Starting /dee2/code/volunteer_pipeline.sh SRR7166148 current disk space = 3111548698624 free memory = 1568450528 SRR7166148 SRAfilesize 39651da4c7798619de67726ef4261b1d SRR7166148.sra SRR7166148.sra file validated SRR7166148 is paired end SRR7166148 is conventional basespace SRR7166148 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166148_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.122 33.0 31.0 33.0 18.0 34.0 2 32.43375 33.0 33.0 33.0 32.0 34.0 3 32.02375 33.0 31.0 33.0 29.0 34.0 4 32.72725 33.0 33.0 34.0 31.0 34.0 5 33.12425 33.0 33.0 34.0 33.0 34.0 6 37.1855 38.0 38.0 38.0 36.0 38.0 7 37.44325 38.0 38.0 38.0 37.0 38.0 8 37.575 38.0 38.0 38.0 37.0 38.0 9 37.5615 38.0 38.0 38.0 38.0 38.0 10-14 37.6085 38.0 38.0 38.0 38.0 38.0 15-19 37.5673 38.0 38.0 38.0 38.0 38.0 20-24 37.5652 38.0 38.0 38.0 38.0 38.0 25-29 37.516450000000006 38.0 38.0 38.0 37.6 38.0 30-34 37.5028 38.0 38.0 38.0 38.0 38.0 35-39 37.449 38.0 38.0 38.0 37.0 38.0 40-44 37.43315 38.0 38.0 38.0 37.0 38.0 45-49 37.415049999999994 38.0 38.0 38.0 37.0 38.0 50-54 37.17035 38.0 38.0 38.0 37.0 38.0 55-59 36.63395 38.0 38.0 38.0 36.2 38.0 60-64 36.91305 38.0 38.0 38.0 36.0 38.0 65-69 37.1902 38.0 38.0 38.0 36.4 38.0 70-74 37.122 38.0 38.0 38.0 36.2 38.0 75-79 37.007850000000005 38.0 38.0 38.0 36.0 38.0 80-84 36.9337 38.0 38.0 38.0 36.0 38.0 85-89 36.7731 38.0 38.0 38.0 35.2 38.0 90-94 36.68920000000001 38.0 38.0 38.0 35.0 38.0 95-99 36.6657 38.0 38.0 38.0 35.0 38.0 100-104 36.56745 38.0 38.0 38.0 34.6 38.0 105-109 36.273 38.0 38.0 38.0 34.0 38.0 110-114 36.318599999999996 38.0 38.0 38.0 34.0 38.0 115-119 36.119299999999996 38.0 38.0 38.0 33.8 38.0 120-124 36.03475 38.0 37.4 38.0 33.2 38.0 125-129 35.845150000000004 38.0 37.0 38.0 33.0 38.0 130-134 35.697050000000004 38.0 36.8 38.0 31.8 38.0 135-139 35.37134999999999 38.0 36.0 38.0 31.0 38.0 140-144 35.127750000000006 38.0 36.0 38.0 30.4 38.0 145-149 34.808299999999996 38.0 36.0 38.0 29.2 38.0 150-151 31.44725 36.5 31.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 2.0 13 0.0 14 2.0 15 1.0 16 2.0 17 2.0 18 0.0 19 4.0 20 3.0 21 4.0 22 6.0 23 9.0 24 8.0 25 9.0 26 16.0 27 21.0 28 14.0 29 16.0 30 39.0 31 63.0 32 68.0 33 86.0 34 141.0 35 210.0 36 614.0 37 2658.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.147689129873484 18.564420345985024 13.34882520010328 31.939065324038214 2 19.875 26.5 35.85 17.775 3 16.275000000000002 33.550000000000004 26.875 23.3 4 20.3 39.050000000000004 22.650000000000002 18.0 5 19.479869967491872 38.834708677169296 23.380845211302827 18.30457614403601 6 16.025 38.224999999999994 24.9 20.849999999999998 7 11.899999999999999 20.875 45.625 21.6 8 17.875 22.400000000000002 27.900000000000002 31.825 9 17.424999999999997 24.2 30.875000000000004 27.500000000000004 10-14 18.88 31.455 26.284999999999997 23.380000000000003 15-19 19.009999999999998 31.345 26.935 22.71 20-24 19.075 30.240000000000002 27.500000000000004 23.185 25-29 19.195 31.15 27.005000000000003 22.650000000000002 30-34 19.27096354817741 30.686534326716338 27.1963598179909 22.846142307115354 35-39 19.105955297764886 30.88654432721636 27.076353817690883 22.931146557327867 40-44 19.775000000000002 30.37 26.82 23.035 45-49 20.095 30.475 26.740000000000002 22.689999999999998 50-54 19.789939192924265 29.343183074526358 27.18729584401226 23.67958188853711 55-59 19.707917769183798 29.62039487075107 27.43232240993283 23.239364950132302 60-64 19.530582499874352 29.8537467959994 27.426245162587325 23.189425541538924 65-69 19.45167100260156 30.263157894736842 26.956173704222536 23.328997398439064 70-74 19.895 30.625000000000004 27.07 22.41 75-79 19.225 29.975 27.435 23.365 80-84 20.265 29.439999999999998 27.24 23.055 85-89 20.064999999999998 30.135 27.105 22.695 90-94 20.015 29.69 27.334999999999997 22.96 95-99 19.225 29.915000000000003 27.415 23.445 100-104 20.386115834750427 29.65889766930079 26.71301390417125 23.241972591777532 105-109 19.576799356654604 29.92561318858062 26.960193003618816 23.53739445114596 110-114 19.9799899949975 29.67983991995998 27.008504252126066 23.33166583291646 115-119 20.637861112501877 29.4647774495569 26.871276222900914 23.026085215040304 120-124 20.432043204320433 29.427942794279428 26.982698269826983 23.157315731573156 125-129 20.66 28.735 27.045 23.56 130-134 20.544999999999998 29.385 26.52 23.549999999999997 135-139 20.695 29.685 26.325 23.294999999999998 140-144 20.94 29.465000000000003 26.040000000000003 23.555 145-149 21.595 28.494999999999997 26.08 23.830000000000002 150-151 21.54924289826054 28.24427480916031 25.691402828181705 24.515079464397445 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 2.0 21 3.5 22 3.0 23 1.5 24 4.5 25 7.0 26 6.0 27 11.0 28 21.0 29 25.5 30 38.5 31 54.5 32 65.5 33 85.5 34 103.5 35 116.0 36 135.0 37 153.0 38 165.0 39 178.0 40 192.0 41 214.5 42 231.0 43 236.0 44 250.0 45 238.5 46 221.0 47 224.0 48 209.5 49 179.5 50 149.5 51 118.5 52 88.5 53 63.5 54 44.0 55 35.0 56 26.0 57 21.0 58 19.5 59 14.5 60 11.0 61 8.0 62 8.5 63 6.0 64 1.5 65 2.0 66 1.5 67 2.0 68 2.0 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.175 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.005 35-39 0.005 40-44 0.0 45-49 0.0 50-54 0.505 55-59 1.7399999999999998 60-64 0.515 65-69 0.06 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.03 105-109 0.52 110-114 0.05 115-119 0.135 120-124 0.01 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.11249999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44640161046804 98.8 2 0.4781077000503271 0.95 3 0.050327126321087066 0.15 4 0.025163563160543533 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.325 0.0 0.0 0.0 0.0 88-89 0.3625 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.7875000000000001 0.0 0.0 0.0 0.0 98-99 0.8875 0.0 0.0 0.0 0.0 100-101 1.0875 0.0 0.0 0.0 0.0 102-103 1.2625000000000002 0.0 0.0 0.0 0.0 104-105 1.45 0.0 0.0 0.0 0.0 106-107 1.7125 0.0 0.0 0.0 0.0 108-109 1.875 0.0 0.0 0.0 0.0 110-111 2.225 0.0 0.0 0.0 0.0 112-113 2.5125 0.0 0.0 0.0 0.0 114-115 2.9124999999999996 0.0 0.0 0.0 0.0 116-117 3.3875 0.0 0.0 0.0 0.0 118-119 3.6625 0.0 0.0 0.0 0.0 120-121 3.95 0.0 0.0 0.0 0.0 122-123 4.4625 0.0 0.0 0.0 0.0 124-125 4.9625 0.0 0.0 0.0 0.0 126-127 5.6 0.0 0.0 0.0 0.0 128-129 6.2625 0.0 0.0 0.0 0.0 130-131 6.875 0.0 0.0 0.0 0.0 132-133 7.5625 0.0 0.0 0.0 0.0 134-135 8.1875 0.0 0.0 0.0 0.0 136-137 9.0875 0.0 0.0 0.0 0.0 138-139 9.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCAGAT 10 0.006158407 150.03896 1 GTCTGAA 30 0.0018265423 72.20625 145 CACGTCT 35 0.003620828 20.630358 140-144 GAGCACA 40 0.0078364005 18.051563 135-139 CGGAAGA 40 0.0078364005 18.051563 130-134 >>END_MODULE SRR7166148 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166148_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.01825 33.0 33.0 34.0 32.0 34.0 2 33.03325 34.0 33.0 34.0 32.0 34.0 3 33.08575 34.0 33.0 34.0 32.0 34.0 4 33.10975 34.0 33.0 34.0 33.0 34.0 5 33.07175 34.0 33.0 34.0 33.0 34.0 6 37.249 38.0 38.0 38.0 37.0 38.0 7 37.256 38.0 38.0 38.0 37.0 38.0 8 37.27275 38.0 38.0 38.0 37.0 38.0 9 37.25475 38.0 38.0 38.0 37.0 38.0 10-14 37.24425000000001 38.0 38.0 38.0 37.0 38.0 15-19 37.189800000000005 38.0 38.0 38.0 37.0 38.0 20-24 37.163149999999995 38.0 38.0 38.0 37.0 38.0 25-29 37.1348 38.0 38.0 38.0 36.8 38.0 30-34 37.0745 38.0 38.0 38.0 36.8 38.0 35-39 36.999750000000006 38.0 38.0 38.0 36.0 38.0 40-44 36.983000000000004 38.0 38.0 38.0 36.0 38.0 45-49 36.90585 38.0 38.0 38.0 36.0 38.0 50-54 36.78959999999999 38.0 38.0 38.0 35.6 38.0 55-59 36.7686 38.0 38.0 38.0 35.8 38.0 60-64 36.77245 38.0 38.0 38.0 35.6 38.0 65-69 36.747699999999995 38.0 38.0 38.0 35.6 38.0 70-74 36.648649999999996 38.0 38.0 38.0 35.0 38.0 75-79 36.537549999999996 38.0 38.0 38.0 34.4 38.0 80-84 36.4732 38.0 38.0 38.0 34.2 38.0 85-89 36.27165 38.0 38.0 38.0 34.0 38.0 90-94 36.15045 38.0 38.0 38.0 33.6 38.0 95-99 35.93125 38.0 37.4 38.0 33.0 38.0 100-104 35.837849999999996 38.0 37.0 38.0 32.6 38.0 105-109 35.710150000000006 38.0 37.0 38.0 31.8 38.0 110-114 35.475199999999994 38.0 37.0 38.0 31.0 38.0 115-119 35.169200000000004 38.0 36.4 38.0 29.0 38.0 120-124 34.91485 38.0 36.2 38.0 28.0 38.0 125-129 34.590599999999995 38.0 35.4 38.0 26.8 38.0 130-134 34.16625 38.0 35.0 38.0 23.8 38.0 135-139 33.85865 38.0 35.0 38.0 22.6 38.0 140-144 33.261649999999996 38.0 34.2 38.0 16.6 38.0 145-149 32.455799999999996 38.0 33.8 38.0 11.4 38.0 150-151 28.18375 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 1.0 4 4.0 5 3.0 6 1.0 7 0.0 8 1.0 9 3.0 10 1.0 11 1.0 12 1.0 13 0.0 14 3.0 15 5.0 16 7.0 17 11.0 18 8.0 19 7.0 20 8.0 21 7.0 22 18.0 23 12.0 24 22.0 25 20.0 26 19.0 27 26.0 28 22.0 29 37.0 30 40.0 31 62.0 32 61.0 33 111.0 34 173.0 35 326.0 36 706.0 37 2269.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.625 15.925 15.8 27.650000000000002 2 26.424999999999997 22.525000000000002 33.825 17.224999999999998 3 20.65 26.55 31.825 20.974999999999998 4 23.849999999999998 35.8 20.95 19.400000000000002 5 24.45 37.475 20.45 17.625 6 17.68384192096048 38.669334667333665 22.63631815907954 21.010505252626313 7 18.154538634658664 16.379094773693424 44.2110527631908 21.255313828457115 8 21.680420105026258 22.005501375343837 27.306826706676667 29.00725181295324 9 22.980745186296573 23.78094523630908 27.206801700425103 26.03150787696924 10-14 22.88072018004501 28.107026756689173 27.746936734183546 21.26531632908227 15-19 23.760940235058765 27.336834208552137 28.122030507626906 20.78019504876219 20-24 22.96303706297204 27.874756164657633 28.59500825288851 20.56719851948182 25-29 22.755479931938744 27.619857872084875 28.405565008507654 21.219097187468723 30-34 23.334000400240143 27.52651590954573 28.0768461076646 21.062637582549527 35-39 23.08654327163582 27.733866933466732 28.61430715357679 20.56528264132066 40-44 23.55824538588506 27.94478067323563 28.454959235732506 20.0420147051468 45-49 23.429915428113894 27.983786218285545 28.669368963619075 19.916929389981483 50-54 23.25907384230288 28.010012515644554 28.380475594493117 20.35043804755945 55-59 23.551196076468823 27.05935341807627 28.630767690921832 20.75868281453308 60-64 23.190435696063226 27.65244359961983 29.198139162623182 19.958981541693763 65-69 23.604441776710683 27.641056422569026 28.461384553821528 20.29311724689876 70-74 24.005006257822277 28.07008760951189 28.195244055068834 19.729662077596995 75-79 23.339173967459324 27.939924906132667 28.901126408010015 19.819774718397998 80-84 23.00375469336671 27.699624530663332 29.141426783479353 20.155193992490613 85-89 23.856241866052656 27.835619181099208 28.601461607768545 19.706677345079587 90-94 22.995294824306736 28.19101011112223 27.985784362799077 20.82791070177195 95-99 23.55944931163955 27.13892365456821 29.266583229036296 20.035043804755944 100-104 24.190237797246557 27.02377972465582 29.176470588235293 19.609511889862326 105-109 23.90412329863891 27.366893514811853 29.033226581265016 19.695756605284227 110-114 24.080100125156445 27.879849812265334 29.09637046307885 18.943679599499376 115-119 24.35518605699404 27.46531777432764 28.56212751039215 19.61736865828617 120-124 23.743926263587635 28.066923809046735 28.45263737915143 19.736512548214197 125-129 23.992389726130277 27.947729434736896 28.338256646472736 19.72162419266009 130-134 24.95871903927946 28.011008256192145 27.865899424568426 19.16437327995997 135-139 24.525941862210438 28.418472006804425 28.183319157452345 18.8722669735328 140-144 25.2338318411444 27.959785925073778 28.08482969039164 18.721552543390185 145-149 26.015406162464988 27.34093637454982 27.936174469787918 18.70748299319728 150-151 26.16577072134017 28.22852856607076 27.390923865483185 18.214776847105888 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 1.0 16 1.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 2.0 23 2.0 24 2.0 25 2.5 26 4.5 27 7.0 28 9.5 29 14.0 30 14.5 31 16.0 32 28.5 33 42.5 34 55.0 35 76.5 36 86.0 37 96.5 38 127.0 39 161.0 40 186.0 41 238.5 42 260.0 43 266.5 44 285.5 45 278.5 46 286.5 47 267.0 48 234.0 49 197.0 50 172.5 51 136.0 52 104.0 53 94.0 54 65.0 55 42.5 56 31.0 57 28.5 58 21.0 59 15.0 60 10.5 61 6.0 62 3.5 63 3.0 64 4.0 65 2.0 66 1.5 67 2.0 68 2.0 69 1.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.05 7 0.025 8 0.025 9 0.025 10-14 0.025 15-19 0.025 20-24 0.034999999999999996 25-29 0.09 30-34 0.06 35-39 0.05 40-44 0.034999999999999996 45-49 0.08499999999999999 50-54 0.125 55-59 0.09 60-64 0.045 65-69 0.04 70-74 0.125 75-79 0.125 80-84 0.125 85-89 0.11 90-94 0.11 95-99 0.125 100-104 0.125 105-109 0.08 110-114 0.125 115-119 0.165 120-124 0.185 125-129 0.135 130-134 0.075 135-139 0.065 140-144 0.034999999999999996 145-149 0.04 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49596774193549 98.7 2 0.3780241935483871 0.75 3 0.05040322580645161 0.15 4 0.0 0.0 5 0.05040322580645161 0.25 6 0.025201612903225805 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCCTATTT 6 0.15 No Hit GCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCC 5 0.125 No Hit GCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCCTATTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.325 0.0 0.0 0.0 0.0 88-89 0.3625 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.7375 0.0 0.0 0.0 0.0 98-99 0.8375 0.0 0.0 0.0 0.0 100-101 1.0375 0.0 0.0 0.0 0.0 102-103 1.2125 0.0 0.0 0.0 0.0 104-105 1.4125 0.0 0.0 0.0 0.0 106-107 1.6375000000000002 0.0 0.0 0.0 0.0 108-109 1.8 0.0 0.0 0.0 0.0 110-111 2.1624999999999996 0.0 0.0 0.0 0.0 112-113 2.4625 0.0 0.0 0.0 0.0 114-115 2.8625 0.0 0.0 0.0 0.0 116-117 3.3375 0.0 0.0 0.0 0.0 118-119 3.6125 0.0 0.0 0.0 0.0 120-121 3.9000000000000004 0.0 0.0 0.0 0.0 122-123 4.4 0.0 0.0 0.0 0.0 124-125 4.887499999999999 0.0 0.0 0.0 0.0 126-127 5.5 0.0 0.0 0.0 0.0 128-129 6.199999999999999 0.0 0.0 0.0 0.0 130-131 6.8375 0.0 0.0 0.0 0.0 132-133 7.5625 0.0 0.0 0.0 0.0 134-135 8.1875 0.0 0.0 0.0 0.0 136-137 9.05 0.0 0.0 0.0 0.0 138-139 9.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACCCAA 10 0.006830828 145.0 3 TCAGATT 10 0.006830828 145.0 2 ACCCAAA 10 0.006830828 145.0 4 GGAAAAT 10 0.006830828 145.0 1 TGTAGGG 30 0.0017973486 72.5 145 TCGTGTA 35 0.0035366106 20.714287 140-144 GAGCGTC 40 0.0076550315 18.125 135-139 CGGAAGA 40 0.0076550315 18.125 130-134 >>END_MODULE Read 732355 spots for SRR7166148.sra Written 732355 spots for SRR7166148.sra Read 732355 spots for SRR7166148.sra Written 732355 spots for SRR7166148.sra Read 732355 spots for SRR7166148.sra Written 732355 spots for SRR7166148.sra Read 732355 spots for SRR7166148.sra Written 732355 spots for SRR7166148.sra Read 732355 spots for SRR7166148.sra Written 732355 spots for SRR7166148.sra Read 732355 spots for SRR7166148.sra Written 732355 spots for SRR7166148.sra Read 732355 spots for SRR7166148.sra Written 732355 spots for SRR7166148.sra Read 732355 spots for SRR7166148.sra Written 732355 spots for SRR7166148.sra Read 732355 spots for SRR7166148.sra Written 732355 spots for SRR7166148.sra Read 732355 spots for SRR7166148.sra Written 732355 spots for SRR7166148.sra Read 732355 spots for SRR7166148.sra Written 732355 spots for SRR7166148.sra Read 732355 spots for SRR7166148.sra Written 732355 spots for SRR7166148.sra Read 732355 spots for SRR7166148.sra Written 732355 spots for SRR7166148.sra Read 732355 spots for SRR7166148.sra Written 732355 spots for SRR7166148.sra Read 732355 spots for SRR7166148.sra Written 732355 spots for SRR7166148.sra Read 732355 spots for SRR7166148.sra Written 732355 spots for SRR7166148.sra Read 732355 spots for SRR7166148.sra Written 732355 spots for SRR7166148.sra Read 732355 spots for SRR7166148.sra Written 732355 spots for SRR7166148.sra Read 732365 spots for SRR7166148.sra Written 732365 spots for SRR7166148.sra Read 732355 spots for SRR7166148.sra Written 732355 spots for SRR7166148.sra SRR ids: ['SRR7166148.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jsam27il SRR7166148.sra spots: 14647110 blocks: [[1, 732355], [732356, 1464710], [1464711, 2197065], [2197066, 2929420], [2929421, 3661775], [3661776, 4394130], [4394131, 5126485], [5126486, 5858840], [5858841, 6591195], [6591196, 7323550], [7323551, 8055905], [8055906, 8788260], [8788261, 9520615], [9520616, 10252970], [10252971, 10985325], [10985326, 11717680], [11717681, 12450035], [12450036, 13182390], [13182391, 13914745], [13914746, 14647110]] SRR7166148 file size 4941724 SRR7166148 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166148 SRR7166148_1.fastq SRR7166148_2.fastq Input file: SRR7166148_1.fastq Paired file: SRR7166148_2.fastq trimmed: SRR7166148-trimmed-pair1.fastq, SRR7166148-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 17:05:21 2025 >> started Fri Feb 14 17:05:37 2025 >> done (15.937s) 14647110 read pairs processed; of these: 11826 ( 0.08%) short read pairs filtered out after trimming by size control 7753 ( 0.05%) empty read pairs filtered out after trimming by size control 14627531 (99.87%) read pairs available; of these: 6858290 (46.89%) trimmed read pairs available after processing 7769241 (53.11%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 3 0.00% 21 4 0.00% 22 4 0.00% 23 3 0.00% 24 8 0.00% 25 7 0.00% 26 4 0.00% 27 4 0.00% 28 5 0.00% 29 5 0.00% 30 3 0.00% 31 6 0.00% 32 3 0.00% 33 10 0.00% 34 9 0.00% 35 8 0.00% 36 8 0.00% 37 10 0.00% 38 8 0.00% 39 9 0.00% 40 11 0.00% 41 12 0.00% 42 9 0.00% 43 13 0.00% 44 15 0.00% 45 19 0.00% 46 24 0.00% 47 21 0.00% 48 25 0.00% 49 51 0.00% 50 44 0.00% 51 43 0.00% 52 71 0.00% 53 53 0.00% 54 72 0.00% 55 76 0.00% 56 106 0.00% 57 105 0.00% 58 141 0.00% 59 184 0.00% 60 189 0.00% 61 222 0.00% 62 244 0.00% 63 282 0.00% 64 316 0.00% 65 333 0.00% 66 405 0.00% 67 431 0.00% 68 554 0.00% 69 620 0.00% 70 703 0.00% 71 870 0.01% 72 1032 0.01% 73 1077 0.01% 74 1314 0.01% 75 1464 0.01% 76 1631 0.01% 77 1903 0.01% 78 2062 0.01% 79 2357 0.02% 80 2781 0.02% 81 3251 0.02% 82 3629 0.02% 83 4228 0.03% 84 5411 0.04% 85 5661 0.04% 86 6252 0.04% 87 6943 0.05% 88 7356 0.05% 89 8197 0.06% 90 8892 0.06% 91 9821 0.07% 92 10743 0.07% 93 11654 0.08% 94 12849 0.09% 95 13525 0.09% 96 14480 0.10% 97 15214 0.10% 98 16310 0.11% 99 17754 0.12% 100 18275 0.12% 101 19933 0.14% 102 21262 0.15% 103 22816 0.16% 104 24014 0.16% 105 25058 0.17% 106 26588 0.18% 107 27342 0.19% 108 28240 0.19% 109 29884 0.20% 110 31085 0.21% 111 32732 0.22% 112 34492 0.24% 113 36641 0.25% 114 38041 0.26% 115 40104 0.27% 116 41549 0.28% 117 42068 0.29% 118 43611 0.30% 119 44694 0.31% 120 46065 0.31% 121 47634 0.33% 122 49942 0.34% 123 52040 0.36% 124 54045 0.37% 125 55901 0.38% 126 57469 0.39% 127 58259 0.40% 128 59811 0.41% 129 61155 0.42% 130 62711 0.43% 131 64751 0.44% 132 67379 0.46% 133 70817 0.48% 134 73461 0.50% 135 75656 0.52% 136 78513 0.54% 137 81129 0.55% 138 84334 0.58% 139 87804 0.60% 140 91574 0.63% 141 97317 0.67% 142 103889 0.71% 143 112774 0.77% 144 126229 0.86% 145 143872 0.98% 146 171061 1.17% 147 216030 1.48% 148 310931 2.13% 149 573142 3.92% 150 2789987 19.07% 151 7769241 53.11% 14627531 reads passed initial QC criterion=sequence-density sequence-density=0.76 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=27 prefix-density=0.79 prefix-fanout=2.1 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.14 sequence-density-rank=22 fanout-score=33.53 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=11.2 sequence=ACACCAGCAATGATTGT criterion=sequence-density sequence-density=0.87 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=22 prefix-density=0.88 prefix-fanout=2.1 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=27 fanout-score=35.99 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=6.2 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTC SRR7166148 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 17:06:25 Started mapping on | Feb 14 17:06:25 Finished on | Feb 14 17:07:46 Mapping speed, Million of reads per hour | 650.11 Number of input reads | 14627531 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 13936051 Uniquely mapped reads % | 95.27% Average mapped length | 290.90 Number of splices: Total | 11378886 Number of splices: Annotated (sjdb) | 11137491 Number of splices: GT/AG | 11184788 Number of splices: GC/AG | 143333 Number of splices: AT/AC | 8495 Number of splices: Non-canonical | 42270 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.04% Deletion average length | 2.46 Insertion rate per base | 0.03% Insertion average length | 2.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 368829 % of reads mapped to multiple loci | 2.52% Number of reads mapped to too many loci | 40810 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.85% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 333447 333447 333447 N_multimapping 368829 368829 368829 N_noFeature 432206 13738946 520725 N_ambiguous 176724 1351 67221 UnstrandedReadsAssigned:13327121 PositiveStrandReadsAssigned:195754 NegativeStrandReadsAssigned:13348105 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7166148 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166148-trimmed-pair1.fastq SRR7166148-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,627,531 reads, 13,265,633 reads pseudoaligned [quant] estimated average fragment length: 218.427 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,137 rounds 52401 SRR7166148.ke.tsv 34699 SRR7166148.se.tsv 87100 total ==> SRR7166148.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1800.57 1057 35.6607 Potri.005G024800.1.v4.1 1035 817.573 286 21.2503 Potri.004G059700.1.v4.1 961 743.593 39 3.18607 Potri.007G009000.2.v4.1 1416 1198.57 0 0 Potri.003G141000.2.v4.1 2943 2725.57 605 13.4841 Potri.016G087400.1.v4.1 270 91.1477 815 543.172 Potri.015G069301.1.v4.1 564 349.406 0 0 Potri.010G195200.1.v4.1 1773 1555.57 216 8.43507 Potri.012G127500.1.v4.1 977 759.583 4541 363.163 ==> SRR7166148.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 42 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 795 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 201 SRR7166148 completed mapping pipeline successfully