Starting /dee2/code/volunteer_pipeline.sh SRR7166146 current disk space = 3111838998528 free memory = 1575188376 SRR7166146 SRAfilesize 961d204f52cdbd9466ad34a233db41a9 SRR7166146.sra SRR7166146.sra file validated SRR7166146 is paired end SRR7166146 is conventional basespace SRR7166146 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166146_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.2525 33.0 18.0 33.0 18.0 34.0 2 30.059 31.0 28.0 33.0 25.0 34.0 3 31.7555 33.0 31.0 33.0 29.0 34.0 4 31.726 33.0 31.0 33.0 29.0 33.0 5 32.5085 33.0 33.0 33.0 32.0 34.0 6 36.82275 38.0 37.0 38.0 35.0 38.0 7 36.6815 38.0 37.0 38.0 34.0 38.0 8 37.22875 38.0 38.0 38.0 36.0 38.0 9 37.514 38.0 38.0 38.0 37.0 38.0 10-14 37.53405 38.0 38.0 38.0 37.4 38.0 15-19 37.5412 38.0 38.0 38.0 37.4 38.0 20-24 37.5264 38.0 38.0 38.0 37.2 38.0 25-29 37.5151 38.0 38.0 38.0 37.6 38.0 30-34 37.50655 38.0 38.0 38.0 37.0 38.0 35-39 37.50795 38.0 38.0 38.0 37.0 38.0 40-44 37.483000000000004 38.0 38.0 38.0 37.2 38.0 45-49 37.446000000000005 38.0 38.0 38.0 37.0 38.0 50-54 37.034549999999996 38.0 38.0 38.0 36.6 38.0 55-59 36.579750000000004 38.0 38.0 38.0 36.0 38.0 60-64 36.8493 38.0 38.0 38.0 36.0 38.0 65-69 37.1544 38.0 38.0 38.0 36.0 38.0 70-74 37.02715 38.0 38.0 38.0 35.8 38.0 75-79 36.989599999999996 38.0 38.0 38.0 36.0 38.0 80-84 36.888349999999996 38.0 38.0 38.0 35.6 38.0 85-89 36.82165 38.0 38.0 38.0 35.4 38.0 90-94 36.79805 38.0 38.0 38.0 35.0 38.0 95-99 36.624550000000006 38.0 38.0 38.0 34.0 38.0 100-104 36.37325 38.0 38.0 38.0 34.0 38.0 105-109 35.8754 38.0 37.4 38.0 33.0 38.0 110-114 36.060249999999996 38.0 37.0 38.0 32.8 38.0 115-119 36.008750000000006 38.0 37.2 38.0 33.2 38.0 120-124 35.78845 38.0 37.0 38.0 31.4 38.0 125-129 35.44185 38.0 36.2 38.0 30.2 38.0 130-134 35.463499999999996 38.0 36.0 38.0 30.6 38.0 135-139 35.1648 38.0 36.0 38.0 29.8 38.0 140-144 34.7605 38.0 35.2 38.0 27.6 38.0 145-149 34.23325 38.0 35.0 38.0 26.0 38.0 150-151 30.974125 36.5 31.5 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 3.0 18 3.0 19 4.0 20 1.0 21 5.0 22 7.0 23 7.0 24 6.0 25 6.0 26 12.0 27 12.0 28 32.0 29 42.0 30 39.0 31 54.0 32 82.0 33 104.0 34 167.0 35 261.0 36 756.0 37 2395.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.6585117227319 20.998980632008156 11.773700305810397 32.56880733944954 2 19.425 25.924999999999997 35.15 19.5 3 17.125 33.050000000000004 26.75 23.075000000000003 4 21.675 38.175 21.775 18.375 5 18.85327991987982 40.41061592388583 22.108162243365047 18.627941912869304 6 16.7 37.075 24.925 21.3 7 12.8 19.975 46.300000000000004 20.925 8 17.325 21.7 28.349999999999998 32.625 9 18.175 21.675 30.625000000000004 29.525000000000002 10-14 19.205 30.659999999999997 26.665 23.47 15-19 19.435 29.494999999999997 27.875 23.195 20-24 19.49 29.875 27.650000000000002 22.985 25-29 19.205 30.115 27.125 23.555 30-34 19.139999999999997 29.815 27.894999999999996 23.150000000000002 35-39 19.45 29.585 27.67 23.294999999999998 40-44 19.605 29.95 27.339999999999996 23.105 45-49 19.85 28.9 28.015 23.235 50-54 19.983851433185304 29.64271295922487 27.472749293500204 22.900686314089626 55-59 19.403289038236345 30.273407667634032 27.182933659182325 23.140369634947305 60-64 19.879973775782943 29.27026072923496 27.595945332593676 23.253820162388422 65-69 19.620886265879765 28.968690607182157 27.908372511753527 23.502050615184555 70-74 19.81981981981982 29.614614614614617 27.26226226226226 23.303303303303302 75-79 19.770931279383817 29.238771631489445 27.643292987896366 23.34700410123037 80-84 19.610980549027452 28.736436821841092 28.48142407120356 23.171158557927896 85-89 19.725986299314965 29.741487074353717 27.2213610680534 23.311165558277914 90-94 19.725 29.56 27.834999999999997 22.88 95-99 20.17105131539462 29.648894668400523 27.27818345503651 22.90187056116835 100-104 19.92077817890092 29.718210990774168 27.426795026073002 22.934215804251906 105-109 20.0030330603579 29.284197755535335 27.499747244970173 23.21302193913659 110-114 20.70431694262418 29.058076134260418 27.377319793907258 22.860287129208142 115-119 20.397111913357403 29.53770557561171 27.446851183313274 22.61833132771761 120-124 19.613922784556912 29.590918183636727 27.250450090018003 23.544708941788357 125-129 20.620364802565643 29.41471236720786 26.7288033674083 23.2361194628182 130-134 20.517181013354673 29.155204321512528 27.07447606662332 23.25313859850948 135-139 20.70810621593239 29.10436565484823 26.849027354103118 23.338500775116266 140-144 21.279255851170234 28.85077015403081 26.835367073414684 23.034606921384277 145-149 21.408563425370147 29.02160864345738 26.230492196878753 23.339335734293716 150-151 21.028914757791963 29.202653648767058 25.973213168106145 23.795218425334834 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.0 17 1.0 18 1.5 19 0.5 20 0.0 21 2.0 22 3.0 23 3.5 24 4.5 25 3.5 26 7.0 27 14.0 28 17.0 29 19.5 30 26.5 31 37.0 32 46.5 33 65.0 34 89.5 35 111.0 36 123.0 37 136.5 38 163.0 39 183.0 40 210.0 41 233.0 42 234.0 43 246.0 44 263.5 45 258.5 46 241.0 47 227.0 48 206.0 49 190.5 50 160.0 51 118.5 52 92.0 53 66.5 54 50.0 55 38.0 56 31.0 57 22.5 58 14.5 59 12.0 60 7.5 61 4.5 62 5.0 63 3.0 64 1.5 65 1.5 66 0.5 67 1.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.9 2 0.0 3 0.0 4 0.0 5 0.15 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.9199999999999999 55-59 1.7950000000000002 60-64 0.855 65-69 0.03 70-74 0.1 75-79 0.03 80-84 0.005 85-89 0.005 90-94 0.0 95-99 0.03 100-104 0.27999999999999997 105-109 1.09 110-114 0.045 115-119 0.27999999999999997 120-124 0.02 125-129 0.22 130-134 0.034999999999999996 135-139 0.015 140-144 0.02 145-149 0.04 150-151 0.13749999999999998 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5475113122172 99.0 2 0.35193564605329314 0.7000000000000001 3 0.10055304172951231 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.36250000000000004 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.6875 0.0 0.0 0.0 0.0 96-97 0.8500000000000001 0.0 0.0 0.0 0.0 98-99 1.0375 0.0 0.0 0.0 0.0 100-101 1.1375000000000002 0.0 0.0 0.0 0.0 102-103 1.2999999999999998 0.0 0.0 0.0 0.0 104-105 1.4625 0.0 0.0 0.0 0.0 106-107 1.75 0.0 0.0 0.0 0.0 108-109 2.0375 0.0 0.0 0.0 0.0 110-111 2.425 0.0 0.0 0.0 0.0 112-113 2.775 0.0 0.0 0.0 0.0 114-115 3.0875000000000004 0.0 0.0 0.0 0.0 116-117 3.5125 0.0 0.0 0.0 0.0 118-119 3.9 0.0 0.0 0.0 0.0 120-121 4.2875 0.0 0.0 0.0 0.0 122-123 4.725 0.0 0.0 0.0 0.0 124-125 5.2125 0.0 0.0 0.0 0.0 126-127 5.7125 0.0 0.0 0.0 0.0 128-129 6.125 0.0 0.0 0.0 0.0 130-131 6.550000000000001 0.0 0.0 0.0 0.0 132-133 7.175 0.0 0.0 0.0 0.0 134-135 7.825 0.0 0.0 0.0 0.0 136-137 8.5125 0.0 0.0 0.0 0.0 138-139 9.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAATTGC 10 0.006830828 145.0 4 GCAGCTC 10 0.006830828 145.0 2 AATTGCT 10 0.006830828 145.0 5 >>END_MODULE SRR7166146 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166146_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.704 33.0 33.0 34.0 32.0 34.0 2 32.75275 33.0 33.0 34.0 32.0 34.0 3 32.83875 33.0 33.0 34.0 32.0 34.0 4 32.85825 33.0 33.0 34.0 32.0 34.0 5 32.769 33.0 33.0 34.0 32.0 34.0 6 37.11725 38.0 38.0 38.0 36.0 38.0 7 37.1515 38.0 38.0 38.0 36.0 38.0 8 37.029 38.0 38.0 38.0 36.0 38.0 9 37.08 38.0 38.0 38.0 36.0 38.0 10-14 37.06635 38.0 38.0 38.0 36.0 38.0 15-19 36.999100000000006 38.0 38.0 38.0 36.0 38.0 20-24 36.918899999999994 38.0 38.0 38.0 36.0 38.0 25-29 36.8839 38.0 38.0 38.0 35.4 38.0 30-34 36.8065 38.0 38.0 38.0 35.6 38.0 35-39 36.7363 38.0 38.0 38.0 35.0 38.0 40-44 36.6682 38.0 38.0 38.0 34.8 38.0 45-49 36.5226 38.0 38.0 38.0 34.0 38.0 50-54 36.3142 38.0 38.0 38.0 33.6 38.0 55-59 36.1038 38.0 37.0 38.0 33.0 38.0 60-64 36.11280000000001 38.0 37.0 38.0 33.0 38.0 65-69 36.08905 38.0 37.0 38.0 32.2 38.0 70-74 35.82985 38.0 37.0 38.0 31.0 38.0 75-79 35.6622 38.0 37.0 38.0 29.4 38.0 80-84 35.55780000000001 38.0 36.4 38.0 29.4 38.0 85-89 35.28490000000001 38.0 36.0 38.0 29.0 38.0 90-94 35.07940000000001 38.0 36.0 38.0 28.4 38.0 95-99 34.77315 38.0 35.6 38.0 27.0 38.0 100-104 34.51995 38.0 35.0 38.0 25.8 38.0 105-109 34.223949999999995 38.0 34.4 38.0 23.6 38.0 110-114 33.830200000000005 38.0 34.0 38.0 21.0 38.0 115-119 33.327749999999995 38.0 33.8 38.0 15.0 38.0 120-124 32.902 37.8 33.0 38.0 15.0 38.0 125-129 32.3664 37.0 31.6 38.0 15.0 38.0 130-134 31.61705 36.4 30.6 38.0 14.2 38.0 135-139 30.8334 36.0 28.0 38.0 13.4 38.0 140-144 29.4986 35.2 24.0 38.0 8.6 38.0 145-149 28.08225 34.6 20.6 38.0 2.0 38.0 150-151 23.195875 29.5 2.0 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 2.0 5 0.0 6 0.0 7 0.0 8 1.0 9 3.0 10 2.0 11 1.0 12 4.0 13 4.0 14 4.0 15 9.0 16 11.0 17 7.0 18 13.0 19 12.0 20 10.0 21 17.0 22 17.0 23 26.0 24 16.0 25 47.0 26 37.0 27 45.0 28 61.0 29 73.0 30 96.0 31 133.0 32 147.0 33 227.0 34 357.0 35 549.0 36 969.0 37 1099.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.525 16.25 14.799999999999999 28.425 2 23.425 22.925 36.325 17.325 3 20.275000000000002 26.924999999999997 32.2 20.599999999999998 4 23.849999999999998 36.449999999999996 21.45 18.25 5 23.400000000000002 36.65 22.25 17.7 6 17.4 37.425000000000004 24.85 20.325 7 17.025000000000002 15.7 47.675 19.6 8 20.674999999999997 21.7 28.075 29.549999999999997 9 22.0 23.525 28.275 26.200000000000003 10-14 22.065 29.099999999999998 27.55 21.285 15-19 22.900000000000002 28.625 28.349999999999998 20.125 20-24 22.89 28.77 27.91 20.43 25-29 22.830000000000002 27.884999999999998 29.060000000000002 20.225 30-34 22.830000000000002 28.285 28.294999999999998 20.59 35-39 23.14 27.875 28.975 20.01 40-44 22.770000000000003 28.189999999999998 28.57 20.47 45-49 23.27 28.175 28.215 20.34 50-54 22.830000000000002 28.275 28.99 19.905 55-59 22.905 28.21 28.685 20.200000000000003 60-64 23.07 28.09 28.38 20.46 65-69 23.485 27.91 28.82 19.785 70-74 23.400000000000002 28.325 28.249999999999996 20.025000000000002 75-79 23.455000000000002 27.55 28.835 20.16 80-84 22.55 28.225 28.689999999999998 20.535 85-89 23.695 27.639999999999997 28.655 20.01 90-94 23.025000000000002 27.725 28.71 20.54 95-99 23.32 28.439999999999998 28.105000000000004 20.135 100-104 23.95 28.355000000000004 28.28 19.415 105-109 23.75 27.525 28.854999999999997 19.869999999999997 110-114 23.385 28.155 28.54 19.919999999999998 115-119 24.085 29.005 27.445000000000004 19.465 120-124 23.830000000000002 28.000000000000004 28.34 19.830000000000002 125-129 24.455 27.944999999999997 28.29 19.31 130-134 24.495 28.03 28.155 19.32 135-139 24.18 28.134999999999998 28.435 19.25 140-144 25.085 28.34 27.639999999999997 18.935 145-149 25.655 28.194999999999997 27.095000000000002 19.055 150-151 26.069552164123095 27.270452839629723 27.708281210908183 18.951713785339006 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.5 21 2.0 22 3.5 23 3.5 24 3.5 25 4.0 26 5.0 27 8.0 28 9.0 29 11.0 30 13.5 31 19.5 32 38.0 33 59.0 34 64.0 35 70.5 36 93.0 37 116.5 38 145.5 39 183.0 40 212.5 41 238.5 42 262.0 43 286.5 44 284.5 45 272.5 46 266.0 47 232.5 48 203.5 49 184.5 50 156.5 51 133.5 52 107.5 53 82.5 54 60.0 55 41.0 56 41.0 57 29.5 58 12.5 59 9.5 60 9.0 61 5.5 62 5.0 63 4.5 64 2.5 65 1.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64841788046208 99.2 2 0.25113008538422904 0.5 3 0.10045203415369162 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.36250000000000004 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.5249999999999999 0.0 0.0 0.0 0.0 94-95 0.65 0.0 0.0 0.0 0.0 96-97 0.8 0.0 0.0 0.0 0.0 98-99 0.9875 0.0 0.0 0.0 0.0 100-101 1.0875 0.0 0.0 0.0 0.0 102-103 1.225 0.0 0.0 0.0 0.0 104-105 1.3625 0.0 0.0 0.0 0.0 106-107 1.65 0.0 0.0 0.0 0.0 108-109 1.925 0.0 0.0 0.0 0.0 110-111 2.3 0.0 0.0 0.0 0.0 112-113 2.6375 0.0 0.0 0.0 0.0 114-115 2.925 0.0 0.0 0.0 0.0 116-117 3.3 0.0 0.0 0.0 0.0 118-119 3.6625 0.0 0.0 0.0 0.0 120-121 4.0625 0.0 0.0 0.0 0.0 122-123 4.475 0.0 0.0 0.0 0.0 124-125 4.8625 0.0 0.0 0.0 0.0 126-127 5.2375 0.0 0.0 0.0 0.0 128-129 5.550000000000001 0.0 0.0 0.0 0.0 130-131 5.975 0.0 0.0 0.0 0.0 132-133 6.575 0.0 0.0 0.0 0.0 134-135 7.1625 0.0 0.0 0.0 0.0 136-137 7.7875 0.0 0.0 0.0 0.0 138-139 8.6125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACCGTC 10 0.006830828 145.0 3 CAAGTTA 10 0.006830828 145.0 9 >>END_MODULE Read 756472 spots for SRR7166146.sra Written 756472 spots for SRR7166146.sra Read 756472 spots for SRR7166146.sra Written 756472 spots for SRR7166146.sra Read 756472 spots for SRR7166146.sra Written 756472 spots for SRR7166146.sra Read 756472 spots for SRR7166146.sra Written 756472 spots for SRR7166146.sra Read 756472 spots for SRR7166146.sra Written 756472 spots for SRR7166146.sra Read 756472 spots for SRR7166146.sra Written 756472 spots for SRR7166146.sra Read 756472 spots for SRR7166146.sra Written 756472 spots for SRR7166146.sra Read 756472 spots for SRR7166146.sra Written 756472 spots for SRR7166146.sra Read 756472 spots for SRR7166146.sra Written 756472 spots for SRR7166146.sra Read 756472 spots for SRR7166146.sra Written 756472 spots for SRR7166146.sra Read 756472 spots for SRR7166146.sra Written 756472 spots for SRR7166146.sra Read 756472 spots for SRR7166146.sra Written 756472 spots for SRR7166146.sra Read 756472 spots for SRR7166146.sra Written 756472 spots for SRR7166146.sra Read 756482 spots for SRR7166146.sra Written 756482 spots for SRR7166146.sra Read 756472 spots for SRR7166146.sra Written 756472 spots for SRR7166146.sra Read 756472 spots for SRR7166146.sra Written 756472 spots for SRR7166146.sra Read 756472 spots for SRR7166146.sra Written 756472 spots for SRR7166146.sra Read 756472 spots for SRR7166146.sra Written 756472 spots for SRR7166146.sra Read 756472 spots for SRR7166146.sra Written 756472 spots for SRR7166146.sra Read 756472 spots for SRR7166146.sra Written 756472 spots for SRR7166146.sra SRR ids: ['SRR7166146.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_63x6wmob SRR7166146.sra spots: 15129450 blocks: [[1, 756472], [756473, 1512944], [1512945, 2269416], [2269417, 3025888], [3025889, 3782360], [3782361, 4538832], [4538833, 5295304], [5295305, 6051776], [6051777, 6808248], [6808249, 7564720], [7564721, 8321192], [8321193, 9077664], [9077665, 9834136], [9834137, 10590608], [10590609, 11347080], [11347081, 12103552], [12103553, 12860024], [12860025, 13616496], [13616497, 14372968], [14372969, 15129450]] SRR7166146 file size 5105173 SRR7166146 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166146 SRR7166146_1.fastq SRR7166146_2.fastq Input file: SRR7166146_1.fastq Paired file: SRR7166146_2.fastq trimmed: SRR7166146-trimmed-pair1.fastq, SRR7166146-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 16:30:37 2025 >> started Fri Feb 14 16:30:54 2025 >> done (17.042s) 15129450 read pairs processed; of these: 10371 ( 0.07%) short read pairs filtered out after trimming by size control 6549 ( 0.04%) empty read pairs filtered out after trimming by size control 15112530 (99.89%) read pairs available; of these: 6949270 (45.98%) trimmed read pairs available after processing 8163260 (54.02%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 5 0.00% 20 1 0.00% 21 4 0.00% 22 5 0.00% 23 5 0.00% 24 7 0.00% 25 3 0.00% 26 5 0.00% 27 2 0.00% 28 5 0.00% 29 8 0.00% 30 4 0.00% 31 4 0.00% 32 9 0.00% 33 5 0.00% 34 9 0.00% 35 8 0.00% 36 5 0.00% 37 9 0.00% 38 10 0.00% 39 11 0.00% 40 12 0.00% 41 10 0.00% 42 17 0.00% 43 15 0.00% 44 11 0.00% 45 22 0.00% 46 25 0.00% 47 26 0.00% 48 40 0.00% 49 48 0.00% 50 59 0.00% 51 46 0.00% 52 67 0.00% 53 71 0.00% 54 63 0.00% 55 90 0.00% 56 79 0.00% 57 113 0.00% 58 130 0.00% 59 140 0.00% 60 161 0.00% 61 201 0.00% 62 243 0.00% 63 223 0.00% 64 269 0.00% 65 290 0.00% 66 349 0.00% 67 417 0.00% 68 486 0.00% 69 553 0.00% 70 640 0.00% 71 700 0.00% 72 870 0.01% 73 1013 0.01% 74 1062 0.01% 75 1268 0.01% 76 1493 0.01% 77 1626 0.01% 78 1808 0.01% 79 2035 0.01% 80 2280 0.02% 81 2666 0.02% 82 3084 0.02% 83 3532 0.02% 84 4366 0.03% 85 5068 0.03% 86 5295 0.04% 87 6036 0.04% 88 6515 0.04% 89 7061 0.05% 90 7719 0.05% 91 8361 0.06% 92 9274 0.06% 93 10090 0.07% 94 11136 0.07% 95 11833 0.08% 96 12597 0.08% 97 13289 0.09% 98 14167 0.09% 99 15303 0.10% 100 16067 0.11% 101 16930 0.11% 102 18083 0.12% 103 19547 0.13% 104 20455 0.14% 105 22035 0.15% 106 22745 0.15% 107 23420 0.15% 108 24368 0.16% 109 25712 0.17% 110 26814 0.18% 111 28477 0.19% 112 29829 0.20% 113 31942 0.21% 114 33416 0.22% 115 35248 0.23% 116 36947 0.24% 117 37439 0.25% 118 38616 0.26% 119 39394 0.26% 120 40441 0.27% 121 42712 0.28% 122 44412 0.29% 123 46881 0.31% 124 48443 0.32% 125 50481 0.33% 126 52314 0.35% 127 53536 0.35% 128 54804 0.36% 129 55954 0.37% 130 58504 0.39% 131 59923 0.40% 132 63004 0.42% 133 66339 0.44% 134 69021 0.46% 135 72535 0.48% 136 75692 0.50% 137 79788 0.53% 138 83015 0.55% 139 86928 0.58% 140 91736 0.61% 141 98550 0.65% 142 108198 0.72% 143 116970 0.77% 144 132695 0.88% 145 153656 1.02% 146 185709 1.23% 147 237835 1.57% 148 341986 2.26% 149 622491 4.12% 150 2930643 19.39% 151 8163260 54.02% 15112530 reads passed initial QC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=3.27 fanout-score-rank=16 prefix-density=0.84 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACCAGAGTTCATCTCAGACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=20.94 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=4.2 sequence=TTTTGGATTTTTTCCGCTTTGATATTCTCTGCATCCTATTTAGGGCTATTGATATTTAACAAATATCCAGCAAAGGTTTTTCCAGGAGATGTTGGAACTCTACCAATTGGAGCTTTCTTAGCTGTCTTAGCAGTAGTTTATAAGGAATATATCCCATTTTTAGTTATAATGATGCCTTATGTGATAGATGCCTCTTTAAAATATCTAAGTGCTGGGGTTATGAGTAGGGATGAGCATAAACCAACAACTCTCAAAGAAGATGGGAAGCTATACTATATAGGTGGCTATCTATCCCTACCAAGGCTTATATTGAAGTATAAACCAATGAGAGAGCCTCACTTAGTTACAGTTTTATGGATAATTGGGATATTCTTTGGTATAGTTGGGATTTTAATATCATTAATAGCATGATGGTGATTGTTTTGAAAACCATAGGAGGAAACCTCC criterion=sequence-density sequence-density=0.79 sequence-density-rank=1 fanout-score=2.40 fanout-score-rank=23 prefix-density=0.81 prefix-fanout=2.3 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=30.82 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=1.9 sequence=CTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCC SRR7166146 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 16:31:48 Started mapping on | Feb 14 16:32:00 Finished on | Feb 14 16:34:07 Mapping speed, Million of reads per hour | 428.39 Number of input reads | 15112530 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 14125797 Uniquely mapped reads % | 93.47% Average mapped length | 292.13 Number of splices: Total | 13600185 Number of splices: Annotated (sjdb) | 13318715 Number of splices: GT/AG | 13376132 Number of splices: GC/AG | 173365 Number of splices: AT/AC | 11391 Number of splices: Non-canonical | 39297 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.04% Deletion average length | 2.31 Insertion rate per base | 0.02% Insertion average length | 2.20 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 405384 % of reads mapped to multiple loci | 2.68% Number of reads mapped to too many loci | 41449 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.50% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 592246 592246 592246 N_multimapping 405384 405384 405384 N_noFeature 479056 13963941 560645 N_ambiguous 150256 982 69417 UnstrandedReadsAssigned:13496485 PositiveStrandReadsAssigned:160874 NegativeStrandReadsAssigned:13495735 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7166146 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166146-trimmed-pair1.fastq SRR7166146-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,112,530 reads, 13,407,552 reads pseudoaligned [quant] estimated average fragment length: 227.997 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,063 rounds 52401 SRR7166146.ke.tsv 34699 SRR7166146.se.tsv 87100 total ==> SRR7166146.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1791 1015 38.4451 Potri.005G024800.1.v4.1 1035 808.003 296 24.8513 Potri.004G059700.1.v4.1 961 734.035 31 2.86494 Potri.007G009000.2.v4.1 1416 1189 0 0 Potri.003G141000.2.v4.1 2943 2716 532.389 13.2975 Potri.016G087400.1.v4.1 270 88.6231 823.555 630.401 Potri.015G069301.1.v4.1 564 341.377 0 0 Potri.010G195200.1.v4.1 1773 1546 257 11.277 Potri.012G127500.1.v4.1 977 750.025 3313 299.652 ==> SRR7166146.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 45 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 552 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 375 SRR7166146 completed mapping pipeline successfully