Starting /dee2/code/volunteer_pipeline.sh SRR7166150 current disk space = 3111815528448 free memory = 1448294088 SRR7166150 SRAfilesize 98ad4fd1379226c307c4fa9e3739efd1 SRR7166150.sra SRR7166150.sra file validated SRR7166150 is paired end SRR7166150 is conventional basespace SRR7166150 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166150_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.05675 33.0 33.0 34.0 32.0 34.0 2 32.978 34.0 33.0 34.0 32.0 34.0 3 32.85075 33.0 33.0 34.0 32.0 34.0 4 32.253 33.0 32.0 33.0 31.0 34.0 5 32.99275 33.0 33.0 34.0 33.0 34.0 6 37.08575 38.0 37.0 38.0 36.0 38.0 7 37.38225 38.0 38.0 38.0 37.0 38.0 8 37.5305 38.0 38.0 38.0 37.0 38.0 9 37.61875 38.0 38.0 38.0 38.0 38.0 10-14 37.566500000000005 38.0 38.0 38.0 38.0 38.0 15-19 37.6199 38.0 38.0 38.0 38.0 38.0 20-24 37.59235 38.0 38.0 38.0 38.0 38.0 25-29 37.56335 38.0 38.0 38.0 38.0 38.0 30-34 37.54395 38.0 38.0 38.0 38.0 38.0 35-39 37.5031 38.0 38.0 38.0 37.6 38.0 40-44 37.4841 38.0 38.0 38.0 37.6 38.0 45-49 37.46755 38.0 38.0 38.0 37.2 38.0 50-54 37.2884 38.0 38.0 38.0 37.0 38.0 55-59 36.877300000000005 38.0 38.0 38.0 36.4 38.0 60-64 37.089749999999995 38.0 38.0 38.0 36.6 38.0 65-69 37.28075 38.0 38.0 38.0 37.0 38.0 70-74 37.1416 38.0 38.0 38.0 36.0 38.0 75-79 37.168800000000005 38.0 38.0 38.0 36.0 38.0 80-84 37.02785 38.0 38.0 38.0 36.0 38.0 85-89 36.92700000000001 38.0 38.0 38.0 35.8 38.0 90-94 36.7782 38.0 38.0 38.0 34.8 38.0 95-99 36.67205 38.0 38.0 38.0 34.6 38.0 100-104 36.64874999999999 38.0 38.0 38.0 34.4 38.0 105-109 36.38615 38.0 38.0 38.0 34.0 38.0 110-114 36.42295 38.0 38.0 38.0 34.0 38.0 115-119 36.269999999999996 38.0 38.0 38.0 34.0 38.0 120-124 36.111000000000004 38.0 37.2 38.0 33.4 38.0 125-129 35.924 38.0 37.0 38.0 32.8 38.0 130-134 35.69295 38.0 36.8 38.0 31.4 38.0 135-139 35.52345 38.0 36.0 38.0 31.0 38.0 140-144 35.24245 38.0 36.0 38.0 31.0 38.0 145-149 34.783500000000004 38.0 35.8 38.0 28.6 38.0 150-151 31.756999999999998 36.5 31.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 0.0 15 0.0 16 2.0 17 0.0 18 2.0 19 1.0 20 2.0 21 4.0 22 8.0 23 7.0 24 9.0 25 6.0 26 13.0 27 17.0 28 22.0 29 24.0 30 22.0 31 46.0 32 59.0 33 103.0 34 131.0 35 231.0 36 595.0 37 2695.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.35218508997429 18.303341902313626 11.79948586118252 32.544987146529564 2 19.650000000000002 24.3 38.15 17.9 3 18.15 29.875 28.175 23.799999999999997 4 20.549999999999997 37.4 22.5 19.55 5 20.295295295295297 38.11311311311311 22.922922922922922 18.66866866866867 6 16.825000000000003 37.925 23.775 21.475 7 12.950000000000001 20.625 45.275 21.15 8 17.5 21.175 28.449999999999996 32.875 9 18.95 22.2 29.549999999999997 29.299999999999997 10-14 19.415 30.7 26.135 23.75 15-19 20.025000000000002 28.115000000000002 28.494999999999997 23.365 20-24 19.495 29.285 27.73 23.49 25-29 19.439999999999998 29.354999999999997 27.985 23.22 30-34 20.14 28.939999999999998 27.73 23.189999999999998 35-39 19.63 29.220000000000002 27.82 23.330000000000002 40-44 20.369999999999997 28.444999999999997 27.735 23.45 45-49 19.830000000000002 29.270000000000003 27.169999999999998 23.73 50-54 19.65181617499498 28.446718844069835 28.306241220148504 23.595223760786673 55-59 20.0385063586158 28.732836803972233 27.88164361351776 23.34701322389421 60-64 19.8655563359085 28.900371225042644 27.505769037824823 23.72830340122404 65-69 20.294999999999998 28.425 27.634999999999998 23.645 70-74 20.724999999999998 28.449999999999996 27.715 23.11 75-79 19.845 28.74 28.04 23.375 80-84 20.575 28.975 27.529999999999998 22.919999999999998 85-89 20.65 28.810000000000002 27.505000000000003 23.035 90-94 20.25 29.195 27.525 23.03 95-99 19.495 28.994999999999997 27.700000000000003 23.810000000000002 100-104 20.990000000000002 28.73 27.315 22.965 105-109 20.456936720276566 28.293000651335237 27.426223758705348 23.823838869682852 110-114 21.285 29.235 26.555 22.925 115-119 20.724999999999998 29.065 26.86 23.35 120-124 21.15 28.794999999999998 26.645000000000003 23.41 125-129 20.565 28.455000000000002 27.32 23.66 130-134 20.979999999999997 28.99 26.47 23.56 135-139 21.15 28.595 26.125 24.13 140-144 21.075 28.610000000000003 25.929999999999996 24.385 145-149 20.875 28.994999999999997 26.27 23.86 150-151 21.60030052592036 28.650137741046834 25.582268970698724 24.167292762334082 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 2.0 23 2.0 24 2.0 25 4.5 26 5.5 27 6.5 28 12.5 29 20.0 30 29.5 31 41.0 32 49.5 33 64.5 34 75.0 35 87.5 36 107.5 37 118.0 38 149.5 39 173.5 40 195.0 41 218.0 42 236.0 43 256.0 44 268.0 45 271.0 46 250.0 47 228.0 48 204.5 49 183.0 50 160.0 51 132.5 52 101.5 53 74.5 54 59.5 55 46.0 56 39.0 57 33.0 58 22.5 59 12.5 60 10.5 61 14.5 62 10.0 63 6.0 64 6.0 65 3.5 66 1.5 67 0.5 68 0.5 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.75 2 0.0 3 0.0 4 0.0 5 0.1 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.33999999999999997 55-59 1.315 60-64 0.33 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.20500000000000002 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.17500000000000002 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52261306532664 99.02499999999999 2 0.4522613065326633 0.8999999999999999 3 0.02512562814070352 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.21250000000000002 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.2875 0.0 0.0 0.0 0.0 80-81 0.3 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.4125 0.0 0.0 0.0 0.0 88-89 0.45 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.6875 0.0 0.0 0.0 0.0 94-95 0.875 0.0 0.0 0.0 0.0 96-97 1.05 0.0 0.0 0.0 0.0 98-99 1.225 0.0 0.0 0.0 0.0 100-101 1.3624999999999998 0.0 0.0 0.0 0.0 102-103 1.6875 0.0 0.0 0.0 0.0 104-105 2.075 0.0 0.0 0.0 0.0 106-107 2.4375 0.0 0.0 0.0 0.0 108-109 2.8125 0.0 0.0 0.0 0.0 110-111 3.2375 0.0 0.0 0.0 0.0 112-113 3.75 0.0 0.0 0.0 0.0 114-115 4.175 0.0 0.0 0.0 0.0 116-117 4.612500000000001 0.0 0.0 0.0 0.0 118-119 5.137499999999999 0.0 0.0 0.0 0.0 120-121 5.8125 0.0 0.0 0.0 0.0 122-123 6.362500000000001 0.0 0.0 0.0 0.0 124-125 7.0 0.0 0.0 0.0 0.0 126-127 7.775 0.0 0.0 0.0 0.0 128-129 8.4625 0.0 0.0 0.0 0.0 130-131 9.1875 0.0 0.0 0.0 0.0 132-133 10.0625 0.0 0.0 0.0 0.0 134-135 10.85 0.0 0.0 0.0 0.0 136-137 11.625 0.0 0.0 0.0 0.0 138-139 12.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATTTAG 10 0.006832588 144.9875 5 >>END_MODULE SRR7166150 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166150_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.97075 33.0 33.0 34.0 32.0 34.0 2 33.01925 34.0 33.0 34.0 32.0 34.0 3 33.1405 34.0 33.0 34.0 33.0 34.0 4 33.08975 34.0 33.0 34.0 32.0 34.0 5 32.9765 34.0 33.0 34.0 32.0 34.0 6 37.295 38.0 38.0 38.0 37.0 38.0 7 37.35725 38.0 38.0 38.0 37.0 38.0 8 37.3605 38.0 38.0 38.0 37.0 38.0 9 37.339 38.0 38.0 38.0 37.0 38.0 10-14 37.2999 38.0 38.0 38.0 37.0 38.0 15-19 37.2745 38.0 38.0 38.0 37.0 38.0 20-24 37.21265 38.0 38.0 38.0 37.0 38.0 25-29 37.221799999999995 38.0 38.0 38.0 37.0 38.0 30-34 37.161300000000004 38.0 38.0 38.0 37.0 38.0 35-39 37.086149999999996 38.0 38.0 38.0 36.6 38.0 40-44 37.071250000000006 38.0 38.0 38.0 36.8 38.0 45-49 36.977050000000006 38.0 38.0 38.0 36.0 38.0 50-54 36.9031 38.0 38.0 38.0 36.0 38.0 55-59 36.80845 38.0 38.0 38.0 35.6 38.0 60-64 36.80995 38.0 38.0 38.0 35.6 38.0 65-69 36.76465 38.0 38.0 38.0 35.8 38.0 70-74 36.65035 38.0 38.0 38.0 35.0 38.0 75-79 36.58669999999999 38.0 38.0 38.0 34.8 38.0 80-84 36.5084 38.0 38.0 38.0 34.0 38.0 85-89 36.42775 38.0 38.0 38.0 34.0 38.0 90-94 36.19265 38.0 38.0 38.0 33.8 38.0 95-99 36.09315 38.0 38.0 38.0 33.6 38.0 100-104 35.9696 38.0 37.4 38.0 33.0 38.0 105-109 35.837900000000005 38.0 37.0 38.0 32.4 38.0 110-114 35.53815 38.0 37.0 38.0 31.2 38.0 115-119 35.338899999999995 38.0 36.6 38.0 29.4 38.0 120-124 35.13625 38.0 36.0 38.0 28.4 38.0 125-129 34.8673 38.0 36.0 38.0 27.6 38.0 130-134 34.55445 38.0 35.0 38.0 27.2 38.0 135-139 34.16225 38.0 35.0 38.0 23.6 38.0 140-144 33.31035 38.0 34.0 38.0 17.2 38.0 145-149 32.34565 38.0 33.2 38.0 11.6 38.0 150-151 28.190125000000002 36.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 0.0 4 1.0 5 1.0 6 1.0 7 0.0 8 6.0 9 1.0 10 3.0 11 1.0 12 1.0 13 1.0 14 1.0 15 3.0 16 3.0 17 3.0 18 6.0 19 6.0 20 5.0 21 12.0 22 6.0 23 14.0 24 17.0 25 14.0 26 22.0 27 26.0 28 30.0 29 40.0 30 38.0 31 54.0 32 74.0 33 129.0 34 176.0 35 297.0 36 705.0 37 2295.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.675 15.6 15.174999999999999 28.549999999999997 2 24.7 22.175 34.449999999999996 18.675 3 21.425 25.05 33.275 20.25 4 24.875 34.675 20.424999999999997 20.025000000000002 5 22.375 37.6 21.575 18.45 6 17.424999999999997 36.675000000000004 24.9 21.0 7 17.575 15.475 47.0 19.950000000000003 8 21.45 20.775 27.224999999999998 30.55 9 22.425 22.425 28.749999999999996 26.400000000000002 10-14 22.52 28.58 26.945000000000004 21.955 15-19 23.305 27.235 28.215 21.245 20-24 22.884999999999998 27.935 27.900000000000002 21.279999999999998 25-29 22.34 28.335 27.955000000000002 21.37 30-34 23.04 27.47 28.79 20.7 35-39 22.935 27.134999999999998 28.355000000000004 21.575 40-44 23.165 27.92 28.444999999999997 20.47 45-49 22.915 27.66 28.610000000000003 20.815 50-54 23.080000000000002 28.275 28.32 20.325 55-59 22.905 28.060000000000002 27.88 21.154999999999998 60-64 22.91 28.29 28.08 20.72 65-69 23.3 27.845 28.435 20.419999999999998 70-74 23.535 27.389999999999997 28.244999999999997 20.830000000000002 75-79 23.645 27.91 27.855 20.59 80-84 23.625 27.68 28.27 20.424999999999997 85-89 22.900000000000002 28.655 28.310000000000002 20.135 90-94 23.91 27.665 27.944999999999997 20.48 95-99 23.52 27.775 28.244999999999997 20.46 100-104 23.775 27.685 27.694999999999997 20.845 105-109 23.755000000000003 28.21 27.825 20.21 110-114 23.835 28.65 27.689999999999998 19.825 115-119 24.33 28.28 27.365000000000002 20.025000000000002 120-124 24.005000000000003 28.16 27.650000000000002 20.185 125-129 23.965 28.665000000000003 27.705000000000002 19.665 130-134 25.06 27.915 27.37 19.655 135-139 24.84 28.005000000000003 27.395000000000003 19.759999999999998 140-144 25.7 28.63 26.334999999999997 19.335 145-149 25.845000000000002 28.075 26.545 19.535 150-151 25.956967725794343 28.071053289967473 26.720040030022517 19.25193895421566 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 1.5 22 0.5 23 2.0 24 3.5 25 2.0 26 2.0 27 3.0 28 5.5 29 10.0 30 20.0 31 27.0 32 28.5 33 34.0 34 42.0 35 57.0 36 82.0 37 105.0 38 144.5 39 183.5 40 199.5 41 208.5 42 244.5 43 280.5 44 295.5 45 290.0 46 274.5 47 259.0 48 215.5 49 184.5 50 161.0 51 134.0 52 112.0 53 84.5 54 61.0 55 51.5 56 51.0 57 37.0 58 21.0 59 17.5 60 15.5 61 13.0 62 8.5 63 7.5 64 3.5 65 1.0 66 2.5 67 4.5 68 3.0 69 0.5 70 1.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.4703656998739 98.6 2 0.37831021437578816 0.75 3 0.07566204287515763 0.22499999999999998 4 0.025220680958385876 0.1 5 0.0 0.0 6 0.025220680958385876 0.15 7 0.025220680958385876 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTT 7 0.17500000000000002 No Hit AGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCCTATTT 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.21250000000000002 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.2875 0.0 0.0 0.0 0.0 80-81 0.3 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.425 0.0 0.0 0.0 0.0 90-91 0.525 0.0 0.0 0.0 0.0 92-93 0.6875 0.0 0.0 0.0 0.0 94-95 0.8625 0.0 0.0 0.0 0.0 96-97 1.025 0.0 0.0 0.0 0.0 98-99 1.2125 0.0 0.0 0.0 0.0 100-101 1.3375 0.0 0.0 0.0 0.0 102-103 1.6375 0.0 0.0 0.0 0.0 104-105 2.025 0.0 0.0 0.0 0.0 106-107 2.375 0.0 0.0 0.0 0.0 108-109 2.7375 0.0 0.0 0.0 0.0 110-111 3.1625 0.0 0.0 0.0 0.0 112-113 3.675 0.0 0.0 0.0 0.0 114-115 4.1 0.0 0.0 0.0 0.0 116-117 4.512499999999999 0.0 0.0 0.0 0.0 118-119 5.075 0.0 0.0 0.0 0.0 120-121 5.762499999999999 0.0 0.0 0.0 0.0 122-123 6.324999999999999 0.0 0.0 0.0 0.0 124-125 6.95 0.0 0.0 0.0 0.0 126-127 7.7375 0.0 0.0 0.0 0.0 128-129 8.425 0.0 0.0 0.0 0.0 130-131 9.1625 0.0 0.0 0.0 0.0 132-133 10.0375 0.0 0.0 0.0 0.0 134-135 10.787500000000001 0.0 0.0 0.0 0.0 136-137 11.5625 0.0 0.0 0.0 0.0 138-139 12.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 838030 spots for SRR7166150.sra Written 838030 spots for SRR7166150.sra Read 838030 spots for SRR7166150.sra Written 838030 spots for SRR7166150.sra Read 838030 spots for SRR7166150.sra Written 838030 spots for SRR7166150.sra Read 838030 spots for SRR7166150.sra Written 838030 spots for SRR7166150.sra Read 838030 spots for SRR7166150.sra Written 838030 spots for SRR7166150.sra Read 838030 spots for SRR7166150.sra Written 838030 spots for SRR7166150.sra Read 838030 spots for SRR7166150.sra Written 838030 spots for SRR7166150.sra Read 838030 spots for SRR7166150.sra Written 838030 spots for SRR7166150.sra Read 838030 spots for SRR7166150.sra Written 838030 spots for SRR7166150.sra Read 838030 spots for SRR7166150.sra Written 838030 spots for SRR7166150.sra Read 838030 spots for SRR7166150.sra Written 838030 spots for SRR7166150.sra Read 838030 spots for SRR7166150.sra Written 838030 spots for SRR7166150.sra Read 838030 spots for SRR7166150.sra Written 838030 spots for SRR7166150.sra Read 838030 spots for SRR7166150.sra Written 838030 spots for SRR7166150.sra Read 838030 spots for SRR7166150.sra Written 838030 spots for SRR7166150.sra Read 838030 spots for SRR7166150.sra Written 838030 spots for SRR7166150.sra Read 838030 spots for SRR7166150.sra Written 838030 spots for SRR7166150.sra Read 838030 spots for SRR7166150.sra Written 838030 spots for SRR7166150.sra Read 838044 spots for SRR7166150.sra Written 838044 spots for SRR7166150.sra Read 838030 spots for SRR7166150.sra Written 838030 spots for SRR7166150.sra SRR ids: ['SRR7166150.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ffj_5j99 SRR7166150.sra spots: 16760614 blocks: [[1, 838030], [838031, 1676060], [1676061, 2514090], [2514091, 3352120], [3352121, 4190150], [4190151, 5028180], [5028181, 5866210], [5866211, 6704240], [6704241, 7542270], [7542271, 8380300], [8380301, 9218330], [9218331, 10056360], [10056361, 10894390], [10894391, 11732420], [11732421, 12570450], [12570451, 13408480], [13408481, 14246510], [14246511, 15084540], [15084541, 15922570], [15922571, 16760614]] SRR7166150 file size 5657921 SRR7166150 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166150 SRR7166150_1.fastq SRR7166150_2.fastq Input file: SRR7166150_1.fastq Paired file: SRR7166150_2.fastq trimmed: SRR7166150-trimmed-pair1.fastq, SRR7166150-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 16:31:29 2025 >> started Fri Feb 14 16:31:57 2025 >> done (27.754s) 16760614 read pairs processed; of these: 10051 ( 0.06%) short read pairs filtered out after trimming by size control 11444 ( 0.07%) empty read pairs filtered out after trimming by size control 16739119 (99.87%) read pairs available; of these: 7853449 (46.92%) trimmed read pairs available after processing 8885670 (53.08%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 3 0.00% 20 5 0.00% 21 4 0.00% 22 5 0.00% 23 4 0.00% 24 10 0.00% 25 10 0.00% 26 4 0.00% 27 5 0.00% 28 10 0.00% 29 7 0.00% 30 9 0.00% 31 0 0.00% 32 6 0.00% 33 3 0.00% 34 10 0.00% 35 8 0.00% 36 6 0.00% 37 11 0.00% 38 19 0.00% 39 13 0.00% 40 18 0.00% 41 31 0.00% 42 37 0.00% 43 33 0.00% 44 24 0.00% 45 39 0.00% 46 29 0.00% 47 42 0.00% 48 56 0.00% 49 69 0.00% 50 86 0.00% 51 100 0.00% 52 110 0.00% 53 107 0.00% 54 142 0.00% 55 162 0.00% 56 188 0.00% 57 210 0.00% 58 284 0.00% 59 313 0.00% 60 405 0.00% 61 473 0.00% 62 471 0.00% 63 539 0.00% 64 634 0.00% 65 685 0.00% 66 718 0.00% 67 812 0.00% 68 962 0.01% 69 1112 0.01% 70 1405 0.01% 71 1649 0.01% 72 1931 0.01% 73 2086 0.01% 74 2415 0.01% 75 2703 0.02% 76 3030 0.02% 77 3197 0.02% 78 3590 0.02% 79 3991 0.02% 80 4540 0.03% 81 5290 0.03% 82 6205 0.04% 83 7022 0.04% 84 8244 0.05% 85 9128 0.05% 86 9386 0.06% 87 10055 0.06% 88 11017 0.07% 89 11797 0.07% 90 12795 0.08% 91 14239 0.09% 92 15926 0.10% 93 17392 0.10% 94 18877 0.11% 95 19967 0.12% 96 20579 0.12% 97 21191 0.13% 98 22358 0.13% 99 24165 0.14% 100 24696 0.15% 101 26081 0.16% 102 28597 0.17% 103 30606 0.18% 104 32478 0.19% 105 34443 0.21% 106 35143 0.21% 107 35309 0.21% 108 36338 0.22% 109 36928 0.22% 110 38764 0.23% 111 40378 0.24% 112 42617 0.25% 113 45573 0.27% 114 48099 0.29% 115 50050 0.30% 116 51436 0.31% 117 52153 0.31% 118 52987 0.32% 119 53348 0.32% 120 53732 0.32% 121 55705 0.33% 122 57715 0.34% 123 61363 0.37% 124 63965 0.38% 125 66027 0.39% 126 68284 0.41% 127 68850 0.41% 128 68960 0.41% 129 70721 0.42% 130 71117 0.42% 131 73314 0.44% 132 75980 0.45% 133 79732 0.48% 134 83694 0.50% 135 87294 0.52% 136 90102 0.54% 137 92776 0.55% 138 96120 0.57% 139 97657 0.58% 140 101694 0.61% 141 107334 0.64% 142 115264 0.69% 143 124365 0.74% 144 140199 0.84% 145 161622 0.97% 146 190518 1.14% 147 239666 1.43% 148 340637 2.03% 149 631331 3.77% 150 3116467 18.62% 151 8885670 53.08% 16739119 reads passed initial QC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=3.14 fanout-score-rank=22 prefix-density=0.56 prefix-fanout=2.9 sequence=CCACATTTGCAGCCACTGCC criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=46.92 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=9.1 sequence=TCAACAACTTCCCTATCTTTAATCCTCTCACTCCACAAATTCATAAGCTTCACCATTTTACTTCACCAATTCCTTAGAGATGTAATAGCCCATAACAATAGGAAATATCAGAAATCCAATAAGAATCAGCAATTCAGGAAGAAATATGACAAGGAGTAGTAGTGTGGATGTTGTTGTTAGACACTTCTTTTTGTCTTTAAATATAAGGCGTGGTAGAATTACTGGCACTCCAATGATTCCATATAACGGCCATAATGGAGCTATAGAATACAACACCAACGTCGCAAAAAACCAGCAAAAATTCTTAACATTATTTTTAGAAATCCCATACTG criterion=sequence-density sequence-density=0.75 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=31 prefix-density=0.76 prefix-fanout=2.1 sequence=GGCAGTGGCTGCAAATGTGGCATGTACCCTGACTTAGGTTTCTCAGAGAACACCACAACTGAGACAATCATTGCAGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=69.00 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=7.3 sequence=CTTCCATTTCCGCCCAAGCTGCTCACAGTATACGGGCGTCGGCATCCAGACCGTCGGCTGATCGTGGTTTTACTAGGCTAGACTAGCGTACGAGCACTATGGTCAGTAATTCCTGGAGGAATAGGTACCAAGAAAAAAACGAACCTTTGGGTTCCAGAGCTGTACGGTCGCACTGAACTCGGATAGGTCTCAGAAAAACGAAATATAGGCTTACGGTAGGTCCGAATGGCACAAAGCTTGTTCCGTTAGCTGGCATAAGATTCCATGCCTAGATGTGATACACGTTTCTGGAAACTGCCTCGTCATGCGACTGTTCCCCGGGGTCAGGGCCGCTGGTATTTGCTGT SRR7166150 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 16:32:48 Started mapping on | Feb 14 16:32:48 Finished on | Feb 14 16:36:00 Mapping speed, Million of reads per hour | 313.86 Number of input reads | 16739119 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 15222658 Uniquely mapped reads % | 90.94% Average mapped length | 290.02 Number of splices: Total | 14220652 Number of splices: Annotated (sjdb) | 13942800 Number of splices: GT/AG | 13983939 Number of splices: GC/AG | 183719 Number of splices: AT/AC | 10570 Number of splices: Non-canonical | 42424 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.04% Deletion average length | 2.16 Insertion rate per base | 0.02% Insertion average length | 2.17 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 414357 % of reads mapped to multiple loci | 2.48% Number of reads mapped to too many loci | 62537 % of reads mapped to too many loci | 0.37% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.10% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1111210 1111210 1111210 N_multimapping 414357 414357 414357 N_noFeature 517061 15018071 632024 N_ambiguous 168169 1153 77708 UnstrandedReadsAssigned:14537428 PositiveStrandReadsAssigned:203434 NegativeStrandReadsAssigned:14512926 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7166150 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166150-trimmed-pair1.fastq SRR7166150-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,739,119 reads, 14,462,083 reads pseudoaligned [quant] estimated average fragment length: 218.077 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,127 rounds 52401 SRR7166150.ke.tsv 34699 SRR7166150.se.tsv 87100 total ==> SRR7166150.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1800.92 1264 46.2454 Potri.005G024800.1.v4.1 1035 817.923 152 12.2447 Potri.004G059700.1.v4.1 961 743.947 32 2.83416 Potri.007G009000.2.v4.1 1416 1198.92 0 0 Potri.003G141000.2.v4.1 2943 2725.92 597.21 14.4354 Potri.016G087400.1.v4.1 270 93.6954 1015.18 713.903 Potri.015G069301.1.v4.1 564 350.303 0 0 Potri.010G195200.1.v4.1 1773 1555.92 558.865 23.6666 Potri.012G127500.1.v4.1 977 759.928 4220 365.895 ==> SRR7166150.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 41 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 538 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 278 SRR7166150 completed mapping pipeline successfully