Starting /dee2/code/volunteer_pipeline.sh SRR7166152 current disk space = 3111838998528 free memory = 1475271104 SRR7166152 SRAfilesize 3102b5218b02798014c2a716fec2a2a1 SRR7166152.sra SRR7166152.sra file validated SRR7166152 is paired end SRR7166152 is conventional basespace SRR7166152 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166152_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.3525 33.0 25.0 33.0 18.0 33.0 2 28.07325 29.0 27.0 31.0 18.0 33.0 3 29.579 31.0 29.0 33.0 25.0 33.0 4 31.9245 33.0 31.0 33.0 29.0 33.0 5 32.324 33.0 33.0 33.0 32.0 33.0 6 36.611 38.0 37.0 38.0 34.0 38.0 7 37.08775 38.0 38.0 38.0 35.0 38.0 8 37.4765 38.0 38.0 38.0 37.0 38.0 9 37.639 38.0 38.0 38.0 38.0 38.0 10-14 37.61345 38.0 38.0 38.0 38.0 38.0 15-19 37.60875 38.0 38.0 38.0 38.0 38.0 20-24 37.615899999999996 38.0 38.0 38.0 38.0 38.0 25-29 37.59755 38.0 38.0 38.0 38.0 38.0 30-34 37.597699999999996 38.0 38.0 38.0 38.0 38.0 35-39 37.5629 38.0 38.0 38.0 38.0 38.0 40-44 37.53415 38.0 38.0 38.0 38.0 38.0 45-49 37.5082 38.0 38.0 38.0 37.2 38.0 50-54 37.165049999999994 38.0 38.0 38.0 37.0 38.0 55-59 36.83685 38.0 38.0 38.0 36.8 38.0 60-64 37.023450000000004 38.0 38.0 38.0 36.4 38.0 65-69 37.2841 38.0 38.0 38.0 36.6 38.0 70-74 37.16515 38.0 38.0 38.0 36.0 38.0 75-79 37.110150000000004 38.0 38.0 38.0 36.0 38.0 80-84 37.06785000000001 38.0 38.0 38.0 36.0 38.0 85-89 36.96575 38.0 38.0 38.0 35.8 38.0 90-94 36.86505 38.0 38.0 38.0 35.4 38.0 95-99 36.776599999999995 38.0 38.0 38.0 35.0 38.0 100-104 36.59835 38.0 38.0 38.0 34.6 38.0 105-109 36.22215 38.0 38.0 38.0 33.8 38.0 110-114 36.350649999999995 38.0 38.0 38.0 34.0 38.0 115-119 36.2128 38.0 37.8 38.0 33.6 38.0 120-124 36.0758 38.0 37.2 38.0 33.0 38.0 125-129 35.78565 38.0 37.0 38.0 32.0 38.0 130-134 35.74545 38.0 36.6 38.0 32.0 38.0 135-139 35.44425 38.0 36.0 38.0 30.6 38.0 140-144 35.2535 38.0 36.0 38.0 31.0 38.0 145-149 34.80805 38.0 35.4 38.0 29.4 38.0 150-151 31.611375000000002 36.5 31.5 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 2.0 17 2.0 18 2.0 19 5.0 20 0.0 21 4.0 22 0.0 23 1.0 24 5.0 25 6.0 26 14.0 27 20.0 28 32.0 29 29.0 30 28.0 31 41.0 32 65.0 33 100.0 34 148.0 35 231.0 36 688.0 37 2576.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.832317073170735 21.1890243902439 10.721544715447154 33.25711382113821 2 19.625 27.1 37.125 16.150000000000002 3 16.675 33.75 25.5 24.075 4 21.4 38.375 19.625 20.599999999999998 5 19.434009516654143 38.216879539193584 23.69146005509642 18.657650889055848 6 15.375 37.2 26.075 21.349999999999998 7 11.799999999999999 20.349999999999998 47.225 20.625 8 17.474999999999998 20.349999999999998 28.925 33.25 9 17.875 22.400000000000002 30.65 29.075 10-14 18.69 31.155 26.99 23.165 15-19 19.905 29.470000000000002 27.255000000000003 23.369999999999997 20-24 19.53 29.799999999999997 27.32 23.35 25-29 19.715 29.93 27.63 22.725 30-34 19.285 29.445 27.800000000000004 23.47 35-39 19.655 29.56 27.775 23.01 40-44 19.31 30.09 27.57 23.03 45-49 19.64 29.84 27.334999999999997 23.185 50-54 19.457036365467918 29.807595446761358 27.853329303918606 22.882038883852122 55-59 19.794996701679608 29.507281676561625 27.42680265895367 23.270918962805094 60-64 19.558979006192416 28.938226853949555 28.087398680964608 23.41539545889342 65-69 19.900000000000002 28.895 27.839999999999996 23.365 70-74 19.444583437578185 29.25694270703027 28.011008256192145 23.2874655991994 75-79 19.96 28.465 27.555000000000003 24.02 80-84 19.875 28.794999999999998 27.98 23.35 85-89 19.62 28.78 27.845 23.755000000000003 90-94 19.830000000000002 29.035 28.015 23.119999999999997 95-99 20.53 29.815 27.150000000000002 22.505 100-104 20.46821736514939 28.975335873270502 27.34108682574694 23.215359935833167 105-109 20.15429608713191 29.04901169826543 27.55143202904397 23.245260185558696 110-114 20.195 29.585 27.284999999999997 22.935 115-119 20.661820005013787 29.230383554775635 26.954123840561543 23.153672599649035 120-124 20.72603630181509 28.671433571678584 26.87634381719086 23.726186309315466 125-129 20.355800551240293 28.46404409922325 27.136056126284142 24.044099223252317 130-134 20.315 29.325000000000003 26.76 23.599999999999998 135-139 21.175 28.38 26.905 23.54 140-144 21.185000000000002 28.51 26.779999999999998 23.525 145-149 20.895 28.815 26.38 23.91 150-151 20.99724379854673 28.81483337509396 25.84565271861689 24.34227010774242 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 1.0 22 2.0 23 2.0 24 2.0 25 4.0 26 6.5 27 9.0 28 11.5 29 19.0 30 31.5 31 41.0 32 52.5 33 69.5 34 85.5 35 98.5 36 122.0 37 139.0 38 166.5 39 185.5 40 192.0 41 234.5 42 268.0 43 273.5 44 259.0 45 241.0 46 237.5 47 231.5 48 212.0 49 178.5 50 141.0 51 106.5 52 92.0 53 78.5 54 55.0 55 43.5 56 32.0 57 19.0 58 14.5 59 11.5 60 6.0 61 3.5 62 5.0 63 5.0 64 2.0 65 2.0 66 2.0 67 2.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.6 2 0.0 3 0.0 4 0.0 5 0.17500000000000002 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.73 55-59 1.465 60-64 0.685 65-69 0.0 70-74 0.075 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.26 105-109 0.84 110-114 0.0 115-119 0.27499999999999997 120-124 0.005 125-129 0.22499999999999998 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.22499999999999998 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39592247671784 98.725 2 0.5285678328718851 1.05 3 0.07550969041026932 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.45 0.0 0.0 0.0 0.0 98-99 0.625 0.0 0.0 0.0 0.0 100-101 0.775 0.0 0.0 0.0 0.0 102-103 0.95 0.0 0.0 0.0 0.0 104-105 1.1375000000000002 0.0 0.0 0.0 0.0 106-107 1.3250000000000002 0.0 0.0 0.0 0.0 108-109 1.6 0.0 0.0 0.0 0.0 110-111 1.8875000000000002 0.0 0.0 0.0 0.0 112-113 2.2 0.0 0.0 0.0 0.0 114-115 2.5375 0.0 0.0 0.0 0.0 116-117 2.9 0.0 0.0 0.0 0.0 118-119 3.0875 0.0 0.0 0.0 0.0 120-121 3.4 0.0 0.0 0.0 0.0 122-123 3.675 0.0 0.0 0.0 0.0 124-125 4.237500000000001 0.0 0.0 0.0 0.0 126-127 4.7375 0.0 0.0 0.0 0.0 128-129 5.225 0.0 0.0 0.0 0.0 130-131 5.925 0.0 0.0 0.0 0.0 132-133 6.625 0.0 0.0 0.0 0.0 134-135 7.1875 0.0 0.0 0.0 0.0 136-137 7.8125 0.0 0.0 0.0 0.0 138-139 8.3875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGAAAT 10 0.006674818 146.10127 1 GATGATA 10 0.0069339755 144.27501 2 >>END_MODULE SRR7166152 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166152_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.722 33.0 33.0 34.0 32.0 34.0 2 32.783 33.0 33.0 34.0 32.0 34.0 3 32.83775 33.0 33.0 34.0 32.0 34.0 4 32.81125 33.0 33.0 34.0 32.0 34.0 5 32.8465 33.0 33.0 34.0 32.0 34.0 6 37.13 38.0 38.0 38.0 36.0 38.0 7 37.241 38.0 38.0 38.0 37.0 38.0 8 37.184 38.0 38.0 38.0 37.0 38.0 9 37.0825 38.0 38.0 38.0 36.0 38.0 10-14 37.106049999999996 38.0 38.0 38.0 36.0 38.0 15-19 37.025 38.0 38.0 38.0 36.0 38.0 20-24 37.02065 38.0 38.0 38.0 36.0 38.0 25-29 36.9889 38.0 38.0 38.0 36.0 38.0 30-34 36.8702 38.0 38.0 38.0 35.6 38.0 35-39 36.764649999999996 38.0 38.0 38.0 35.0 38.0 40-44 36.66695 38.0 38.0 38.0 34.4 38.0 45-49 36.5476 38.0 38.0 38.0 34.2 38.0 50-54 36.383500000000005 38.0 38.0 38.0 34.0 38.0 55-59 36.22410000000001 38.0 37.0 38.0 33.2 38.0 60-64 36.2327 38.0 37.2 38.0 33.2 38.0 65-69 36.065099999999994 38.0 37.0 38.0 33.0 38.0 70-74 35.91765 38.0 37.0 38.0 31.8 38.0 75-79 35.73485 38.0 37.0 38.0 30.8 38.0 80-84 35.57865 38.0 36.6 38.0 29.4 38.0 85-89 35.30275 38.0 36.0 38.0 29.0 38.0 90-94 35.078250000000004 38.0 36.0 38.0 28.2 38.0 95-99 34.75775 38.0 35.6 38.0 26.8 38.0 100-104 34.4455 38.0 35.0 38.0 24.8 38.0 105-109 34.162099999999995 38.0 34.4 38.0 23.4 38.0 110-114 33.7587 38.0 34.0 38.0 18.2 38.0 115-119 33.352850000000004 38.0 34.0 38.0 16.2 38.0 120-124 32.8483 38.0 33.0 38.0 15.0 38.0 125-129 32.48395 37.0 32.4 38.0 15.0 38.0 130-134 31.7063 36.4 31.0 38.0 14.4 38.0 135-139 30.878149999999998 36.0 28.2 38.0 13.6 38.0 140-144 29.76065 35.2 25.8 38.0 8.6 38.0 145-149 28.194799999999997 34.6 21.0 38.0 2.0 38.0 150-151 23.31175 30.5 2.0 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 1.0 7 1.0 8 1.0 9 0.0 10 2.0 11 2.0 12 3.0 13 3.0 14 8.0 15 7.0 16 4.0 17 10.0 18 6.0 19 16.0 20 12.0 21 17.0 22 21.0 23 16.0 24 23.0 25 34.0 26 45.0 27 60.0 28 59.0 29 69.0 30 89.0 31 102.0 32 148.0 33 243.0 34 377.0 35 563.0 36 965.0 37 1091.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.925 15.55 12.225 28.299999999999997 2 23.175 23.875 36.875 16.075 3 19.425 27.175 31.025000000000002 22.375 4 25.05 36.675000000000004 21.099999999999998 17.175 5 23.375 38.25 21.95 16.425 6 18.625 38.574999999999996 23.75 19.05 7 17.625 15.8 45.050000000000004 21.525 8 20.200000000000003 20.325 29.175 30.3 9 23.325000000000003 22.6 28.299999999999997 25.775 10-14 23.21 28.815 27.51 20.465 15-19 23.0 27.865000000000002 28.21 20.925 20-24 22.665 27.900000000000002 28.415000000000003 21.02 25-29 22.595000000000002 29.12 27.21 21.075 30-34 22.655 28.08 28.185 21.08 35-39 22.835 27.805000000000003 28.68 20.68 40-44 22.994999999999997 27.815 28.694999999999997 20.495 45-49 22.57 27.950000000000003 28.34 21.14 50-54 22.875 27.91 28.794999999999998 20.419999999999998 55-59 23.085 28.000000000000004 28.384999999999998 20.53 60-64 23.025000000000002 28.375 28.525 20.075000000000003 65-69 23.285 27.279999999999998 29.04 20.395 70-74 23.04 27.950000000000003 28.515 20.495 75-79 23.0 28.575 28.4 20.025000000000002 80-84 23.645 27.815 28.235 20.305 85-89 23.185 28.18 28.435 20.200000000000003 90-94 22.925 27.79 28.845 20.44 95-99 23.54 28.294999999999998 28.294999999999998 19.869999999999997 100-104 23.225 27.98 28.685 20.11 105-109 23.71 27.88 28.15 20.26 110-114 23.805 28.475 27.76 19.96 115-119 23.59 27.775 28.560000000000002 20.075000000000003 120-124 24.315 28.185 28.199999999999996 19.3 125-129 23.905 27.894999999999996 28.32 19.88 130-134 24.295 27.639999999999997 28.415000000000003 19.650000000000002 135-139 25.255 28.08 27.26 19.405 140-144 25.025 28.125 27.284999999999997 19.564999999999998 145-149 25.22 27.305 28.07 19.405 150-151 25.322156887276364 27.073689478293506 28.612535968972853 18.991617665457277 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 1.0 22 1.5 23 1.0 24 3.5 25 6.0 26 4.5 27 4.5 28 8.0 29 12.5 30 18.5 31 23.0 32 32.5 33 46.0 34 58.5 35 73.0 36 89.0 37 117.0 38 148.0 39 167.0 40 209.5 41 253.0 42 248.5 43 246.5 44 270.5 45 272.5 46 263.0 47 254.5 48 226.5 49 201.5 50 173.0 51 132.5 52 112.5 53 95.5 54 69.5 55 50.5 56 31.0 57 18.0 58 12.0 59 10.0 60 9.0 61 6.0 62 3.5 63 2.5 64 2.5 65 2.5 66 2.5 67 2.0 68 1.0 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59728165114524 98.925 2 0.27686886483765416 0.5499999999999999 3 0.05033979360684621 0.15 4 0.05033979360684621 0.2 5 0.0 0.0 6 0.0 0.0 7 0.025169896803423106 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCCTATTT 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.3875 0.0 0.0 0.0 0.0 98-99 0.5875 0.0 0.0 0.0 0.0 100-101 0.7375 0.0 0.0 0.0 0.0 102-103 0.8999999999999999 0.0 0.0 0.0 0.0 104-105 1.0625 0.0 0.0 0.0 0.0 106-107 1.275 0.0 0.0 0.0 0.0 108-109 1.525 0.0 0.0 0.0 0.0 110-111 1.7999999999999998 0.0 0.0 0.0 0.0 112-113 2.05 0.0 0.0 0.0 0.0 114-115 2.4125 0.0 0.0 0.0 0.0 116-117 2.775 0.0 0.0 0.0 0.0 118-119 2.9625 0.0 0.0 0.0 0.0 120-121 3.25 0.0 0.0 0.0 0.0 122-123 3.4625 0.0 0.0 0.0 0.0 124-125 3.9375 0.0 0.0 0.0 0.0 126-127 4.4 0.0 0.0 0.0 0.0 128-129 4.9125 0.0 0.0 0.0 0.0 130-131 5.6 0.0 0.0 0.0 0.0 132-133 6.25 0.0 0.0 0.0 0.0 134-135 6.8125 0.0 0.0 0.0 0.0 136-137 7.3375 0.0 0.0 0.0 0.0 138-139 7.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TACCAGA 10 0.006830828 145.0 5 >>END_MODULE Read 784782 spots for SRR7166152.sra Written 784782 spots for SRR7166152.sra Read 784782 spots for SRR7166152.sra Written 784782 spots for SRR7166152.sra Read 784782 spots for SRR7166152.sra Written 784782 spots for SRR7166152.sra Read 784782 spots for SRR7166152.sra Written 784782 spots for SRR7166152.sra Read 784782 spots for SRR7166152.sra Written 784782 spots for SRR7166152.sra Read 784782 spots for SRR7166152.sra Written 784782 spots for SRR7166152.sra Read 784782 spots for SRR7166152.sra Written 784782 spots for SRR7166152.sra Read 784782 spots for SRR7166152.sra Written 784782 spots for SRR7166152.sra Read 784782 spots for SRR7166152.sra Written 784782 spots for SRR7166152.sra Read 784782 spots for SRR7166152.sra Written 784782 spots for SRR7166152.sra Read 784782 spots for SRR7166152.sra Written 784782 spots for SRR7166152.sra Read 784782 spots for SRR7166152.sra Written 784782 spots for SRR7166152.sra Read 784782 spots for SRR7166152.sra Written 784782 spots for SRR7166152.sra Read 784782 spots for SRR7166152.sra Written 784782 spots for SRR7166152.sra Read 784782 spots for SRR7166152.sra Written 784782 spots for SRR7166152.sra Read 784782 spots for SRR7166152.sra Written 784782 spots for SRR7166152.sra Read 784782 spots for SRR7166152.sra Written 784782 spots for SRR7166152.sra Read 784782 spots for SRR7166152.sra Written 784782 spots for SRR7166152.sra Read 784782 spots for SRR7166152.sra Written 784782 spots for SRR7166152.sra Read 784782 spots for SRR7166152.sra Written 784782 spots for SRR7166152.sra SRR ids: ['SRR7166152.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6u2oil_x SRR7166152.sra spots: 15695640 blocks: [[1, 784782], [784783, 1569564], [1569565, 2354346], [2354347, 3139128], [3139129, 3923910], [3923911, 4708692], [4708693, 5493474], [5493475, 6278256], [6278257, 7063038], [7063039, 7847820], [7847821, 8632602], [8632603, 9417384], [9417385, 10202166], [10202167, 10986948], [10986949, 11771730], [11771731, 12556512], [12556513, 13341294], [13341295, 14126076], [14126077, 14910858], [14910859, 15695640]] SRR7166152 file size 5297037 SRR7166152 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166152 SRR7166152_1.fastq SRR7166152_2.fastq Input file: SRR7166152_1.fastq Paired file: SRR7166152_2.fastq trimmed: SRR7166152-trimmed-pair1.fastq, SRR7166152-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 16:30:44 2025 >> started Fri Feb 14 16:31:03 2025 >> done (18.075s) 15695640 read pairs processed; of these: 6813 ( 0.04%) short read pairs filtered out after trimming by size control 5957 ( 0.04%) empty read pairs filtered out after trimming by size control 15682870 (99.92%) read pairs available; of these: 7002735 (44.65%) trimmed read pairs available after processing 8680135 (55.35%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 3 0.00% 20 7 0.00% 21 7 0.00% 22 3 0.00% 23 9 0.00% 24 5 0.00% 25 3 0.00% 26 3 0.00% 27 4 0.00% 28 4 0.00% 29 1 0.00% 30 4 0.00% 31 1 0.00% 32 8 0.00% 33 6 0.00% 34 7 0.00% 35 5 0.00% 36 8 0.00% 37 6 0.00% 38 8 0.00% 39 9 0.00% 40 14 0.00% 41 15 0.00% 42 10 0.00% 43 13 0.00% 44 9 0.00% 45 15 0.00% 46 13 0.00% 47 18 0.00% 48 28 0.00% 49 28 0.00% 50 27 0.00% 51 47 0.00% 52 34 0.00% 53 49 0.00% 54 47 0.00% 55 60 0.00% 56 59 0.00% 57 85 0.00% 58 107 0.00% 59 119 0.00% 60 139 0.00% 61 136 0.00% 62 183 0.00% 63 197 0.00% 64 200 0.00% 65 258 0.00% 66 294 0.00% 67 343 0.00% 68 392 0.00% 69 483 0.00% 70 576 0.00% 71 602 0.00% 72 736 0.00% 73 834 0.01% 74 917 0.01% 75 1063 0.01% 76 1264 0.01% 77 1366 0.01% 78 1577 0.01% 79 1735 0.01% 80 2021 0.01% 81 2324 0.01% 82 2638 0.02% 83 3034 0.02% 84 3771 0.02% 85 4319 0.03% 86 4699 0.03% 87 5304 0.03% 88 5684 0.04% 89 6261 0.04% 90 6726 0.04% 91 7374 0.05% 92 8073 0.05% 93 8774 0.06% 94 9654 0.06% 95 10282 0.07% 96 11027 0.07% 97 12148 0.08% 98 12993 0.08% 99 14099 0.09% 100 14187 0.09% 101 15241 0.10% 102 16234 0.10% 103 17132 0.11% 104 18231 0.12% 105 19693 0.13% 106 20209 0.13% 107 21265 0.14% 108 21976 0.14% 109 23452 0.15% 110 24421 0.16% 111 25816 0.16% 112 27452 0.18% 113 29099 0.19% 114 30172 0.19% 115 31985 0.20% 116 33044 0.21% 117 34456 0.22% 118 36418 0.23% 119 36832 0.23% 120 37911 0.24% 121 39660 0.25% 122 40756 0.26% 123 43511 0.28% 124 45014 0.29% 125 46291 0.30% 126 48040 0.31% 127 49587 0.32% 128 50543 0.32% 129 53675 0.34% 130 54909 0.35% 131 56784 0.36% 132 59876 0.38% 133 62022 0.40% 134 65881 0.42% 135 68684 0.44% 136 71891 0.46% 137 75089 0.48% 138 79155 0.50% 139 84474 0.54% 140 89434 0.57% 141 96305 0.61% 142 105845 0.67% 143 115405 0.74% 144 130518 0.83% 145 152381 0.97% 146 186959 1.19% 147 241882 1.54% 148 352719 2.25% 149 649109 4.14% 150 3095698 19.74% 151 8680135 55.35% 15682870 reads passed initial QC criterion=sequence-density sequence-density=0.80 sequence-density-rank=1 fanout-score=2.40 fanout-score-rank=29 prefix-density=0.90 prefix-fanout=2.1 sequence=CATCTCAGACCTCTCATAGAACATCTTAACTGGTGCAACACCTGCAATGATTGTCTCAGTTGTGGTGTTCTCTGAGAAACCTAAGTCAGGGTACATGCCACATTTGCAGCCACTGCCACACTTGCA criterion=fanout-score sequence-density=0.03 sequence-density-rank=33 fanout-score=166.61 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=19.4 sequence=ATCATCAACTCCACATAGTTCAAGTTTCCAAGCATACATGAAAACACCTTGAAAGTTGAAGCAGCCAACAAAGCAGTGACGCGTACACAAGACAAAGGATTTATAGGAACCCTTTGCTGTTTATTATTATTTAACAA criterion=sequence-density sequence-density=0.95 sequence-density-rank=1 fanout-score=2.59 fanout-score-rank=30 prefix-density=1.12 prefix-fanout=2.2 sequence=GGTTTCTCAGAGA criterion=fanout-score sequence-density=0.10 sequence-density-rank=26 fanout-score=25.64 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=8.7 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7166152 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 16:31:56 Started mapping on | Feb 14 16:31:57 Finished on | Feb 14 16:34:15 Mapping speed, Million of reads per hour | 409.12 Number of input reads | 15682870 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 14686714 Uniquely mapped reads % | 93.65% Average mapped length | 293.15 Number of splices: Total | 14309254 Number of splices: Annotated (sjdb) | 14021422 Number of splices: GT/AG | 14081586 Number of splices: GC/AG | 178335 Number of splices: AT/AC | 11321 Number of splices: Non-canonical | 38012 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.04% Deletion average length | 2.31 Insertion rate per base | 0.02% Insertion average length | 2.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 404706 % of reads mapped to multiple loci | 2.58% Number of reads mapped to too many loci | 55742 % of reads mapped to too many loci | 0.36% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.32% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 598987 598987 598987 N_multimapping 404706 404706 404706 N_noFeature 487953 14528601 564282 N_ambiguous 158313 944 75942 UnstrandedReadsAssigned:14040448 PositiveStrandReadsAssigned:157169 NegativeStrandReadsAssigned:14046490 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7166152 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166152-trimmed-pair1.fastq SRR7166152-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,682,870 reads, 13,921,461 reads pseudoaligned [quant] estimated average fragment length: 230.251 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,068 rounds 52401 SRR7166152.ke.tsv 34699 SRR7166152.se.tsv 87100 total ==> SRR7166152.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1788.75 1314 43.4903 Potri.005G024800.1.v4.1 1035 805.749 344 25.2758 Potri.004G059700.1.v4.1 961 731.769 32 2.58894 Potri.007G009000.2.v4.1 1416 1186.75 0 0 Potri.003G141000.2.v4.1 2943 2713.75 493 10.7553 Potri.016G087400.1.v4.1 270 85.6656 1117 771.956 Potri.015G069301.1.v4.1 564 338.685 0 0 Potri.010G195200.1.v4.1 1773 1543.75 363.811 13.9523 Potri.012G127500.1.v4.1 977 747.754 2776 219.79 ==> SRR7166152.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 13 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 588 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 374 SRR7166152 completed mapping pipeline successfully