 136-137 7.824999999999999 0.0 0.0 0.0 0.0 138-139 8.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7166145 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166145_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.519 33.0 33.0 34.0 32.0 34.0 2 32.46975 33.0 33.0 34.0 31.0 34.0 3 32.60675 33.0 33.0 34.0 32.0 34.0 4 32.4245 33.0 33.0 34.0 31.0 34.0 5 32.45425 33.0 33.0 34.0 32.0 34.0 6 36.68875 38.0 38.0 38.0 35.0 38.0 7 36.6065 38.0 38.0 38.0 35.0 38.0 8 36.618 38.0 38.0 38.0 34.0 38.0 9 36.48 38.0 38.0 38.0 34.0 38.0 10-14 36.4048 38.0 38.0 38.0 33.8 38.0 15-19 36.32635 38.0 38.0 38.0 33.8 38.0 20-24 36.080000000000005 38.0 38.0 38.0 33.0 38.0 25-29 36.2693 38.0 38.0 38.0 33.6 38.0 30-34 36.2066 38.0 38.0 38.0 33.4 38.0 35-39 36.05245 38.0 37.8 38.0 32.4 38.0 40-44 35.9409 38.0 37.8 38.0 32.2 38.0 45-49 35.7426 38.0 37.2 38.0 30.2 38.0 50-54 35.674600000000005 38.0 37.0 38.0 29.4 38.0 55-59 35.7214 38.0 37.0 38.0 30.2 38.0 60-64 35.656150000000004 38.0 37.0 38.0 30.2 38.0 65-69 35.56255 38.0 37.0 38.0 29.8 38.0 70-74 35.431200000000004 38.0 37.0 38.0 29.0 38.0 75-79 35.212599999999995 38.0 36.6 38.0 28.2 38.0 80-84 34.904199999999996 38.0 36.0 38.0 26.8 38.0 85-89 34.96085000000001 38.0 36.0 38.0 27.8 38.0 90-94 34.6105 38.0 35.6 38.0 25.6 38.0 95-99 34.4431 38.0 35.2 38.0 25.0 38.0 100-104 34.1344 38.0 34.6 38.0 23.4 38.0 105-109 33.98465 38.0 34.6 38.0 21.4 38.0 110-114 33.66295 38.0 34.0 38.0 19.4 38.0 115-119 33.115100000000005 38.0 33.8 38.0 15.0 38.0 120-124 32.768 38.0 32.2 38.0 15.0 38.0 125-129 32.08659999999999 37.4 31.6 38.0 15.0 38.0 130-134 31.214349999999996 36.4 30.6 38.0 13.4 38.0 135-139 30.33455 36.0 28.0 38.0 12.8 38.0 140-144 29.094899999999996 35.8 25.0 38.0 2.0 38.0 145-149 26.676550000000002 33.2 13.6 38.0 2.0 38.0 150-151 20.946375 26.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 10.0 4 4.0 5 4.0 6 1.0 7 2.0 8 6.0 9 5.0 10 5.0 11 4.0 12 3.0 13 6.0 14 5.0 15 4.0 16 1.0 17 9.0 18 14.0 19 15.0 20 13.0 21 22.0 22 27.0 23 44.0 24 33.0 25 52.0 26 46.0 27 55.0 28 74.0 29 84.0 30 117.0 31 147.0 32 153.0 33 223.0 34 304.0 35 463.0 36 812.0 37 1223.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.596298149074535 16.03301650825413 14.132066033016507 27.238619309654826 2 23.611805902951478 23.56178089044522 35.41770885442722 17.408704352176088 3 20.710355177588795 26.138069034517258 32.61630815407704 20.535267633816908 4 23.461730865432717 35.542771385692845 21.91095547773887 19.084542271135568 5 23.111555777888945 38.26913456728364 20.735367683841922 17.883941970985493 6 18.099999999999998 38.375 24.75 18.775 7 17.424999999999997 15.75 44.975 21.85 8 20.0 22.425 27.525 30.049999999999997 9 21.925 23.95 28.499999999999996 25.624999999999996 10-14 22.705000000000002 29.265 27.029999999999998 21.0 15-19 23.06 28.005000000000003 28.205000000000002 20.73 20-24 22.720000000000002 29.025000000000002 27.715 20.54 25-29 22.055 28.765 28.384999999999998 20.794999999999998 30-34 22.85 28.275 28.99 19.885 35-39 22.77341601240186 28.349252387858183 28.249237385607838 20.62809421413212 40-44 22.785 28.050000000000004 28.64 20.525 45-49 23.29 27.944999999999997 28.720000000000002 20.044999999999998 50-54 22.78 28.38 28.444999999999997 20.395 55-59 22.75 28.110000000000003 28.915000000000003 20.225 60-64 23.28 27.665 28.610000000000003 20.445 65-69 22.93 28.144999999999996 29.075 19.85 70-74 22.814999999999998 27.955000000000002 29.315 19.915 75-79 23.49 28.310000000000002 28.375 19.825 80-84 23.11 28.315 28.325 20.25 85-89 23.435 28.144999999999996 28.48 19.939999999999998 90-94 23.44 28.17 28.549999999999997 19.84 95-99 23.69 28.050000000000004 28.215 20.044999999999998 100-104 23.220805201300326 28.252063015753937 28.54713678419605 19.979994998749685 105-109 24.15207603801901 27.6088044022011 28.61430715357679 19.6248124062031 110-114 23.35317361076377 28.304906717351074 27.99479817936278 20.347121492522383 115-119 23.974999999999998 27.92 28.494999999999997 19.61 120-124 24.05 27.875 28.78 19.295 125-129 23.799999999999997 28.194999999999997 28.075 19.93 130-134 24.54 27.68 28.325 19.455 135-139 24.87 28.115000000000002 27.73 19.285 140-144 25.52 27.61 28.13 18.740000000000002 145-149 25.77 28.095 27.450000000000003 18.685 150-151 27.200000000000003 26.687499999999996 27.4125 18.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.5 21 0.5 22 3.0 23 3.5 24 2.0 25 3.5 26 6.5 27 8.0 28 11.5 29 14.5 30 17.5 31 22.0 32 28.5 33 37.0 34 47.0 35 63.5 36 86.0 37 123.5 38 156.5 39 177.0 40 215.5 41 253.0 42 267.5 43 274.0 44 288.5 45 302.0 46 286.5 47 255.0 48 227.0 49 194.5 50 149.5 51 118.0 52 94.5 53 68.5 54 51.5 55 41.5 56 32.5 57 21.5 58 14.5 59 8.5 60 7.0 61 6.0 62 2.5 63 1.5 64 1.0 65 0.0 66 0.5 67 0.5 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.05 3 0.05 4 0.05 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.015 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.025 105-109 0.05 110-114 0.034999999999999996 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52249308871576 99.0 2 0.42724302588590096 0.8500000000000001 3 0.050263885398341285 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.3625 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.5375 0.0 0.0 0.0 0.0 94-95 0.6 0.0 0.0 0.0 0.0 96-97 0.65 0.0 0.0 0.0 0.0 98-99 0.8375 0.0 0.0 0.0 0.0 100-101 0.95 0.0 0.0 0.0 0.0 102-103 1.1375000000000002 0.0 0.0 0.0 0.0 104-105 1.4874999999999998 0.0 0.0 0.0 0.0 106-107 1.7 0.0 0.0 0.0 0.0 108-109 1.9125 0.0 0.0 0.0 0.0 110-111 2.1625 0.0 0.0 0.0 0.0 112-113 2.4875 0.0 0.0 0.0 0.0 114-115 2.8125 0.0 0.0 0.0 0.0 116-117 3.1 0.0 0.0 0.0 0.0 118-119 3.5250000000000004 0.0 0.0 0.0 0.0 120-121 3.9250000000000003 0.0 0.0 0.0 0.0 122-123 4.4375 0.0 0.0 0.0 0.0 124-125 4.8625 0.0 0.0 0.0 0.0 126-127 5.3375 0.0 0.0 0.0 0.0 128-129 5.887499999999999 0.0 0.0 0.0 0.0 130-131 6.4 0.0 0.0 0.0 0.0 132-133 6.975 0.0 0.0 0.0 0.0 134-135 7.675000000000001 0.0 0.0 0.0 0.0 136-137 8.325 0.0 0.0 0.0 0.0 138-139 8.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACACCCA 10 0.006830828 145.0 4 CACCCAT 10 0.006830828 145.0 5 ATATCCT 10 0.006830828 145.0 3 >>END_MODULE Read 744937 spots for SRR7166145.sra Written 744937 spots for SRR7166145.sra Read 744937 spots for SRR7166145.sra Written 744937 spots for SRR7166145.sra Read 744937 spots for SRR7166145.sra Written 744937 spots for SRR7166145.sra Read 744950 spots for SRR7166145.sra Written 744950 spots for SRR7166145.sra Read 744937 spots for SRR7166145.sra Written 744937 spots for SRR7166145.sra Read 744937 spots for SRR7166145.sra Written 744937 spots for SRR7166145.sra Read 744937 spots for SRR7166145.sra Written 744937 spots for SRR7166145.sra Read 744937 spots for SRR7166145.sra Written 744937 spots for SRR7166145.sra Read 744937 spots for SRR7166145.sra Written 744937 spots for SRR7166145.sra Read 744937 spots for SRR7166145.sra Written 744937 spots for SRR7166145.sra Read 744937 spots for SRR7166145.sra Written 744937 spots for SRR7166145.sra Read 744937 spots for SRR7166145.sra Written 744937 spots for SRR7166145.sra Read 744937 spots for SRR7166145.sra Written 744937 spots for SRR7166145.sra Read 744937 spots for SRR7166145.sra Written 744937 spots for SRR7166145.sra Read 744937 spots for SRR7166145.sra Written 744937 spots for SRR7166145.sra Read 744937 spots for SRR7166145.sra Written 744937 spots for SRR7166145.sra Read 744937 spots for SRR7166145.sra Written 744937 spots for SRR7166145.sra Read 744937 spots for SRR7166145.sra Written 744937 spots for SRR7166145.sra Read 744937 spots for SRR7166145.sra Written 744937 spots for SRR7166145.sra Read 744937 spots for SRR7166145.sra Written 744937 spots for SRR7166145.sra SRR ids: ['SRR7166145.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_m1vpwq4d SRR7166145.sra spots: 14898753 blocks: [[1, 744937], [744938, 1489874], [1489875, 2234811], [2234812, 2979748], [2979749, 3724685], [3724686, 4469622], [4469623, 5214559], [5214560, 5959496], [5959497, 6704433], [6704434, 7449370], [7449371, 8194307], [8194308, 8939244], [8939245, 9684181], [9684182, 10429118], [10429119, 11174055], [11174056, 11918992], [11918993, 12663929], [12663930, 13408866], [13408867, 14153803], [14153804, 14898753]] SRR7166145 file size 5026998 SRR7166145 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166145 SRR7166145_1.fastq SRR7166145_2.fastq Input file: SRR7166145_1.fastq Paired file: SRR7166145_2.fastq trimmed: SRR7166145-trimmed-pair1.fastq, SRR7166145-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 16:31:59 2025 >> started Fri Feb 14 16:32:16 2025 >> done (16.655s) 14898753 read pairs processed; of these: 24573 ( 0.16%) short read pairs filtered out after trimming by size control 23178 ( 0.16%) empty read pairs filtered out after trimming by size control 14851002 (99.68%) read pairs available; of these: 10465584 (70.47%) trimmed read pairs available after processing 4385418 (29.53%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 8 0.00% 20 8 0.00% 21 5 0.00% 22 9 0.00% 23 7 0.00% 24 11 0.00% 25 7 0.00% 26 5 0.00% 27 14 0.00% 28 10 0.00% 29 15 0.00% 30 11 0.00% 31 9 0.00% 32 6 0.00% 33 15 0.00% 34 7 0.00% 35 15 0.00% 36 11 0.00% 37 17 0.00% 38 12 0.00% 39 20 0.00% 40 27 0.00% 41 35 0.00% 42 25 0.00% 43 25 0.00% 44 25 0.00% 45 29 0.00% 46 44 0.00% 47 52 0.00% 48 50 0.00% 49 68 0.00% 50 75 0.00% 51 70 0.00% 52 92 0.00% 53 110 0.00% 54 115 0.00% 55 141 0.00% 56 178 0.00% 57 180 0.00% 58 190 0.00% 59 258 0.00% 60 258 0.00% 61 328 0.00% 62 422 0.00% 63 400 0.00% 64 470 0.00% 65 489 0.00% 66 580 0.00% 67 655 0.00% 68 736 0.00% 69 836 0.01% 70 1075 0.01% 71 1154 0.01% 72 1318 0.01% 73 1506 0.01% 74 1732 0.01% 75 1872 0.01% 76 2086 0.01% 77 2327 0.02% 78 2684 0.02% 79 2951 0.02% 80 3279 0.02% 81 3836 0.03% 82 4420 0.03% 83 5041 0.03% 84 6257 0.04% 85 7285 0.05% 86 7249 0.05% 87 8028 0.05% 88 8477 0.06% 89 8754 0.06% 90 9617 0.06% 91 10698 0.07% 92 11656 0.08% 93 12759 0.09% 94 13478 0.09% 95 14364 0.10% 96 15196 0.10% 97 16031 0.11% 98 16624 0.11% 99 17752 0.12% 100 19154 0.13% 101 20507 0.14% 102 21973 0.15% 103 23409 0.16% 104 24769 0.17% 105 26380 0.18% 106 27195 0.18% 107 27995 0.19% 108 28850 0.19% 109 30247 0.20% 110 32329 0.22% 111 33719 0.23% 112 35977 0.24% 113 38580 0.26% 114 41370 0.28% 115 43203 0.29% 116 44857 0.30% 117 46694 0.31% 118 48942 0.33% 119 50884 0.34% 120 52778 0.36% 121 56121 0.38% 122 59467 0.40% 123 62293 0.42% 124 66523 0.45% 125 70232 0.47% 126 73914 0.50% 127 77100 0.52% 128 81187 0.55% 129 85498 0.58% 130 90046 0.61% 131 95700 0.64% 132 103244 0.70% 133 111481 0.75% 134 121355 0.82% 135 131792 0.89% 136 137623 0.93% 137 143543 0.97% 138 153924 1.04% 139 167771 1.13% 140 187039 1.26% 141 187745 1.26% 142 206261 1.39% 143 229380 1.54% 144 262368 1.77% 145 312866 2.11% 146 383526 2.58% 147 500607 3.37% 148 695444 4.68% 149 1199126 8.07% 150 3465899 23.34% 151 4385418 29.53% 14851002 reads passed initial QC criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=2.79 fanout-score-rank=23 prefix-density=0.44 prefix-fanout=2.6 sequence=CCACACTTGCAG criterion=fanout-score sequence-density=0.08 sequence-density-rank=27 fanout-score=12.74 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=3.3 sequence=TTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGT criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=3.35 fanout-score-rank=30 prefix-density=0.61 prefix-fanout=1.9 sequence=TGCAAATGTGGCATGTACCCTGACTTAGGTTTCTCAGAGA criterion=fanout-score sequence-density=0.10 sequence-density-rank=34 fanout-score=27.56 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=9.3 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7166145 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 16:33:00 Started mapping on | Feb 14 16:33:00 Finished on | Feb 14 16:34:44 Mapping speed, Million of reads per hour | 514.07 Number of input reads | 14851002 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 14061772 Uniquely mapped reads % | 94.69% Average mapped length | 287.77 Number of splices: Total | 13027380 Number of splices: Annotated (sjdb) | 12785605 Number of splices: GT/AG | 12817198 Number of splices: GC/AG | 164425 Number of splices: AT/AC | 10230 Number of splices: Non-canonical | 35527 Mismatch rate per base, % | 0.46% Deletion rate per base | 0.03% Deletion average length | 2.34 Insertion rate per base | 0.02% Insertion average length | 2.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 371418 % of reads mapped to multiple loci | 2.50% Number of reads mapped to too many loci | 28097 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.54% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 439867 439867 439867 N_multimapping 371418 371418 371418 N_noFeature 454057 13861897 578744 N_ambiguous 146631 1046 70672 UnstrandedReadsAssigned:13461084 PositiveStrandReadsAssigned:198829 NegativeStrandReadsAssigned:13412356 Dataset is classified negative stranded MeadianReadLen=149 20thPercentileLength=137 echo kmer=133 SRR7166145 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166145-trimmed-pair1.fastq SRR7166145-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,851,002 reads, 13,334,343 reads pseudoaligned [quant] estimated average fragment length: 221.838 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,078 rounds 52401 SRR7166145.ke.tsv 34699 SRR7166145.se.tsv 87100 total ==> SRR7166145.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1797.16 984 40.5941 Potri.005G024800.1.v4.1 1035 814.162 144 13.1132 Potri.004G059700.1.v4.1 961 740.172 31 3.10517 Potri.007G009000.2.v4.1 1416 1195.16 0 0 Potri.003G141000.2.v4.1 2943 2722.16 605 16.4777 Potri.016G087400.1.v4.1 270 88.3079 986 827.814 Potri.015G069301.1.v4.1 564 345.984 0 0 Potri.010G195200.1.v4.1 1773 1552.16 323 15.4284 Potri.012G127500.1.v4.1 977 756.172 5390 528.474 ==> SRR7166145.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 106 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 559 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 300 SRR7166145 completed mapping pipeline successfully