Starting /dee2/code/volunteer_pipeline.sh SRR7166149 current disk space = 3112496365568 free memory = 1307851752 SRR7166149 SRAfilesize 28559e8ef1f9129214f85a825440521f SRR7166149.sra SRR7166149.sra file validated SRR7166149 is paired end SRR7166149 is conventional basespace SRR7166149 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166149_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.5105 32.0 30.0 33.0 18.0 33.0 2 32.3335 33.0 32.0 33.0 31.0 34.0 3 31.99775 33.0 31.0 33.0 29.0 34.0 4 32.516 33.0 33.0 34.0 31.0 34.0 5 32.69075 33.0 33.0 34.0 32.0 34.0 6 36.81225 38.0 37.0 38.0 34.0 38.0 7 36.98875 38.0 38.0 38.0 35.0 38.0 8 37.40725 38.0 38.0 38.0 37.0 38.0 9 37.48625 38.0 38.0 38.0 37.0 38.0 10-14 37.5659 38.0 38.0 38.0 37.8 38.0 15-19 37.57905 38.0 38.0 38.0 37.8 38.0 20-24 37.5667 38.0 38.0 38.0 38.0 38.0 25-29 37.490899999999996 38.0 38.0 38.0 37.4 38.0 30-34 37.49264999999999 38.0 38.0 38.0 37.0 38.0 35-39 37.424549999999996 38.0 38.0 38.0 37.0 38.0 40-44 37.399800000000006 38.0 38.0 38.0 37.0 38.0 45-49 37.424249999999994 38.0 38.0 38.0 37.0 38.0 50-54 37.19615 38.0 38.0 38.0 36.8 38.0 55-59 36.7014 38.0 38.0 38.0 36.0 38.0 60-64 36.96535 38.0 38.0 38.0 36.0 38.0 65-69 37.137950000000004 38.0 38.0 38.0 36.2 38.0 70-74 37.068749999999994 38.0 38.0 38.0 36.0 38.0 75-79 36.56055 38.0 38.0 38.0 35.2 38.0 80-84 36.434999999999995 38.0 38.0 38.0 35.0 38.0 85-89 36.2638 38.0 38.0 38.0 34.2 38.0 90-94 36.213499999999996 38.0 38.0 38.0 34.0 38.0 95-99 36.08405 38.0 38.0 38.0 34.0 38.0 100-104 36.097150000000006 38.0 38.0 38.0 34.0 38.0 105-109 35.77975 38.0 37.8 38.0 33.2 38.0 110-114 35.752300000000005 38.0 37.6 38.0 33.0 38.0 115-119 35.582800000000006 38.0 37.0 38.0 31.8 38.0 120-124 35.4082 38.0 37.0 38.0 31.0 38.0 125-129 35.295 38.0 36.8 38.0 31.0 38.0 130-134 35.0782 38.0 36.0 38.0 28.4 38.0 135-139 34.80615 38.0 36.0 38.0 27.8 38.0 140-144 34.48945 38.0 35.8 38.0 26.0 38.0 145-149 34.102149999999995 38.0 35.4 38.0 24.2 38.0 150-151 30.853625 36.5 31.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 3.0 16 2.0 17 5.0 18 5.0 19 52.0 20 3.0 21 7.0 22 7.0 23 7.0 24 9.0 25 7.0 26 13.0 27 17.0 28 30.0 29 31.0 30 41.0 31 53.0 32 60.0 33 90.0 34 144.0 35 295.0 36 565.0 37 2554.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.16300697494188 18.806509945750452 8.834926375613536 33.19555670369414 2 17.95 28.050000000000004 37.375 16.625 3 15.75 31.374999999999996 29.349999999999998 23.525 4 19.75 35.949999999999996 23.525 20.775 5 22.125 36.375 23.125 18.375 6 17.5 36.575 24.55 21.375 7 12.525 22.225 45.625 19.625 8 17.1 22.925 27.650000000000002 32.324999999999996 9 19.075 22.775000000000002 28.849999999999998 29.299999999999997 10-14 18.87 30.59 26.93 23.61 15-19 18.795 29.765000000000004 27.265 24.175 20-24 18.995 30.0 27.71 23.294999999999998 25-29 19.105 29.470000000000002 27.955000000000002 23.47 30-34 19.225 29.630000000000003 27.705000000000002 23.44 35-39 19.435 29.085 27.935 23.544999999999998 40-44 19.31 29.880000000000003 27.384999999999998 23.425 45-49 19.295 29.404999999999998 27.91 23.39 50-54 20.057249033294834 28.745040928036964 27.590016572088583 23.607693466579622 55-59 19.022181522181523 28.479853479853478 28.561253561253565 23.936711436711438 60-64 19.623115577889447 28.788944723618094 28.55276381909548 23.035175879396984 65-69 19.65572457966373 30.309247397918337 27.4919935948759 22.543034427542032 70-74 19.305 29.880000000000003 27.73 23.085 75-79 19.49 29.755 27.57 23.185 80-84 20.150000000000002 29.32 27.785 22.745 85-89 19.24 29.92 27.465 23.375 90-94 19.97 29.275000000000002 27.589999999999996 23.165 95-99 19.515 28.82 27.779999999999998 23.885 100-104 19.783902756240305 28.697914061327594 27.487369316192282 24.030813866239807 105-109 20.08034145116746 28.742154155159426 27.72784333417022 23.449661059502887 110-114 21.154519533790207 28.958031114001297 26.967135210844877 22.920314141363612 115-119 20.416437259122077 29.410881425496772 27.018369287752144 23.15431202762901 120-124 21.112111211121114 28.95289528952895 26.712671267126716 23.22232223222322 125-129 20.575 28.939999999999998 26.715 23.77 130-134 20.49 28.77 27.08 23.66 135-139 20.549999999999997 28.975 26.625 23.849999999999998 140-144 20.68 29.29 26.25 23.78 145-149 20.330000000000002 29.335 26.5 23.835 150-151 21.531339922432128 28.287251344926812 25.785061929188043 24.39634680345302 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.5 22 2.5 23 4.0 24 4.0 25 4.5 26 7.0 27 7.5 28 16.0 29 25.0 30 29.5 31 37.5 32 41.5 33 67.0 34 85.5 35 96.0 36 129.5 37 144.0 38 153.0 39 200.5 40 231.0 41 226.0 42 240.0 43 262.0 44 267.5 45 250.0 46 235.5 47 219.5 48 203.0 49 177.0 50 151.0 51 128.5 52 89.0 53 65.0 54 54.0 55 39.5 56 24.5 57 17.0 58 13.0 59 9.0 60 8.0 61 7.5 62 7.5 63 6.5 64 3.0 65 2.0 66 1.0 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.225 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.43499999999999994 55-59 1.72 60-64 0.5 65-69 0.08 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.045 105-109 0.42500000000000004 110-114 0.045 115-119 0.105 120-124 0.01 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.05 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59204487506375 97.65 2 0.35696073431922487 0.7000000000000001 3 0.025497195308516064 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.025497195308516064 1.575 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCATAACATCTCGTAT 63 1.575 TruSeq Adapter, Index 6 (97% over 37bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.42500000000000004 0.0 0.0 0.0 0.0 94-95 0.525 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.725 0.0 0.0 0.0 0.0 100-101 0.825 0.0 0.0 0.0 0.0 102-103 1.0125 0.0 0.0 0.0 0.0 104-105 1.3125 0.0 0.0 0.0 0.0 106-107 1.525 0.0 0.0 0.0 0.0 108-109 1.8625 0.0 0.0 0.0 0.0 110-111 2.2125 0.0 0.0 0.0 0.0 112-113 2.4625 0.0 0.0 0.0 0.0 114-115 2.9 0.0 0.0 0.0 0.0 116-117 3.2750000000000004 0.0 0.0 0.0 0.0 118-119 3.675 0.0 0.0 0.0 0.0 120-121 4.1 0.0 0.0 0.0 0.0 122-123 4.625 0.0 0.0 0.0 0.0 124-125 5.0 0.0 0.0 0.0 0.0 126-127 5.45 0.0 0.0 0.0 0.0 128-129 5.862500000000001 0.0 0.0 0.0 0.0 130-131 6.4 0.0 0.0 0.0 0.0 132-133 6.95 0.0 0.0 0.0 0.0 134-135 7.625 0.0 0.0 0.0 0.0 136-137 7.9875 0.0 0.0 0.0 0.0 138-139 8.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGCTAAC 10 0.0066523887 146.26582 1 TGAAGTA 10 0.006910676 144.4375 8 AAAAAAA 165 0.005560086 7.8784094 70-74 >>END_MODULE SRR7166149 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166149_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9515 33.0 33.0 34.0 32.0 34.0 2 32.986 34.0 33.0 34.0 32.0 34.0 3 33.015 34.0 33.0 34.0 32.0 34.0 4 33.05675 34.0 33.0 34.0 32.0 34.0 5 32.97025 34.0 33.0 34.0 32.0 34.0 6 37.188 38.0 38.0 38.0 37.0 38.0 7 37.18075 38.0 38.0 38.0 37.0 38.0 8 37.22175 38.0 38.0 38.0 37.0 38.0 9 37.1535 38.0 38.0 38.0 37.0 38.0 10-14 37.2102 38.0 38.0 38.0 36.8 38.0 15-19 37.1217 38.0 38.0 38.0 36.6 38.0 20-24 37.117850000000004 38.0 38.0 38.0 36.6 38.0 25-29 37.11305 38.0 38.0 38.0 36.6 38.0 30-34 37.07115 38.0 38.0 38.0 36.0 38.0 35-39 36.99825 38.0 38.0 38.0 36.0 38.0 40-44 36.87595 38.0 38.0 38.0 36.0 38.0 45-49 36.57965 38.0 38.0 38.0 34.6 38.0 50-54 36.43495 38.0 38.0 38.0 34.2 38.0 55-59 36.39020000000001 38.0 38.0 38.0 34.0 38.0 60-64 36.3335 38.0 38.0 38.0 34.0 38.0 65-69 36.3638 38.0 38.0 38.0 34.0 38.0 70-74 36.3383 38.0 38.0 38.0 34.0 38.0 75-79 36.22215 38.0 38.0 38.0 33.8 38.0 80-84 35.902150000000006 38.0 38.0 38.0 33.2 38.0 85-89 35.678450000000005 38.0 37.2 38.0 32.6 38.0 90-94 35.4805 38.0 37.0 38.0 30.6 38.0 95-99 35.2801 38.0 37.0 38.0 29.4 38.0 100-104 35.26805 38.0 37.0 38.0 29.4 38.0 105-109 35.10934999999999 38.0 37.0 38.0 29.0 38.0 110-114 34.875299999999996 38.0 36.4 38.0 27.8 38.0 115-119 34.5106 38.0 35.6 38.0 25.4 38.0 120-124 34.3296 38.0 35.2 38.0 24.4 38.0 125-129 34.048500000000004 38.0 35.0 38.0 23.0 38.0 130-134 33.55545 38.0 34.4 38.0 19.8 38.0 135-139 33.1888 38.0 34.0 38.0 15.0 38.0 140-144 32.5983 38.0 33.8 38.0 14.0 38.0 145-149 31.859050000000003 38.0 33.2 38.0 8.8 38.0 150-151 27.7035 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 2.0 4 2.0 5 1.0 6 0.0 7 0.0 8 1.0 9 4.0 10 4.0 11 3.0 12 5.0 13 4.0 14 1.0 15 5.0 16 8.0 17 20.0 18 26.0 19 15.0 20 14.0 21 13.0 22 13.0 23 21.0 24 21.0 25 16.0 26 21.0 27 24.0 28 30.0 29 39.0 30 47.0 31 68.0 32 91.0 33 124.0 34 170.0 35 315.0 36 716.0 37 2149.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.55 16.275000000000002 12.65 29.525000000000002 2 22.425 24.349999999999998 37.775 15.45 3 20.849999999999998 25.424999999999997 34.275 19.45 4 24.9 34.575 20.825 19.7 5 24.224999999999998 38.125 21.325 16.325 6 19.514635976982735 38.1285964473355 24.218163622717036 18.138603952964726 7 17.858929464732366 17.483741870935468 44.022011005502755 20.635317658829415 8 19.834917458729365 23.186593296648326 26.88844422211106 30.09004502251126 9 23.461730865432717 23.961980990495245 28.16408204102051 24.412206103051524 10-14 23.637091127338202 28.038411523457036 27.153145943783137 21.171351405421625 15-19 23.737121136340903 27.48324497349205 28.373512053616086 20.406121836550966 20-24 23.644457783113246 28.49139655862345 27.611044417767104 20.2531012404962 25-29 23.42139497648354 28.585009506654657 27.854498148704092 20.13909736815771 30-34 23.806664665265686 27.05894125888122 28.32983088161713 20.804563194235964 35-39 22.175522866006204 28.965275692985088 27.81947363154208 21.039727809466626 40-44 23.73924354612768 27.751650990594356 28.422053231939167 20.087052231338802 45-49 23.17006053935058 28.323410216640816 28.29339070395757 20.213138540051034 50-54 23.153522818254604 28.002401921537228 28.157526020816654 20.686549239391514 55-59 24.061843290303212 27.16901831281897 28.54498148704093 20.224156909836886 60-64 23.086160312218553 27.77944561192835 28.414890423296306 20.71950365255679 65-69 22.929904437884623 27.933156551758643 29.068894781608044 20.068044228748686 70-74 22.7982385908727 29.443554843875102 27.68714971977582 20.07105684547638 75-79 23.18971125456638 28.78446679677726 27.70354801581344 20.322273932842915 80-84 22.12269815852682 29.353482786228984 28.12249799839872 20.401321056845475 85-89 23.502626970227674 28.896672504378284 27.72079059294471 19.879909932449337 90-94 23.18238679009257 28.651488616462345 27.81085814360771 20.355266449837377 95-99 22.902176632474355 28.801601200900674 28.016012009006758 20.280210157618214 100-104 23.95796847635727 28.741556167125342 27.830873154866147 19.469602201651238 105-109 23.35251438578934 28.43632724543407 28.326244683512634 19.884913685263946 110-114 23.597698273705277 28.621466099574683 27.710783087315487 20.070052539404553 115-119 24.172798718526305 28.512789708164387 27.902087400510588 19.412324172798716 120-124 24.396715730449582 28.13657755081606 27.856213077000103 19.610493641734255 125-129 24.3931735148391 28.326910565036783 27.56618787848456 19.71372804163956 130-134 23.716601621134796 28.735114580206144 27.83448413889723 19.713799659761833 135-139 24.884930958575143 28.311987192315392 27.396437862717633 19.406643986391835 140-144 25.035021012607565 28.662197318391037 26.691014608765258 19.61176706023614 145-149 25.10131585530595 28.568569570220642 27.242707760044027 19.08740681442938 150-151 25.731432858214554 28.619654913728432 26.63165791447862 19.017254313578395 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 1.0 5 0.5 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 1.0 21 1.5 22 1.0 23 0.5 24 2.0 25 3.5 26 6.0 27 6.5 28 8.5 29 11.0 30 14.0 31 22.5 32 30.0 33 38.5 34 52.0 35 66.0 36 87.0 37 108.5 38 153.0 39 188.0 40 201.5 41 226.0 42 244.5 43 279.5 44 284.5 45 279.0 46 278.5 47 256.0 48 240.5 49 198.0 50 159.5 51 136.0 52 106.0 53 82.5 54 56.0 55 38.0 56 29.5 57 22.0 58 18.5 59 14.5 60 9.0 61 9.5 62 9.5 63 4.5 64 0.5 65 0.5 66 2.0 67 2.0 68 0.5 69 0.0 70 0.0 71 0.5 72 1.5 73 1.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.075 7 0.05 8 0.05 9 0.05 10-14 0.03 15-19 0.03 20-24 0.04 25-29 0.06999999999999999 30-34 0.06999999999999999 35-39 0.06999999999999999 40-44 0.06 45-49 0.065 50-54 0.08 55-59 0.06999999999999999 60-64 0.06999999999999999 65-69 0.065 70-74 0.08 75-79 0.08499999999999999 80-84 0.08 85-89 0.075 90-94 0.075 95-99 0.075 100-104 0.075 105-109 0.075 110-114 0.075 115-119 0.11499999999999999 120-124 0.13 125-129 0.095 130-134 0.06999999999999999 135-139 0.06 140-144 0.06 145-149 0.065 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.46564885496183 97.725 2 0.45801526717557256 0.8999999999999999 3 0.02544529262086514 0.075 4 0.0 0.0 5 0.02544529262086514 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02544529262086514 1.175 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGCCATAACGTGTAGATCT 47 1.175 Illumina Single End PCR Primer 1 (96% over 32bp) GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGCCATAACGTGTAGATAT 5 0.125 Illumina Single End PCR Primer 1 (96% over 32bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.0125 0.0 0.0 0.025 0.0 76-77 0.025 0.0 0.0 0.025 0.0 78-79 0.025 0.0 0.0 0.025 0.0 80-81 0.0625 0.0 0.0 0.025 0.0 82-83 0.075 0.0 0.0 0.025 0.0 84-85 0.1 0.0 0.0 0.025 0.0 86-87 0.16249999999999998 0.0 0.0 0.025 0.0 88-89 0.2 0.0 0.0 0.025 0.0 90-91 0.30000000000000004 0.0 0.0 0.025 0.0 92-93 0.375 0.0 0.0 0.025 0.0 94-95 0.475 0.0 0.0 0.025 0.0 96-97 0.5625 0.0 0.0 0.025 0.0 98-99 0.675 0.0 0.0 0.025 0.0 100-101 0.7749999999999999 0.0 0.0 0.025 0.0 102-103 0.9624999999999999 0.0 0.0 0.025 0.0 104-105 1.2625000000000002 0.0 0.0 0.025 0.0 106-107 1.475 0.0 0.0 0.025 0.0 108-109 1.8375 0.0 0.0 0.025 0.0 110-111 2.1375 0.0 0.0 0.025 0.0 112-113 2.375 0.0 0.0 0.025 0.0 114-115 2.75 0.0 0.0 0.025 0.0 116-117 3.1500000000000004 0.0 0.0 0.025 0.0 118-119 3.5375 0.0 0.0 0.025 0.0 120-121 3.925 0.0 0.0 0.025 0.0 122-123 4.475 0.0 0.0 0.025 0.0 124-125 4.862500000000001 0.0 0.0 0.025 0.0 126-127 5.325 0.0 0.0 0.025 0.0 128-129 5.762499999999999 0.0 0.0 0.025 0.0 130-131 6.3375 0.0 0.0 0.025 0.0 132-133 6.8375 0.0 0.0 0.025 0.0 134-135 7.512499999999999 0.0 0.0 0.025 0.0 136-137 7.925 0.0 0.0 0.025 0.0 138-139 8.3625 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGGGGG 20 0.00593511 29.0 20-24 AAAAAAA 185 0.0016759153 7.8378377 70-74 >>END_MODULE Read 869498 spots for SRR7166149.sra Written 869498 spots for SRR7166149.sra Read 869498 spots for SRR7166149.sra Written 869498 spots for SRR7166149.sra Read 869498 spots for SRR7166149.sra Written 869498 spots for SRR7166149.sra Read 869498 spots for SRR7166149.sra Written 869498 spots for SRR7166149.sra Read 869498 spots for SRR7166149.sra Written 869498 spots for SRR7166149.sra Read 869498 spots for SRR7166149.sra Written 869498 spots for SRR7166149.sra Read 869498 spots for SRR7166149.sra Written 869498 spots for SRR7166149.sra Read 869498 spots for SRR7166149.sra Written 869498 spots for SRR7166149.sra Read 869498 spots for SRR7166149.sra Written 869498 spots for SRR7166149.sra Read 869498 spots for SRR7166149.sra Written 869498 spots for SRR7166149.sra Read 869498 spots for SRR7166149.sra Written 869498 spots for SRR7166149.sra Read 869498 spots for SRR7166149.sra Written 869498 spots for SRR7166149.sra Read 869498 spots for SRR7166149.sra Written 869498 spots for SRR7166149.sra Read 869498 spots for SRR7166149.sra Written 869498 spots for SRR7166149.sra Read 869498 spots for SRR7166149.sra Written 869498 spots for SRR7166149.sra Read 869498 spots for SRR7166149.sra Written 869498 spots for SRR7166149.sra Read 869503 spots for SRR7166149.sra Written 869503 spots for SRR7166149.sra Read 869498 spots for SRR7166149.sra Written 869498 spots for SRR7166149.sra Read 869498 spots for SRR7166149.sra Written 869498 spots for SRR7166149.sra Read 869498 spots for SRR7166149.sra Written 869498 spots for SRR7166149.sra SRR ids: ['SRR7166149.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0xvh1jfz SRR7166149.sra spots: 17389965 blocks: [[1, 869498], [869499, 1738996], [1738997, 2608494], [2608495, 3477992], [3477993, 4347490], [4347491, 5216988], [5216989, 6086486], [6086487, 6955984], [6955985, 7825482], [7825483, 8694980], [8694981, 9564478], [9564479, 10433976], [10433977, 11303474], [11303475, 12172972], [12172973, 13042470], [13042471, 13911968], [13911969, 14781466], [14781467, 15650964], [15650965, 16520462], [16520463, 17389965]] SRR7166149 file size 5871188 SRR7166149 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166149 SRR7166149_1.fastq SRR7166149_2.fastq Input file: SRR7166149_1.fastq Paired file: SRR7166149_2.fastq trimmed: SRR7166149-trimmed-pair1.fastq, SRR7166149-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 15:56:07 2025 >> started Fri Feb 14 15:56:31 2025 >> done (24.253s) 17389965 read pairs processed; of these: 13809 ( 0.08%) short read pairs filtered out after trimming by size control 356368 ( 2.05%) empty read pairs filtered out after trimming by size control 17019788 (97.87%) read pairs available; of these: 7861138 (46.19%) trimmed read pairs available after processing 9158650 (53.81%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 7 0.00% 20 8 0.00% 21 10 0.00% 22 4 0.00% 23 10 0.00% 24 6 0.00% 25 8 0.00% 26 13 0.00% 27 5 0.00% 28 3 0.00% 29 5 0.00% 30 7 0.00% 31 6 0.00% 32 4 0.00% 33 8 0.00% 34 11 0.00% 35 4 0.00% 36 13 0.00% 37 14 0.00% 38 17 0.00% 39 15 0.00% 40 15 0.00% 41 12 0.00% 42 18 0.00% 43 16 0.00% 44 24 0.00% 45 25 0.00% 46 38 0.00% 47 55 0.00% 48 49 0.00% 49 70 0.00% 50 53 0.00% 51 62 0.00% 52 78 0.00% 53 89 0.00% 54 110 0.00% 55 121 0.00% 56 148 0.00% 57 218 0.00% 58 238 0.00% 59 238 0.00% 60 256 0.00% 61 276 0.00% 62 334 0.00% 63 426 0.00% 64 453 0.00% 65 453 0.00% 66 452 0.00% 67 457 0.00% 68 561 0.00% 69 603 0.00% 70 703 0.00% 71 871 0.01% 72 1055 0.01% 73 1191 0.01% 74 1422 0.01% 75 1704 0.01% 76 2832 0.02% 77 3363 0.02% 78 2524 0.01% 79 2476 0.01% 80 2804 0.02% 81 3026 0.02% 82 3639 0.02% 83 4135 0.02% 84 5593 0.03% 85 5838 0.03% 86 5965 0.04% 87 6344 0.04% 88 6905 0.04% 89 7253 0.04% 90 8225 0.05% 91 9188 0.05% 92 10093 0.06% 93 11175 0.07% 94 11966 0.07% 95 12950 0.08% 96 13720 0.08% 97 13996 0.08% 98 14918 0.09% 99 16344 0.10% 100 16705 0.10% 101 17999 0.11% 102 19595 0.12% 103 21085 0.12% 104 22225 0.13% 105 23900 0.14% 106 24826 0.15% 107 25499 0.15% 108 26623 0.16% 109 27203 0.16% 110 28594 0.17% 111 30150 0.18% 112 32308 0.19% 113 34618 0.20% 114 36327 0.21% 115 38535 0.23% 116 39380 0.23% 117 41425 0.24% 118 42135 0.25% 119 42927 0.25% 120 43727 0.26% 121 46211 0.27% 122 47783 0.28% 123 50442 0.30% 124 53307 0.31% 125 55358 0.33% 126 57628 0.34% 127 59182 0.35% 128 59980 0.35% 129 61957 0.36% 130 63849 0.38% 131 66068 0.39% 132 68867 0.40% 133 72677 0.43% 134 76282 0.45% 135 80711 0.47% 136 83656 0.49% 137 87690 0.52% 138 91322 0.54% 139 96227 0.57% 140 101517 0.60% 141 108308 0.64% 142 117452 0.69% 143 128934 0.76% 144 146239 0.86% 145 169581 1.00% 146 205059 1.20% 147 264814 1.56% 148 387141 2.27% 149 719333 4.23% 150 3399428 19.97% 151 9158650 53.81% 17019788 reads passed initial QC criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=2.93 fanout-score-rank=16 prefix-density=0.84 prefix-fanout=2.1 sequence=CACTTGCAGCCATTCTCAGCACCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=35.22 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.7 sequence=AAATAACATTACAAACGAGGAAGCAGCCGCAGCTTTAGCTTCTACTTTTATTTAATAGTTTTATAGATTACACAAAGGAAATACAACACAAGATCTCCCCACAAATCACACACATTGATGCAGTACTGAACTCGTTGCACGAAAGCGCTTAGATATATATTATACAAGTACTAGCATGATCACAAACATGTGATGCTTATTGGTCGAGATCGATGACCCCTTCTATTACTCCGTGCTAAGGGCTTCGTCGATGTCTTTAGTCATATGAACCATAAGATCAACATAAATCTCTGGAACCGGGACTTCAGGATGGAGTTTTTCGTATTCAATGGTCAGTTTTGCCAAGCAGCCCGAGCCTTTTGGTGTAAGCTGCCAG criterion=sequence-density sequence-density=0.79 sequence-density-rank=1 fanout-score=4.05 fanout-score-rank=11 prefix-density=0.97 prefix-fanout=3.3 sequence=TGCAAGTGCGGCAGTGGCTGCAA criterion=fanout-score sequence-density=0.08 sequence-density-rank=23 fanout-score=40.56 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=10.3 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7166149 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 15:57:55 Started mapping on | Feb 14 15:57:55 Finished on | Feb 14 15:59:38 Mapping speed, Million of reads per hour | 594.87 Number of input reads | 17019788 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 16302428 Uniquely mapped reads % | 95.79% Average mapped length | 292.37 Number of splices: Total | 14836578 Number of splices: Annotated (sjdb) | 14512636 Number of splices: GT/AG | 14597456 Number of splices: GC/AG | 185700 Number of splices: AT/AC | 12332 Number of splices: Non-canonical | 41090 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.04% Deletion average length | 2.41 Insertion rate per base | 0.02% Insertion average length | 2.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 404025 % of reads mapped to multiple loci | 2.37% Number of reads mapped to too many loci | 51578 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.46% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 324371 324371 324371 N_multimapping 404025 404025 404025 N_noFeature 591225 16072441 708048 N_ambiguous 190460 1330 76478 UnstrandedReadsAssigned:15520743 PositiveStrandReadsAssigned:228657 NegativeStrandReadsAssigned:15517902 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7166149 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166149-trimmed-pair1.fastq SRR7166149-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,019,788 reads, 15,424,071 reads pseudoaligned [quant] estimated average fragment length: 227.991 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,130 rounds 52401 SRR7166149.ke.tsv 34699 SRR7166149.se.tsv 87100 total ==> SRR7166149.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1791.01 1705 53.3262 Potri.005G024800.1.v4.1 1035 808.009 626 43.3982 Potri.004G059700.1.v4.1 961 734.041 36 2.74724 Potri.007G009000.2.v4.1 1416 1189.01 0 0 Potri.003G141000.2.v4.1 2943 2716.01 875.282 18.0522 Potri.016G087400.1.v4.1 270 86.84 1393 898.557 Potri.015G069301.1.v4.1 564 340.855 0 0 Potri.010G195200.1.v4.1 1773 1546.01 430 15.5801 Potri.012G127500.1.v4.1 977 750.014 11236 839.183 ==> SRR7166149.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 435 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 778 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 358 SRR7166149 completed mapping pipeline successfully