Starting /dee2/code/volunteer_pipeline.sh SRR7166147 current disk space = 3111836131328 free memory = 1473476240 SRR7166147 SRAfilesize 30892059bd6e245ac8b368ca95d9a6d8 SRR7166147.sra SRR7166147.sra file validated SRR7166147 is paired end SRR7166147 is conventional basespace SRR7166147 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166147_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.72675 33.0 30.0 33.0 18.0 34.0 2 32.007 33.0 31.0 34.0 29.0 34.0 3 31.6985 33.0 31.0 33.0 29.0 34.0 4 32.761 33.0 33.0 34.0 32.0 34.0 5 32.96725 33.0 33.0 34.0 32.0 34.0 6 36.621 38.0 37.0 38.0 34.0 38.0 7 36.89275 38.0 37.0 38.0 35.0 38.0 8 37.361 38.0 38.0 38.0 37.0 38.0 9 37.5595 38.0 38.0 38.0 37.0 38.0 10-14 37.572250000000004 38.0 38.0 38.0 37.8 38.0 15-19 37.5538 38.0 38.0 38.0 38.0 38.0 20-24 37.582 38.0 38.0 38.0 38.0 38.0 25-29 37.5238 38.0 38.0 38.0 38.0 38.0 30-34 37.53845 38.0 38.0 38.0 38.0 38.0 35-39 37.51255 38.0 38.0 38.0 38.0 38.0 40-44 37.4895 38.0 38.0 38.0 37.2 38.0 45-49 37.4708 38.0 38.0 38.0 37.0 38.0 50-54 37.394400000000005 38.0 38.0 38.0 37.0 38.0 55-59 37.08265 38.0 38.0 38.0 36.6 38.0 60-64 37.22385 38.0 38.0 38.0 36.8 38.0 65-69 37.2446 38.0 38.0 38.0 37.0 38.0 70-74 37.16425 38.0 38.0 38.0 36.0 38.0 75-79 37.17335 38.0 38.0 38.0 36.2 38.0 80-84 37.0225 38.0 38.0 38.0 36.0 38.0 85-89 36.9288 38.0 38.0 38.0 35.8 38.0 90-94 36.792649999999995 38.0 38.0 38.0 35.4 38.0 95-99 36.79665 38.0 38.0 38.0 35.0 38.0 100-104 36.64919999999999 38.0 38.0 38.0 34.8 38.0 105-109 36.50619999999999 38.0 38.0 38.0 34.0 38.0 110-114 36.45225 38.0 38.0 38.0 34.0 38.0 115-119 36.2529 38.0 37.6 38.0 33.8 38.0 120-124 36.032300000000006 38.0 37.6 38.0 33.2 38.0 125-129 35.8923 38.0 37.0 38.0 33.0 38.0 130-134 35.7251 38.0 36.4 38.0 31.4 38.0 135-139 35.5889 38.0 36.0 38.0 31.0 38.0 140-144 35.18985 38.0 35.8 38.0 30.0 38.0 145-149 34.827600000000004 38.0 36.0 38.0 29.4 38.0 150-151 31.5155 36.5 31.5 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 1.0 13 0.0 14 0.0 15 1.0 16 1.0 17 1.0 18 3.0 19 0.0 20 4.0 21 3.0 22 5.0 23 4.0 24 3.0 25 8.0 26 14.0 27 13.0 28 23.0 29 29.0 30 31.0 31 46.0 32 57.0 33 77.0 34 137.0 35 256.0 36 613.0 37 2669.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.60143076136944 17.041389882473172 11.599386816555953 31.757792539601432 2 21.05 24.2 38.074999999999996 16.675 3 16.85 30.2 29.099999999999998 23.849999999999998 4 20.75 37.425000000000004 22.75 19.075 5 21.30162703379224 36.99624530663329 22.428035043804755 19.27409261576971 6 15.875 37.925 23.549999999999997 22.650000000000002 7 13.900000000000002 20.575 45.375 20.150000000000002 8 18.2 21.775 28.125 31.900000000000002 9 18.525 21.725 31.65 28.1 10-14 19.869999999999997 29.25 27.38 23.5 15-19 20.66 28.845 27.57 22.925 20-24 20.05 28.299999999999997 28.115000000000002 23.535 25-29 19.55 28.975 28.675 22.8 30-34 19.73 28.65 28.1 23.52 35-39 20.14 28.98 27.71 23.169999999999998 40-44 20.105 28.52 28.310000000000002 23.064999999999998 45-49 20.175 28.49 27.91 23.425 50-54 20.505000000000003 28.58 28.165000000000003 22.75 55-59 19.786634460547504 29.262278582930755 28.004227053140095 22.946859903381643 60-64 20.380285213910433 28.68651488616462 27.68076057042782 23.252439329497125 65-69 19.99 29.03 28.185 22.795 70-74 20.175 28.925 27.785 23.115 75-79 20.044999999999998 28.735 27.67 23.549999999999997 80-84 20.645 28.67 27.72 22.965 85-89 20.810000000000002 28.845 27.894999999999996 22.45 90-94 20.04 29.615000000000002 27.065 23.28 95-99 20.465 28.615000000000002 27.925 22.994999999999997 100-104 20.807484490694417 28.972383430058034 27.68160896537923 22.538523113868322 105-109 20.4644412191582 28.67223862669536 28.061658575646863 22.801661578499573 110-114 20.64 29.09 27.77 22.5 115-119 21.21 28.59 27.310000000000002 22.89 120-124 20.580000000000002 28.685 27.650000000000002 23.085 125-129 20.89 28.89 27.305 22.915 130-134 20.82 28.93 27.765 22.485 135-139 20.474999999999998 29.375 27.185 22.965 140-144 21.18 28.810000000000002 27.05 22.96 145-149 21.0 29.244999999999997 26.47 23.285 150-151 20.768652979469206 28.229844767150723 26.89033550325488 24.111166750125186 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.5 20 1.0 21 1.0 22 0.5 23 0.5 24 5.0 25 8.5 26 7.5 27 9.0 28 14.5 29 21.0 30 29.0 31 34.0 32 42.0 33 55.5 34 60.5 35 69.0 36 99.0 37 132.5 38 157.0 39 170.5 40 199.0 41 223.5 42 242.5 43 276.5 44 277.5 45 265.5 46 270.0 47 261.0 48 220.0 49 175.0 50 145.5 51 117.0 52 96.5 53 80.0 54 58.0 55 37.0 56 29.5 57 35.5 58 23.5 59 11.0 60 9.0 61 6.0 62 3.5 63 2.5 64 3.5 65 2.5 66 2.5 67 2.5 68 1.0 69 0.0 70 1.0 71 1.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.15 2 0.0 3 0.0 4 0.0 5 0.125 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.64 60-64 0.075 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.06 105-109 0.095 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.15 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.7743795437453 99.5 2 0.17548257708698922 0.35000000000000003 3 0.0501378791677112 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.4375 0.0 0.0 0.0 0.0 98-99 0.5375000000000001 0.0 0.0 0.0 0.0 100-101 0.6125 0.0 0.0 0.0 0.0 102-103 0.7 0.0 0.0 0.0 0.0 104-105 0.95 0.0 0.0 0.0 0.0 106-107 1.1749999999999998 0.0 0.0 0.0 0.0 108-109 1.3125 0.0 0.0 0.0 0.0 110-111 1.4 0.0 0.0 0.0 0.0 112-113 1.6125 0.0 0.0 0.0 0.0 114-115 1.8 0.0 0.0 0.0 0.0 116-117 2.0 0.0 0.0 0.0 0.0 118-119 2.475 0.0 0.0 0.0 0.0 120-121 2.8625 0.0 0.0 0.0 0.0 122-123 3.2625 0.0 0.0 0.0 0.0 124-125 3.775 0.0 0.0 0.0 0.0 126-127 4.0875 0.0 0.0 0.0 0.0 128-129 4.6375 0.0 0.0 0.0 0.0 130-131 4.95 0.0 0.0 0.0 0.0 132-133 5.4 0.0 0.0 0.0 0.0 134-135 6.0375 0.0 0.0 0.0 0.0 136-137 6.6875 0.0 0.0 0.0 0.0 138-139 7.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTAACAA 10 0.006830828 145.0 4 >>END_MODULE SRR7166147 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166147_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9255 33.0 33.0 34.0 32.0 34.0 2 33.01 33.0 33.0 34.0 32.0 34.0 3 33.0585 34.0 33.0 34.0 32.0 34.0 4 33.081 34.0 33.0 34.0 32.0 34.0 5 33.08025 34.0 33.0 34.0 32.0 34.0 6 37.30875 38.0 38.0 38.0 37.0 38.0 7 37.33625 38.0 38.0 38.0 37.0 38.0 8 37.26825 38.0 38.0 38.0 37.0 38.0 9 37.31725 38.0 38.0 38.0 37.0 38.0 10-14 37.25175 38.0 38.0 38.0 37.0 38.0 15-19 37.2222 38.0 38.0 38.0 36.8 38.0 20-24 37.1827 38.0 38.0 38.0 36.2 38.0 25-29 37.16445 38.0 38.0 38.0 36.2 38.0 30-34 37.107350000000004 38.0 38.0 38.0 36.0 38.0 35-39 37.0595 38.0 38.0 38.0 36.0 38.0 40-44 37.01755 38.0 38.0 38.0 36.0 38.0 45-49 36.8987 38.0 38.0 38.0 35.6 38.0 50-54 36.7571 38.0 38.0 38.0 35.0 38.0 55-59 36.67659999999999 38.0 38.0 38.0 34.6 38.0 60-64 36.66165 38.0 38.0 38.0 34.6 38.0 65-69 36.65375 38.0 38.0 38.0 34.6 38.0 70-74 36.49685 38.0 38.0 38.0 34.0 38.0 75-79 36.451800000000006 38.0 38.0 38.0 34.0 38.0 80-84 36.318650000000005 38.0 37.6 38.0 33.8 38.0 85-89 36.14595 38.0 37.0 38.0 33.2 38.0 90-94 35.895950000000006 38.0 37.0 38.0 31.4 38.0 95-99 35.730900000000005 38.0 36.6 38.0 30.8 38.0 100-104 35.60375 38.0 36.8 38.0 30.2 38.0 105-109 35.3748 38.0 36.0 38.0 29.4 38.0 110-114 35.129549999999995 38.0 36.0 38.0 28.4 38.0 115-119 34.75295 38.0 35.0 38.0 27.0 38.0 120-124 34.51205 38.0 35.0 38.0 25.4 38.0 125-129 34.2949 38.0 34.8 38.0 24.4 38.0 130-134 33.715650000000004 38.0 34.0 38.0 21.8 38.0 135-139 33.275099999999995 38.0 34.0 38.0 18.6 38.0 140-144 32.266 37.0 33.0 38.0 14.2 38.0 145-149 30.97105 36.2 31.0 38.0 8.6 38.0 150-151 26.25975 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 2.0 8 1.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 5.0 15 2.0 16 2.0 17 5.0 18 5.0 19 6.0 20 10.0 21 9.0 22 13.0 23 20.0 24 14.0 25 11.0 26 28.0 27 30.0 28 43.0 29 59.0 30 60.0 31 73.0 32 102.0 33 157.0 34 250.0 35 422.0 36 951.0 37 1718.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.45 15.8 15.125 31.624999999999996 2 23.575 24.025 35.675000000000004 16.725 3 19.975 26.224999999999998 32.300000000000004 21.5 4 24.325 34.849999999999994 22.675 18.15 5 22.325 38.074999999999996 21.725 17.875 6 16.325 38.85 25.05 19.775000000000002 7 16.575 15.85 45.7 21.875 8 20.05 21.9 27.900000000000002 30.15 9 21.875 23.625 29.525000000000002 24.975 10-14 22.35 28.68 27.805000000000003 21.165 15-19 22.259999999999998 28.17 28.57 21.0 20-24 22.845 28.610000000000003 27.57 20.974999999999998 25-29 22.515 28.355000000000004 27.845 21.285 30-34 22.74 28.46 28.37 20.43 35-39 22.065 28.904999999999998 27.825 21.205 40-44 22.465 27.935 28.689999999999998 20.91 45-49 22.585 28.15 28.360000000000003 20.905 50-54 22.665 28.199999999999996 28.675 20.46 55-59 22.875 27.689999999999998 28.53 20.905 60-64 22.89 27.735 28.785 20.59 65-69 23.035 27.694999999999997 28.63 20.64 70-74 22.75 27.555000000000003 28.945 20.75 75-79 22.745 28.105000000000004 28.349999999999998 20.8 80-84 22.994999999999997 27.49 29.220000000000002 20.294999999999998 85-89 23.585 27.735 28.475 20.205000000000002 90-94 22.865 28.775000000000002 28.000000000000004 20.36 95-99 23.45 27.779999999999998 28.535 20.235 100-104 22.96 28.03 28.38 20.630000000000003 105-109 23.24 28.194999999999997 28.535 20.03 110-114 22.82 28.17 28.1 20.91 115-119 23.79 27.905 28.355000000000004 19.950000000000003 120-124 23.11 28.42 28.235 20.235 125-129 23.52 28.76 27.715 20.005 130-134 24.215 28.46 27.57 19.755 135-139 23.685000000000002 28.425 27.975 19.915 140-144 24.285 27.894999999999996 27.83 19.99 145-149 24.345 28.735 27.189999999999998 19.73 150-151 25.021894157387713 27.96196672088077 27.886901038408606 19.129238083322907 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.5 22 0.5 23 2.0 24 3.0 25 3.0 26 3.0 27 4.0 28 9.0 29 15.0 30 21.0 31 27.5 32 29.0 33 46.0 34 67.5 35 71.5 36 90.5 37 127.0 38 146.0 39 180.5 40 203.5 41 227.5 42 269.5 43 269.5 44 276.5 45 289.0 46 265.0 47 233.5 48 214.5 49 192.0 50 161.5 51 131.0 52 112.0 53 84.0 54 57.0 55 42.0 56 29.0 57 22.5 58 17.0 59 15.0 60 11.5 61 5.5 62 5.0 63 5.0 64 3.0 65 2.5 66 3.0 67 2.0 68 1.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64806435394671 99.1 2 0.2765208647561589 0.5499999999999999 3 0.025138260432378077 0.075 4 0.0 0.0 5 0.025138260432378077 0.125 6 0.025138260432378077 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCCTATTT 6 0.15 No Hit GCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCCTATTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0125 0.0 0.0 0.025 0.0 64-65 0.025 0.0 0.0 0.025 0.0 66-67 0.025 0.0 0.0 0.025 0.0 68-69 0.025 0.0 0.0 0.025 0.0 70-71 0.025 0.0 0.0 0.025 0.0 72-73 0.025 0.0 0.0 0.025 0.0 74-75 0.025 0.0 0.0 0.025 0.0 76-77 0.025 0.0 0.0 0.025 0.0 78-79 0.025 0.0 0.0 0.025 0.0 80-81 0.025 0.0 0.0 0.025 0.0 82-83 0.037500000000000006 0.0 0.0 0.025 0.0 84-85 0.0625 0.0 0.0 0.025 0.0 86-87 0.1 0.0 0.0 0.025 0.0 88-89 0.15 0.0 0.0 0.025 0.0 90-91 0.16249999999999998 0.0 0.0 0.025 0.0 92-93 0.2 0.0 0.0 0.025 0.0 94-95 0.3375 0.0 0.0 0.025 0.0 96-97 0.44999999999999996 0.0 0.0 0.025 0.0 98-99 0.5625 0.0 0.0 0.025 0.0 100-101 0.6375 0.0 0.0 0.025 0.0 102-103 0.725 0.0 0.0 0.025 0.0 104-105 0.975 0.0 0.0 0.025 0.0 106-107 1.2000000000000002 0.0 0.0 0.025 0.0 108-109 1.3375 0.0 0.0 0.025 0.0 110-111 1.425 0.0 0.0 0.025 0.0 112-113 1.6375 0.0 0.0 0.025 0.0 114-115 1.825 0.0 0.0 0.025 0.0 116-117 2.0375 0.0 0.0 0.025 0.0 118-119 2.5 0.0 0.0 0.025 0.0 120-121 2.9375 0.0 0.0 0.025 0.0 122-123 3.3375 0.0 0.0 0.025 0.0 124-125 3.85 0.0 0.0 0.025 0.0 126-127 4.1625 0.0 0.0 0.025 0.0 128-129 4.675 0.0 0.0 0.025 0.0 130-131 5.0 0.0 0.0 0.025 0.0 132-133 5.4 0.0 0.0 0.025 0.0 134-135 5.9875 0.0 0.0 0.025 0.0 136-137 6.637499999999999 0.0 0.0 0.025 0.0 138-139 7.375 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 30 0.0014437955 24.166668 40-44 >>END_MODULE Read 758578 spots for SRR7166147.sra Written 758578 spots for SRR7166147.sra Read 758578 spots for SRR7166147.sra Written 758578 spots for SRR7166147.sra Read 758578 spots for SRR7166147.sra Written 758578 spots for SRR7166147.sra Read 758578 spots for SRR7166147.sra Written 758578 spots for SRR7166147.sra Read 758578 spots for SRR7166147.sra Written 758578 spots for SRR7166147.sra Read 758578 spots for SRR7166147.sra Written 758578 spots for SRR7166147.sra Read 758578 spots for SRR7166147.sra Written 758578 spots for SRR7166147.sra Read 758578 spots for SRR7166147.sra Written 758578 spots for SRR7166147.sra Read 758578 spots for SRR7166147.sra Written 758578 spots for SRR7166147.sra Read 758578 spots for SRR7166147.sra Written 758578 spots for SRR7166147.sra Read 758578 spots for SRR7166147.sra Written 758578 spots for SRR7166147.sra Read 758584 spots for SRR7166147.sra Written 758584 spots for SRR7166147.sra Read 758578 spots for SRR7166147.sra Written 758578 spots for SRR7166147.sra Read 758578 spots for SRR7166147.sra Written 758578 spots for SRR7166147.sra Read 758578 spots for SRR7166147.sra Written 758578 spots for SRR7166147.sra Read 758578 spots for SRR7166147.sra Written 758578 spots for SRR7166147.sra Read 758578 spots for SRR7166147.sra Written 758578 spots for SRR7166147.sra Read 758578 spots for SRR7166147.sra Written 758578 spots for SRR7166147.sra Read 758578 spots for SRR7166147.sra Written 758578 spots for SRR7166147.sra Read 758578 spots for SRR7166147.sra Written 758578 spots for SRR7166147.sra SRR ids: ['SRR7166147.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_z0xz30oe SRR7166147.sra spots: 15171566 blocks: [[1, 758578], [758579, 1517156], [1517157, 2275734], [2275735, 3034312], [3034313, 3792890], [3792891, 4551468], [4551469, 5310046], [5310047, 6068624], [6068625, 6827202], [6827203, 7585780], [7585781, 8344358], [8344359, 9102936], [9102937, 9861514], [9861515, 10620092], [10620093, 11378670], [11378671, 12137248], [12137249, 12895826], [12895827, 13654404], [13654405, 14412982], [14412983, 15171566]] SRR7166147 file size 5119445 SRR7166147 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166147 SRR7166147_1.fastq SRR7166147_2.fastq Input file: SRR7166147_1.fastq Paired file: SRR7166147_2.fastq trimmed: SRR7166147-trimmed-pair1.fastq, SRR7166147-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 16:36:04 2025 >> started Fri Feb 14 16:36:22 2025 >> done (17.947s) 15171566 read pairs processed; of these: 6158 ( 0.04%) short read pairs filtered out after trimming by size control 5118 ( 0.03%) empty read pairs filtered out after trimming by size control 15160290 (99.93%) read pairs available; of these: 7414194 (48.91%) trimmed read pairs available after processing 7746096 (51.09%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 7 0.00% 20 6 0.00% 21 4 0.00% 22 5 0.00% 23 9 0.00% 24 6 0.00% 25 4 0.00% 26 4 0.00% 27 5 0.00% 28 2 0.00% 29 8 0.00% 30 8 0.00% 31 3 0.00% 32 5 0.00% 33 4 0.00% 34 5 0.00% 35 7 0.00% 36 6 0.00% 37 7 0.00% 38 8 0.00% 39 11 0.00% 40 11 0.00% 41 13 0.00% 42 19 0.00% 43 16 0.00% 44 28 0.00% 45 17 0.00% 46 25 0.00% 47 25 0.00% 48 39 0.00% 49 44 0.00% 50 38 0.00% 51 45 0.00% 52 63 0.00% 53 69 0.00% 54 72 0.00% 55 67 0.00% 56 88 0.00% 57 93 0.00% 58 113 0.00% 59 134 0.00% 60 146 0.00% 61 189 0.00% 62 191 0.00% 63 266 0.00% 64 265 0.00% 65 326 0.00% 66 321 0.00% 67 347 0.00% 68 422 0.00% 69 477 0.00% 70 554 0.00% 71 662 0.00% 72 734 0.00% 73 934 0.01% 74 1024 0.01% 75 1172 0.01% 76 1233 0.01% 77 1366 0.01% 78 1509 0.01% 79 1741 0.01% 80 2021 0.01% 81 2299 0.02% 82 2603 0.02% 83 2992 0.02% 84 3659 0.02% 85 4116 0.03% 86 4303 0.03% 87 4653 0.03% 88 5121 0.03% 89 5527 0.04% 90 5964 0.04% 91 6603 0.04% 92 7242 0.05% 93 8089 0.05% 94 8773 0.06% 95 9402 0.06% 96 9966 0.07% 97 10147 0.07% 98 10745 0.07% 99 11883 0.08% 100 12368 0.08% 101 13167 0.09% 102 14122 0.09% 103 15457 0.10% 104 16299 0.11% 105 17371 0.11% 106 18007 0.12% 107 18600 0.12% 108 19094 0.13% 109 19767 0.13% 110 20791 0.14% 111 21917 0.14% 112 23546 0.16% 113 25085 0.17% 114 27072 0.18% 115 28656 0.19% 116 29231 0.19% 117 30354 0.20% 118 30877 0.20% 119 31749 0.21% 120 32862 0.22% 121 34327 0.23% 122 36267 0.24% 123 38256 0.25% 124 40596 0.27% 125 42667 0.28% 126 44282 0.29% 127 45385 0.30% 128 46598 0.31% 129 48298 0.32% 130 50489 0.33% 131 52537 0.35% 132 55299 0.36% 133 59013 0.39% 134 62559 0.41% 135 66517 0.44% 136 70194 0.46% 137 74030 0.49% 138 78579 0.52% 139 83883 0.55% 140 89405 0.59% 141 98327 0.65% 142 108356 0.71% 143 121123 0.80% 144 140329 0.93% 145 167670 1.11% 146 206161 1.36% 147 273698 1.81% 148 403163 2.66% 149 764067 5.04% 150 3404593 22.46% 151 7746096 51.09% 15160290 reads passed initial QC criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.99 fanout-score-rank=26 prefix-density=0.64 prefix-fanout=2.8 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.03 sequence-density-rank=33 fanout-score=216.94 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=21.2 sequence=ATCATCAACTCCACATAGTTCAAGTTTCCAAGCATACATGAAAACACCTTGAAAGTTGAAGCAGCCAACAAAGCAGTGACGCGTACACAAGACAAAGGATTTATAGGAACCCTTTGCTGTTTATTATTATTTAACAA criterion=sequence-density sequence-density=0.91 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=29 prefix-density=0.93 prefix-fanout=2.1 sequence=GGCAGTGGCTGCAAATGTGGCATGTACCCTGACTTAGGTTTCTCAGAGAACACCACAACTGAGACAATCATTGCAGGT criterion=fanout-score sequence-density=0.12 sequence-density-rank=29 fanout-score=24.20 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=9.5 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7166147 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 16:37:12 Started mapping on | Feb 14 16:37:17 Finished on | Feb 14 16:39:50 Mapping speed, Million of reads per hour | 356.71 Number of input reads | 15160290 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 14388510 Uniquely mapped reads % | 94.91% Average mapped length | 293.37 Number of splices: Total | 13990011 Number of splices: Annotated (sjdb) | 13702949 Number of splices: GT/AG | 13757701 Number of splices: GC/AG | 179029 Number of splices: AT/AC | 10483 Number of splices: Non-canonical | 42798 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.04% Deletion average length | 2.24 Insertion rate per base | 0.02% Insertion average length | 2.20 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 351139 % of reads mapped to multiple loci | 2.32% Number of reads mapped to too many loci | 36558 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.46% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 427461 427461 427461 N_multimapping 351139 351139 351139 N_noFeature 528662 14197831 645422 N_ambiguous 154357 1523 79245 UnstrandedReadsAssigned:13705491 PositiveStrandReadsAssigned:189156 NegativeStrandReadsAssigned:13663843 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7166147 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166147-trimmed-pair1.fastq SRR7166147-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,160,290 reads, 13,553,738 reads pseudoaligned [quant] estimated average fragment length: 235.451 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 966 rounds 52401 SRR7166147.ke.tsv 34699 SRR7166147.se.tsv 87100 total ==> SRR7166147.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1783.55 1256 52.1621 Potri.005G024800.1.v4.1 1035 800.549 187 17.3023 Potri.004G059700.1.v4.1 961 726.56 9 0.917532 Potri.007G009000.2.v4.1 1416 1181.55 0 0 Potri.003G141000.2.v4.1 2943 2708.55 641 17.5296 Potri.016G087400.1.v4.1 270 83.7554 647 572.192 Potri.015G069301.1.v4.1 564 333.743 0 0 Potri.010G195200.1.v4.1 1773 1538.55 267.824 12.894 Potri.012G127500.1.v4.1 977 742.549 8381 836.028 ==> SRR7166147.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 117 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 475 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 305 SRR7166147 completed mapping pipeline successfully