Starting /dee2/code/volunteer_pipeline.sh SRR7166151 current disk space = 3111161761792 free memory = 1574867260 SRR7166151 SRAfilesize 4dedbc38c7ea1508ef0daeefbae59bec SRR7166151.sra SRR7166151.sra file validated SRR7166151 is paired end SRR7166151 is conventional basespace SRR7166151 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166151_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 42 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.15325 33.0 32.0 34.0 31.0 34.0 2 32.15975 33.0 33.0 34.0 29.0 34.0 3 32.42475 33.0 33.0 34.0 29.0 34.0 4 32.2245 33.0 33.0 34.0 29.0 34.0 5 32.30525 33.0 33.0 34.0 31.0 34.0 6 36.605 38.0 37.0 38.0 34.0 38.0 7 36.81425 38.0 38.0 38.0 35.0 38.0 8 37.065 38.0 38.0 38.0 36.0 38.0 9 36.7095 38.0 38.0 38.0 34.0 38.0 10-14 37.1097 38.0 38.0 38.0 36.0 38.0 15-19 37.138 38.0 38.0 38.0 36.0 38.0 20-24 37.089150000000004 38.0 38.0 38.0 36.0 38.0 25-29 36.874 38.0 38.0 38.0 35.2 38.0 30-34 36.36095 38.0 37.6 38.0 33.4 38.0 35-39 36.32235000000001 38.0 37.2 38.0 33.2 38.0 40-44 36.2285 38.0 37.0 38.0 33.0 38.0 45-49 36.00885 38.0 37.0 38.0 31.8 38.0 50-54 35.755250000000004 38.0 36.6 38.0 30.6 38.0 55-59 35.62179999999999 38.0 36.4 38.0 29.8 38.0 60-64 35.4697 38.0 36.0 38.0 29.0 38.0 65-69 35.585249999999995 38.0 36.2 38.0 29.8 38.0 70-74 35.469049999999996 38.0 36.2 38.0 29.0 38.0 75-79 34.98545 38.0 35.8 38.0 28.4 38.0 80-84 34.7415 38.0 35.6 38.0 27.2 38.0 85-89 34.4923 38.0 34.4 38.0 25.8 38.0 90-94 34.66324999999999 38.0 34.8 38.0 26.4 38.0 95-99 34.40575 38.0 34.4 38.0 25.0 38.0 100-104 33.89555 38.0 34.0 38.0 22.4 38.0 105-109 33.2874 37.6 32.8 38.0 17.8 38.0 110-114 32.80215 37.0 31.4 38.0 15.0 38.0 115-119 32.51835 37.0 31.0 38.0 15.0 38.0 120-124 31.718399999999995 36.6 30.0 38.0 15.0 38.0 125-129 30.63125 35.8 26.6 38.0 14.4 38.0 130-134 29.20705 34.2 23.4 38.0 13.0 38.0 135-139 28.0685 33.0 20.8 38.0 6.4 38.0 140-144 26.811349999999997 33.0 14.8 38.0 2.0 38.0 145-149 24.57095 32.2 8.2 38.0 2.0 38.0 150-151 18.9075 16.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 1.0 8 0.0 9 1.0 10 0.0 11 1.0 12 2.0 13 2.0 14 2.0 15 2.0 16 2.0 17 5.0 18 4.0 19 12.0 20 15.0 21 20.0 22 25.0 23 34.0 24 36.0 25 68.0 26 81.0 27 87.0 28 111.0 29 140.0 30 143.0 31 160.0 32 255.0 33 316.0 34 433.0 35 625.0 36 874.0 37 542.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.11678832116788 17.09035992952429 12.6352881953184 38.15756355398943 2 17.424999999999997 26.875 39.725 15.975 3 16.950000000000003 29.875 26.25 26.924999999999997 4 21.55 38.45 20.1 19.900000000000002 5 19.375 39.225 23.7 17.7 6 16.45 37.4 24.4 21.75 7 11.875 20.075000000000003 47.325 20.724999999999998 8 18.85 20.775 29.7 30.675 9 18.099999999999998 21.65 31.825 28.425 10-14 18.87 31.6 26.685 22.845 15-19 19.435 29.265 27.865000000000002 23.435 20-24 19.189999999999998 30.175 27.875 22.759999999999998 25-29 19.34 29.455 28.225 22.98 30-34 19.655 29.57 27.575 23.200000000000003 35-39 19.785 29.59 28.515 22.11 40-44 19.545 29.654999999999998 28.185 22.615 45-49 19.735 29.505 27.505000000000003 23.255 50-54 19.915 29.725 27.205000000000002 23.155 55-59 19.735 29.635 27.49 23.14 60-64 19.64 29.220000000000002 27.72 23.419999999999998 65-69 19.82 29.404999999999998 27.855 22.919999999999998 70-74 20.111144487834185 29.378191649143886 27.966356263142085 22.544307599879843 75-79 19.549403919983835 29.73327945039402 27.55102040816326 23.166296221458882 80-84 19.407744874715263 29.35965578334599 28.2004555808656 23.032143761073147 85-89 19.85 28.965000000000003 27.66 23.525 90-94 19.855 29.299999999999997 28.27 22.575 95-99 19.625 29.125 28.67 22.58 100-104 19.93 28.720000000000002 28.199999999999996 23.150000000000002 105-109 19.805 29.439999999999998 28.015 22.74 110-114 20.599999999999998 28.384999999999998 27.87 23.145 115-119 20.555 29.725 27.46 22.259999999999998 120-124 20.348400660759875 29.659107974170297 27.466586574560747 22.525904790509085 125-129 20.692072712704693 29.77615303720767 26.936751965546595 22.595022284541038 130-134 21.0848245880093 29.961581235466582 26.706096451319382 22.24749772520473 135-139 21.49096385542169 29.231927710843376 27.228915662650603 22.048192771084338 140-144 21.355 29.845 26.805 21.995 145-149 20.91942409699419 29.088153574134886 26.516797171002775 23.475625157868148 150-151 21.45007526342198 27.74711490215755 27.420973406924237 23.381836427496236 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 1.0 21 1.0 22 2.5 23 6.0 24 7.5 25 6.5 26 6.5 27 11.5 28 16.5 29 23.5 30 29.0 31 32.5 32 44.0 33 61.0 34 83.5 35 101.0 36 129.0 37 148.5 38 157.0 39 177.5 40 206.0 41 235.5 42 265.0 43 283.5 44 282.5 45 268.0 46 254.0 47 223.5 48 201.5 49 182.0 50 129.0 51 108.0 52 91.5 53 63.0 54 44.0 55 31.5 56 27.5 57 19.0 58 11.0 59 8.5 60 6.0 61 4.0 62 1.5 63 1.0 64 1.5 65 1.0 66 1.0 67 1.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.675 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.13 75-79 1.02 80-84 1.225 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.11499999999999999 125-129 0.155 130-134 1.09 135-139 0.4 140-144 0.0 145-149 1.0250000000000001 150-151 0.35000000000000003 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.36250000000000004 0.0 0.0 0.0 0.0 100-101 0.4625 0.0 0.0 0.0 0.0 102-103 0.575 0.0 0.0 0.0 0.0 104-105 0.7125 0.0 0.0 0.0 0.0 106-107 0.8375 0.0 0.0 0.0 0.0 108-109 0.9625 0.0 0.0 0.0 0.0 110-111 1.0750000000000002 0.0 0.0 0.0 0.0 112-113 1.2 0.0 0.0 0.0 0.0 114-115 1.3624999999999998 0.0 0.0 0.0 0.0 116-117 1.5875 0.0 0.0 0.0 0.0 118-119 1.775 0.0 0.0 0.0 0.0 120-121 2.0 0.0 0.0 0.0 0.0 122-123 2.3125 0.0 0.0 0.0 0.0 124-125 2.5250000000000004 0.0 0.0 0.0 0.0 126-127 2.8125 0.0 0.0 0.0 0.0 128-129 3.0999999999999996 0.0 0.0 0.0 0.0 130-131 3.6125 0.0 0.0 0.0 0.0 132-133 4.0625 0.0 0.0 0.0 0.0 134-135 4.637499999999999 0.0 0.0 0.0 0.0 136-137 5.2125 0.0 0.0 0.0 0.0 138-139 5.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTGCCT 10 0.006926796 144.325 5 GAAAAGT 10 0.006926796 144.325 1 GTCCACT 10 0.006926796 144.325 1 >>END_MODULE SRR7166151 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166151_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.766 33.0 33.0 34.0 32.0 34.0 2 32.9 34.0 33.0 34.0 32.0 34.0 3 32.814 34.0 33.0 34.0 32.0 34.0 4 32.76675 34.0 33.0 34.0 32.0 34.0 5 32.86025 34.0 33.0 34.0 32.0 34.0 6 36.975 38.0 38.0 38.0 36.0 38.0 7 36.90875 38.0 38.0 38.0 36.0 38.0 8 36.95525 38.0 38.0 38.0 36.0 38.0 9 36.97825 38.0 38.0 38.0 36.0 38.0 10-14 36.86719999999999 38.0 38.0 38.0 35.6 38.0 15-19 36.72555 38.0 38.0 38.0 34.8 38.0 20-24 36.61725 38.0 38.0 38.0 34.6 38.0 25-29 36.7533 38.0 38.0 38.0 35.0 38.0 30-34 36.7875 38.0 38.0 38.0 35.2 38.0 35-39 36.4142 38.0 38.0 38.0 33.8 38.0 40-44 36.50150000000001 38.0 38.0 38.0 34.2 38.0 45-49 36.13705 38.0 37.8 38.0 32.8 38.0 50-54 36.1437 38.0 37.8 38.0 32.8 38.0 55-59 36.14075 38.0 37.6 38.0 32.6 38.0 60-64 36.155100000000004 38.0 37.6 38.0 33.2 38.0 65-69 35.864850000000004 38.0 37.0 38.0 31.0 38.0 70-74 35.86475 38.0 37.0 38.0 31.0 38.0 75-79 35.669200000000004 38.0 36.8 38.0 30.2 38.0 80-84 35.4476 38.0 36.6 38.0 29.0 38.0 85-89 35.622400000000006 38.0 36.8 38.0 30.2 38.0 90-94 35.39704999999999 38.0 36.8 38.0 29.4 38.0 95-99 35.0677 38.0 36.0 38.0 28.4 38.0 100-104 34.62245 38.0 35.6 38.0 25.8 38.0 105-109 34.62434999999999 38.0 35.8 38.0 26.0 38.0 110-114 34.18965 38.0 34.8 38.0 23.2 38.0 115-119 33.96925 38.0 34.2 38.0 22.4 38.0 120-124 33.40554999999999 38.0 33.8 38.0 17.8 38.0 125-129 32.47845 37.4 31.4 38.0 15.0 38.0 130-134 31.59205 36.8 30.6 38.0 14.2 38.0 135-139 31.081 36.4 30.0 38.0 13.0 38.0 140-144 29.7438 35.8 26.8 38.0 8.0 38.0 145-149 27.878700000000002 34.6 20.4 38.0 2.0 38.0 150-151 21.7815 26.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 3.0 4 1.0 5 2.0 6 2.0 7 1.0 8 2.0 9 2.0 10 1.0 11 2.0 12 2.0 13 4.0 14 8.0 15 6.0 16 11.0 17 14.0 18 10.0 19 13.0 20 12.0 21 16.0 22 13.0 23 17.0 24 28.0 25 29.0 26 34.0 27 55.0 28 71.0 29 92.0 30 97.0 31 133.0 32 148.0 33 224.0 34 295.0 35 445.0 36 815.0 37 1389.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.25 14.025000000000002 15.6 36.125 2 21.55 24.15 38.875 15.425 3 20.025000000000002 25.525 32.074999999999996 22.375 4 23.724999999999998 32.800000000000004 22.375 21.099999999999998 5 23.474999999999998 37.7 22.625 16.2 6 16.150000000000002 39.725 24.05 20.075000000000003 7 15.75 14.025000000000002 48.725 21.5 8 20.025000000000002 21.224999999999998 28.475 30.275000000000002 9 22.900000000000002 22.3 29.9 24.9 10-14 22.355 28.634999999999998 27.775 21.235 15-19 22.06 27.63 28.78 21.529999999999998 20-24 21.905 28.720000000000002 28.749999999999996 20.625 25-29 22.055 28.025 29.535 20.385 30-34 22.1 27.965 29.28 20.655 35-39 22.134999999999998 28.735 28.439999999999998 20.69 40-44 22.165000000000003 28.17 28.67 20.995 45-49 22.395 28.299999999999997 29.020000000000003 20.285 50-54 22.189999999999998 28.610000000000003 28.794999999999998 20.405 55-59 22.245 28.01 29.015 20.73 60-64 22.49 28.52 28.74 20.25 65-69 22.59 27.955000000000002 29.315 20.14 70-74 23.095 27.915 29.044999999999998 19.945 75-79 22.375 27.650000000000002 29.455 20.52 80-84 23.425 27.634999999999998 28.610000000000003 20.330000000000002 85-89 23.1 28.139999999999997 28.860000000000003 19.900000000000002 90-94 23.03 27.71 29.609999999999996 19.650000000000002 95-99 23.03 28.439999999999998 28.785 19.744999999999997 100-104 22.99844976746512 28.31924788718308 28.68430264539681 19.997999699954995 105-109 23.42139497648354 28.444911438006603 28.26478534974482 19.868908235765034 110-114 22.899579915983196 28.005601120224043 29.110822164432886 19.983996799359872 115-119 22.95 28.285 28.865000000000002 19.900000000000002 120-124 23.39 27.950000000000003 28.725 19.935 125-129 23.305 28.505000000000003 28.685 19.505 130-134 24.13 27.715 28.470000000000002 19.685 135-139 24.195 28.000000000000004 28.555000000000003 19.25 140-144 24.529999999999998 27.58 28.315 19.575 145-149 24.345 28.485 27.48 19.689999999999998 150-151 25.162499999999998 26.900000000000002 27.750000000000004 20.1875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 1.0 19 2.0 20 2.0 21 2.5 22 2.5 23 3.0 24 4.5 25 5.0 26 5.0 27 5.5 28 6.5 29 13.5 30 22.0 31 22.5 32 28.0 33 46.5 34 61.5 35 72.5 36 94.5 37 125.5 38 168.0 39 201.5 40 217.0 41 255.0 42 293.5 43 289.5 44 271.5 45 280.0 46 267.5 47 241.0 48 213.0 49 179.0 50 145.5 51 114.5 52 93.0 53 65.5 54 52.0 55 40.0 56 28.5 57 19.0 58 11.5 59 9.0 60 5.5 61 3.0 62 2.5 63 1.5 64 1.0 65 0.5 66 1.0 67 1.0 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.015 105-109 0.06999999999999999 110-114 0.02 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.698568198945 99.225 2 0.17583521728208992 0.35000000000000003 3 0.07535795026375283 0.22499999999999998 4 0.050238633509168545 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.36250000000000004 0.0 0.0 0.0 0.0 100-101 0.4625 0.0 0.0 0.0 0.0 102-103 0.575 0.0 0.0 0.0 0.0 104-105 0.7125 0.0 0.0 0.0 0.0 106-107 0.8375 0.0 0.0 0.0 0.0 108-109 0.9625 0.0 0.0 0.0 0.0 110-111 1.0750000000000002 0.0 0.0 0.0 0.0 112-113 1.2 0.0 0.0 0.0 0.0 114-115 1.3875000000000002 0.0 0.0 0.0 0.0 116-117 1.6375000000000002 0.0 0.0 0.0 0.0 118-119 1.875 0.0 0.0 0.0 0.0 120-121 2.1625 0.0 0.0 0.0 0.0 122-123 2.5125 0.0 0.0 0.0 0.0 124-125 2.75 0.0 0.0 0.0 0.0 126-127 3.125 0.0 0.0 0.0 0.0 128-129 3.45 0.0 0.0 0.0 0.0 130-131 3.9875000000000003 0.0 0.0 0.0 0.0 132-133 4.575 0.0 0.0 0.0 0.0 134-135 5.225 0.0 0.0 0.0 0.0 136-137 5.9 0.0 0.0 0.0 0.0 138-139 6.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 566087 spots for SRR7166151.sra Written 566087 spots for SRR7166151.sra Read 566087 spots for SRR7166151.sra Written 566087 spots for SRR7166151.sra Read 566087 spots for SRR7166151.sra Written 566087 spots for SRR7166151.sra Read 566087 spots for SRR7166151.sra Written 566087 spots for SRR7166151.sra Read 566087 spots for SRR7166151.sra Written 566087 spots for SRR7166151.sra Read 566087 spots for SRR7166151.sra Written 566087 spots for SRR7166151.sra Read 566087 spots for SRR7166151.sra Written 566087 spots for SRR7166151.sra Read 566087 spots for SRR7166151.sra Written 566087 spots for SRR7166151.sra Read 566087 spots for SRR7166151.sra Written 566087 spots for SRR7166151.sra Read 566087 spots for SRR7166151.sra Written 566087 spots for SRR7166151.sra Read 566087 spots for SRR7166151.sra Written 566087 spots for SRR7166151.sra Read 566087 spots for SRR7166151.sra Written 566087 spots for SRR7166151.sra Read 566087 spots for SRR7166151.sra Written 566087 spots for SRR7166151.sra Read 566087 spots for SRR7166151.sra Written 566087 spots for SRR7166151.sra Read 566087 spots for SRR7166151.sra Written 566087 spots for SRR7166151.sra Read 566087 spots for SRR7166151.sra Written 566087 spots for SRR7166151.sra Read 566087 spots for SRR7166151.sra Written 566087 spots for SRR7166151.sra Read 566092 spots for SRR7166151.sra Written 566092 spots for SRR7166151.sra Read 566087 spots for SRR7166151.sra Written 566087 spots for SRR7166151.sra Read 566087 spots for SRR7166151.sra Written 566087 spots for SRR7166151.sra SRR ids: ['SRR7166151.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fjfnz2ys SRR7166151.sra spots: 11321745 blocks: [[1, 566087], [566088, 1132174], [1132175, 1698261], [1698262, 2264348], [2264349, 2830435], [2830436, 3396522], [3396523, 3962609], [3962610, 4528696], [4528697, 5094783], [5094784, 5660870], [5660871, 6226957], [6226958, 6793044], [6793045, 7359131], [7359132, 7925218], [7925219, 8491305], [8491306, 9057392], [9057393, 9623479], [9623480, 10189566], [10189567, 10755653], [10755654, 11321745]] SRR7166151 file size 3814867 SRR7166151 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166151 SRR7166151_1.fastq SRR7166151_2.fastq Input file: SRR7166151_1.fastq Paired file: SRR7166151_2.fastq trimmed: SRR7166151-trimmed-pair1.fastq, SRR7166151-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 17:32:02 2025 >> started Fri Feb 14 17:32:24 2025 >> done (22.355s) 11321745 read pairs processed; of these: 8581 ( 0.08%) short read pairs filtered out after trimming by size control 10245 ( 0.09%) empty read pairs filtered out after trimming by size control 11302919 (99.83%) read pairs available; of these: 7043304 (62.31%) trimmed read pairs available after processing 4259615 (37.69%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 4 0.00% 21 4 0.00% 22 5 0.00% 23 4 0.00% 24 4 0.00% 25 0 0.00% 26 5 0.00% 27 6 0.00% 28 7 0.00% 29 4 0.00% 30 2 0.00% 31 3 0.00% 32 5 0.00% 33 7 0.00% 34 7 0.00% 35 1 0.00% 36 7 0.00% 37 5 0.00% 38 13 0.00% 39 17 0.00% 40 11 0.00% 41 17 0.00% 42 20 0.00% 43 17 0.00% 44 17 0.00% 45 24 0.00% 46 20 0.00% 47 27 0.00% 48 33 0.00% 49 27 0.00% 50 34 0.00% 51 31 0.00% 52 48 0.00% 53 51 0.00% 54 61 0.00% 55 81 0.00% 56 82 0.00% 57 85 0.00% 58 106 0.00% 59 118 0.00% 60 157 0.00% 61 160 0.00% 62 172 0.00% 63 211 0.00% 64 252 0.00% 65 279 0.00% 66 286 0.00% 67 358 0.00% 68 394 0.00% 69 413 0.00% 70 475 0.00% 71 635 0.01% 72 687 0.01% 73 704 0.01% 74 782 0.01% 75 827 0.01% 76 964 0.01% 77 971 0.01% 78 1003 0.01% 79 1117 0.01% 80 1213 0.01% 81 1469 0.01% 82 1672 0.01% 83 1852 0.02% 84 2266 0.02% 85 2782 0.02% 86 2966 0.03% 87 3194 0.03% 88 3475 0.03% 89 3740 0.03% 90 4139 0.04% 91 4743 0.04% 92 5268 0.05% 93 5561 0.05% 94 5762 0.05% 95 5921 0.05% 96 6154 0.05% 97 6918 0.06% 98 7476 0.07% 99 8198 0.07% 100 8459 0.07% 101 8600 0.08% 102 8642 0.08% 103 8644 0.08% 104 9462 0.08% 105 10368 0.09% 106 10947 0.10% 107 11477 0.10% 108 12163 0.11% 109 13881 0.12% 110 15663 0.14% 111 16304 0.14% 112 17767 0.16% 113 18806 0.17% 114 19440 0.17% 115 20015 0.18% 116 21536 0.19% 117 23827 0.21% 118 25860 0.23% 119 27889 0.25% 120 28649 0.25% 121 29615 0.26% 122 29946 0.26% 123 31912 0.28% 124 35126 0.31% 125 36952 0.33% 126 39193 0.35% 127 42053 0.37% 128 44447 0.39% 129 48492 0.43% 130 51784 0.46% 131 56849 0.50% 132 61557 0.54% 133 65438 0.58% 134 70571 0.62% 135 75832 0.67% 136 78098 0.69% 137 81855 0.72% 138 89811 0.79% 139 102942 0.91% 140 121744 1.08% 141 116286 1.03% 142 124408 1.10% 143 138489 1.23% 144 160597 1.42% 145 192878 1.71% 146 246970 2.19% 147 334344 2.96% 148 481361 4.26% 149 835653 7.39% 150 2783063 24.62% 151 4259615 37.69% 11302919 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=3.42 fanout-score-rank=32 prefix-density=0.50 prefix-fanout=2.1 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=268.93 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=20.2 sequence=AAACAGAAACTAATTAAGCATTTTCATTAATAATCATCAACTCCACATAGTTCAAGTTTCCAAGCATACATGAAAACACCTTGAAAGTTGAAGCAGCCAACAAAGCAGTGACGCGTACACAAGACAAAGGATTTATAGGAACCCTTTGCTGTTTATTATTATTTAACAACAAGCACCATTATACAAACATGAGCTGACCAACTGATAGATTAACTACTGCTTTGTTGGAACCATGTCCATGTGTCCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACACTTGCA criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.35 fanout-score-rank=32 prefix-density=0.49 prefix-fanout=2.3 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=24.97 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=2.4 sequence=CTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCC SRR7166151 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 17:34:14 Started mapping on | Feb 14 17:34:14 Finished on | Feb 14 17:35:52 Mapping speed, Million of reads per hour | 415.21 Number of input reads | 11302919 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 10652722 Uniquely mapped reads % | 94.25% Average mapped length | 291.84 Number of splices: Total | 10111966 Number of splices: Annotated (sjdb) | 9915816 Number of splices: GT/AG | 9947007 Number of splices: GC/AG | 129524 Number of splices: AT/AC | 7046 Number of splices: Non-canonical | 28389 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.03% Deletion average length | 2.41 Insertion rate per base | 0.02% Insertion average length | 2.17 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 288956 % of reads mapped to multiple loci | 2.56% Number of reads mapped to too many loci | 15944 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.98% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 369842 369842 369842 N_multimapping 288956 288956 288956 N_noFeature 411104 10500926 503809 N_ambiguous 112806 845 53119 UnstrandedReadsAssigned:10128812 PositiveStrandReadsAssigned:150951 NegativeStrandReadsAssigned:10095794 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=145 echo kmer=141 SRR7166151 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166151-trimmed-pair1.fastq SRR7166151-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,302,919 reads, 10,047,900 reads pseudoaligned [quant] estimated average fragment length: 236.297 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,064 rounds 52401 SRR7166151.ke.tsv 34699 SRR7166151.se.tsv 87100 total ==> SRR7166151.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1782.7 890 50.0329 Potri.005G024800.1.v4.1 1035 799.703 146 18.2965 Potri.004G059700.1.v4.1 961 725.717 15 2.07142 Potri.007G009000.2.v4.1 1416 1180.7 0 0 Potri.003G141000.2.v4.1 2943 2707.7 469.216 17.3667 Potri.016G087400.1.v4.1 270 81.0014 638 789.356 Potri.015G069301.1.v4.1 564 332.124 0 0 Potri.010G195200.1.v4.1 1773 1537.7 318 20.7252 Potri.012G127500.1.v4.1 977 741.703 2495 337.121 ==> SRR7166151.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 36 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 398 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 410 SRR7166151 completed mapping pipeline successfully