Starting /dee2/code/volunteer_pipeline.sh SRR7166153 current disk space = 3111819022336 free memory = 1319855212 SRR7166153 SRAfilesize ff136541d2d0bdcb12ea105d09f644aa SRR7166153.sra SRR7166153.sra file validated SRR7166153 is paired end SRR7166153 is conventional basespace SRR7166153 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166153_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.83075 33.0 32.0 34.0 30.0 34.0 2 32.15625 33.0 33.0 34.0 29.0 34.0 3 32.22875 33.0 32.0 34.0 30.0 34.0 4 32.00775 33.0 32.0 34.0 30.0 34.0 5 32.23425 33.0 33.0 34.0 31.0 34.0 6 36.234 38.0 37.0 38.0 33.0 38.0 7 36.75925 38.0 37.0 38.0 34.0 38.0 8 36.8125 38.0 38.0 38.0 35.0 38.0 9 36.97275 38.0 38.0 38.0 35.0 38.0 10-14 36.9413 38.0 38.0 38.0 35.2 38.0 15-19 36.838800000000006 38.0 38.0 38.0 34.8 38.0 20-24 36.9139 38.0 38.0 38.0 35.0 38.0 25-29 36.7591 38.0 38.0 38.0 34.6 38.0 30-34 36.5522 38.0 37.6 38.0 34.0 38.0 35-39 36.32985 38.0 37.0 38.0 33.2 38.0 40-44 36.172050000000006 38.0 37.0 38.0 32.6 38.0 45-49 36.181 38.0 37.0 38.0 33.0 38.0 50-54 35.9689 38.0 37.0 38.0 32.2 38.0 55-59 35.66555 38.0 36.4 38.0 30.2 38.0 60-64 35.711 38.0 36.6 38.0 30.6 38.0 65-69 35.51485000000001 38.0 36.0 38.0 29.2 38.0 70-74 35.494099999999996 38.0 36.0 38.0 29.0 38.0 75-79 34.799099999999996 38.0 35.6 38.0 27.4 38.0 80-84 34.660000000000004 38.0 35.4 38.0 26.6 38.0 85-89 34.8233 38.0 35.0 38.0 27.4 38.0 90-94 34.622299999999996 38.0 34.6 38.0 26.2 38.0 95-99 34.348749999999995 38.0 34.0 38.0 25.2 38.0 100-104 33.9797 38.0 34.0 38.0 22.0 38.0 105-109 33.36749999999999 37.0 33.2 38.0 16.2 38.0 110-114 33.1908 37.0 32.6 38.0 16.2 38.0 115-119 32.3277 37.0 31.0 38.0 15.0 38.0 120-124 31.994 36.8 30.4 38.0 15.0 38.0 125-129 31.335500000000003 36.0 30.0 38.0 14.6 38.0 130-134 29.438 34.0 24.2 38.0 13.2 38.0 135-139 28.124649999999995 33.0 21.0 38.0 10.4 38.0 140-144 27.4426 33.0 18.2 38.0 2.0 38.0 145-149 25.18745 33.0 8.6 38.0 2.0 38.0 150-151 19.120874999999998 17.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 4.0 10 1.0 11 0.0 12 3.0 13 2.0 14 1.0 15 5.0 16 3.0 17 4.0 18 2.0 19 5.0 20 15.0 21 15.0 22 28.0 23 33.0 24 38.0 25 56.0 26 59.0 27 72.0 28 101.0 29 135.0 30 153.0 31 215.0 32 249.0 33 327.0 34 428.0 35 663.0 36 840.0 37 543.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.32911392405063 17.72151898734177 10.759493670886076 35.189873417721515 2 19.175 25.275 38.675 16.875 3 16.025 30.349999999999998 27.325 26.3 4 20.150000000000002 38.074999999999996 21.925 19.85 5 19.85 37.2 23.974999999999998 18.975 6 15.85 37.375 25.924999999999997 20.849999999999998 7 12.2 20.724999999999998 47.15 19.925 8 18.55 20.3 29.025000000000002 32.125 9 17.75 21.6 30.925000000000004 29.725 10-14 18.84 30.14 26.919999999999998 24.099999999999998 15-19 19.115 28.299999999999997 28.665000000000003 23.919999999999998 20-24 19.38 28.705000000000002 28.544999999999998 23.369999999999997 25-29 19.205 29.15 28.105000000000004 23.54 30-34 19.18 28.625 28.38 23.815 35-39 19.34 29.075 28.34 23.244999999999997 40-44 20.125 29.659999999999997 26.875 23.34 45-49 19.79 29.235 27.644999999999996 23.330000000000002 50-54 19.525000000000002 28.925 28.025 23.525 55-59 19.814999999999998 28.389999999999997 28.439999999999998 23.355 60-64 19.91 28.439999999999998 27.935 23.715 65-69 19.68 29.5 27.450000000000003 23.369999999999997 70-74 19.850955286585975 29.19375812743823 28.238471541462438 22.716815044513353 75-79 19.46880227076892 29.149982259617822 27.634446753510062 23.746768716103198 80-84 19.4072269589931 28.917986195696304 27.578156719447826 24.09663012586277 85-89 19.865 29.425 27.384999999999998 23.325000000000003 90-94 19.685 28.68 27.855 23.78 95-99 19.8 28.294999999999998 28.605000000000004 23.3 100-104 19.735 29.03 27.215 24.02 105-109 20.135 28.275 27.855 23.735 110-114 20.28 27.74 28.294999999999998 23.685000000000002 115-119 20.805 28.52 27.224999999999998 23.45 120-124 20.272095233331665 28.74506077126994 27.174511078877607 23.808332916520783 125-129 21.09527381845461 28.672168042010505 26.841710427606902 23.390847711927982 130-134 20.88763649172244 28.314798973481608 27.127258088864288 23.670306445931665 135-139 21.1655827913957 27.768884442221108 26.903451725862933 24.16208104052026 140-144 20.87439347706468 28.51783302486119 26.962132959831926 23.645640538242212 145-149 20.87361618995141 28.547813454891553 26.268596904272908 24.309973450884137 150-151 20.98672677185074 27.41046831955923 27.160030052592038 24.442774855997996 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 1.0 22 2.0 23 4.0 24 4.5 25 7.5 26 10.0 27 8.5 28 6.0 29 12.0 30 26.0 31 33.0 32 41.5 33 52.5 34 67.5 35 87.0 36 106.0 37 130.0 38 149.5 39 188.0 40 219.0 41 245.0 42 266.5 43 260.5 44 268.0 45 260.5 46 245.0 47 238.0 48 228.5 49 197.5 50 162.5 51 128.5 52 93.0 53 71.0 54 46.0 55 37.0 56 32.5 57 21.5 58 13.0 59 9.5 60 8.0 61 4.0 62 2.0 63 1.0 64 0.0 65 0.5 66 0.5 67 0.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.03 75-79 1.355 80-84 1.48 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.034999999999999996 125-129 0.025 130-134 0.635 135-139 0.05 140-144 0.045 145-149 0.185 150-151 0.17500000000000002 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.425 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.5875 0.0 0.0 0.0 0.0 102-103 0.8875 0.0 0.0 0.0 0.0 104-105 1.0375 0.0 0.0 0.0 0.0 106-107 1.3125 0.0 0.0 0.0 0.0 108-109 1.5875 0.0 0.0 0.0 0.0 110-111 1.85 0.0 0.0 0.0 0.0 112-113 2.225 0.0 0.0 0.0 0.0 114-115 2.6375 0.0 0.0 0.0 0.0 116-117 3.0125 0.0 0.0 0.0 0.0 118-119 3.55 0.0 0.0 0.0 0.0 120-121 4.15 0.0 0.0 0.0 0.0 122-123 4.512499999999999 0.0 0.0 0.0 0.0 124-125 4.8125 0.0 0.0 0.0 0.0 126-127 5.2125 0.0 0.0 0.0 0.0 128-129 5.75 0.0 0.0 0.0 0.0 130-131 6.199999999999999 0.0 0.0 0.0 0.0 132-133 6.6625 0.0 0.0 0.0 0.0 134-135 7.4 0.0 0.0 0.0 0.0 136-137 8.162500000000001 0.0 0.0 0.0 0.0 138-139 8.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7166153 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166153_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.49775 33.0 33.0 34.0 32.0 34.0 2 32.50925 33.0 33.0 34.0 31.0 34.0 3 32.62275 33.0 33.0 34.0 32.0 34.0 4 32.482 33.0 33.0 34.0 31.0 34.0 5 32.5805 33.0 33.0 34.0 32.0 34.0 6 36.75425 38.0 38.0 38.0 35.0 38.0 7 36.68425 38.0 38.0 38.0 35.0 38.0 8 36.75975 38.0 38.0 38.0 35.0 38.0 9 36.613 38.0 38.0 38.0 34.0 38.0 10-14 36.47574999999999 38.0 38.0 38.0 34.2 38.0 15-19 36.3526 38.0 38.0 38.0 33.8 38.0 20-24 36.17545 38.0 38.0 38.0 32.8 38.0 25-29 36.29135 38.0 38.0 38.0 33.6 38.0 30-34 36.2888 38.0 38.0 38.0 33.6 38.0 35-39 36.14845 38.0 38.0 38.0 33.0 38.0 40-44 36.047799999999995 38.0 38.0 38.0 33.0 38.0 45-49 35.872499999999995 38.0 37.2 38.0 31.0 38.0 50-54 35.78775 38.0 37.0 38.0 30.6 38.0 55-59 35.729049999999994 38.0 37.0 38.0 30.2 38.0 60-64 35.747 38.0 37.0 38.0 30.2 38.0 65-69 35.65725 38.0 37.0 38.0 30.6 38.0 70-74 35.4902 38.0 37.0 38.0 29.0 38.0 75-79 35.322 38.0 36.6 38.0 29.0 38.0 80-84 35.0355 38.0 36.0 38.0 28.0 38.0 85-89 35.02595 38.0 36.0 38.0 28.0 38.0 90-94 34.6568 38.0 35.6 38.0 26.0 38.0 95-99 34.59245 38.0 35.2 38.0 25.6 38.0 100-104 34.24935000000001 38.0 34.4 38.0 24.0 38.0 105-109 34.0812 38.0 34.4 38.0 21.4 38.0 110-114 33.887600000000006 38.0 34.0 38.0 21.4 38.0 115-119 33.12545 38.0 33.6 38.0 15.0 38.0 120-124 32.865750000000006 38.0 32.6 38.0 15.0 38.0 125-129 32.213499999999996 37.4 31.8 38.0 15.0 38.0 130-134 31.261599999999998 36.6 30.6 38.0 13.0 38.0 135-139 30.09945 36.0 27.6 38.0 12.6 38.0 140-144 29.0645 35.8 24.2 38.0 2.0 38.0 145-149 26.795749999999998 33.2 14.6 38.0 2.0 38.0 150-151 20.83575 26.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 7.0 4 3.0 5 3.0 6 0.0 7 1.0 8 1.0 9 7.0 10 1.0 11 4.0 12 3.0 13 5.0 14 7.0 15 5.0 16 9.0 17 9.0 18 12.0 19 18.0 20 19.0 21 29.0 22 22.0 23 29.0 24 24.0 25 29.0 26 43.0 27 78.0 28 73.0 29 93.0 30 107.0 31 129.0 32 181.0 33 241.0 34 324.0 35 482.0 36 840.0 37 1154.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.65 14.875 12.45 32.025 2 21.875 24.975 36.15 17.0 3 19.05 27.575 32.225 21.15 4 24.525 35.65 20.424999999999997 19.400000000000002 5 21.555388847211805 38.98474618654664 22.50562640660165 16.954238559639908 6 17.45 39.5 23.799999999999997 19.25 7 16.1 15.35 47.025 21.525 8 20.150000000000002 21.175 27.700000000000003 30.975 9 22.1 23.0 29.45 25.45 10-14 22.64 28.4 27.66 21.3 15-19 22.505 27.860000000000003 28.849999999999998 20.785 20-24 22.6 28.84 28.095 20.465 25-29 23.455000000000002 28.17 28.375 20.0 30-34 22.415 28.305000000000003 28.57 20.71 35-39 22.655 28.544999999999998 28.16 20.64 40-44 23.25 28.345 28.32 20.085 45-49 23.1 28.275 28.294999999999998 20.330000000000002 50-54 23.005 28.96 28.155 19.88 55-59 23.175 28.52 28.494999999999997 19.81 60-64 22.46 28.38 29.005 20.155 65-69 23.76 28.28 27.900000000000002 20.06 70-74 23.225 28.255000000000003 28.23 20.29 75-79 23.265 27.815 28.804999999999996 20.115 80-84 22.439999999999998 28.395 28.87 20.294999999999998 85-89 23.115 27.815 28.765 20.305 90-94 23.095 28.205000000000002 28.21 20.49 95-99 23.815 27.639999999999997 28.64 19.905 100-104 24.355 27.71 27.994999999999997 19.939999999999998 105-109 23.724999999999998 28.610000000000003 27.73 19.935 110-114 24.104999999999997 28.115000000000002 27.500000000000004 20.28 115-119 24.81 27.77 28.294999999999998 19.125 120-124 23.835 28.904999999999998 27.62 19.64 125-129 24.515 28.595 27.639999999999997 19.25 130-134 24.83 27.950000000000003 28.110000000000003 19.11 135-139 25.35 28.235 27.655 18.759999999999998 140-144 25.785000000000004 27.825 27.389999999999997 19.0 145-149 25.85 27.98 27.395000000000003 18.775 150-151 27.250000000000004 26.8125 27.875 18.0625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 1.0 16 1.0 17 0.5 18 1.5 19 1.5 20 1.5 21 1.0 22 0.5 23 1.0 24 2.0 25 5.0 26 6.5 27 5.5 28 8.5 29 13.5 30 18.5 31 20.0 32 24.0 33 35.5 34 51.5 35 68.5 36 85.5 37 113.0 38 148.5 39 180.0 40 213.5 41 251.0 42 275.5 43 302.5 44 300.5 45 279.0 46 269.5 47 262.0 48 229.5 49 187.0 50 161.0 51 122.5 52 98.0 53 73.5 54 46.5 55 37.5 56 26.5 57 18.5 58 15.5 59 9.0 60 5.0 61 5.5 62 6.0 63 3.5 64 1.5 65 0.5 66 0.5 67 0.5 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77443609022556 99.52499999999999 2 0.20050125313283207 0.4 3 0.02506265664160401 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.45 0.0 0.0 0.0 0.0 98-99 0.575 0.0 0.0 0.0 0.0 100-101 0.6 0.0 0.0 0.0 0.0 102-103 0.8875 0.0 0.0 0.0 0.0 104-105 1.025 0.0 0.0 0.0 0.0 106-107 1.275 0.0 0.0 0.0 0.0 108-109 1.5375 0.0 0.0 0.0 0.0 110-111 1.8 0.0 0.0 0.0 0.0 112-113 2.2 0.0 0.0 0.0 0.0 114-115 2.6125 0.0 0.0 0.0 0.0 116-117 2.9375 0.0 0.0 0.0 0.0 118-119 3.5 0.0 0.0 0.0 0.0 120-121 4.1375 0.0 0.0 0.0 0.0 122-123 4.5625 0.0 0.0 0.0 0.0 124-125 4.9 0.0 0.0 0.0 0.0 126-127 5.324999999999999 0.0 0.0 0.0 0.0 128-129 5.9375 0.0 0.0 0.0 0.0 130-131 6.45 0.0 0.0 0.0 0.0 132-133 6.9375 0.0 0.0 0.0 0.0 134-135 7.612500000000001 0.0 0.0 0.0 0.0 136-137 8.375 0.0 0.0 0.0 0.0 138-139 8.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCTAGG 10 0.006830828 145.0 6 TTGGGTA 10 0.006830828 145.0 4 TTTGGGT 10 0.006830828 145.0 3 TTTTTTT 125 4.26335E-4 10.440001 80-84 >>END_MODULE Read 789499 spots for SRR7166153.sra Written 789499 spots for SRR7166153.sra Read 789499 spots for SRR7166153.sra Written 789499 spots for SRR7166153.sra Read 789499 spots for SRR7166153.sra Written 789499 spots for SRR7166153.sra Read 789499 spots for SRR7166153.sra Written 789499 spots for SRR7166153.sra Read 789499 spots for SRR7166153.sra Written 789499 spots for SRR7166153.sra Read 789499 spots for SRR7166153.sra Written 789499 spots for SRR7166153.sra Read 789499 spots for SRR7166153.sra Written 789499 spots for SRR7166153.sra Read 789499 spots for SRR7166153.sra Written 789499 spots for SRR7166153.sra Read 789499 spots for SRR7166153.sra Written 789499 spots for SRR7166153.sra Read 789499 spots for SRR7166153.sra Written 789499 spots for SRR7166153.sra Read 789499 spots for SRR7166153.sra Written 789499 spots for SRR7166153.sra Read 789499 spots for SRR7166153.sra Written 789499 spots for SRR7166153.sra Read 789499 spots for SRR7166153.sra Written 789499 spots for SRR7166153.sra Read 789510 spots for SRR7166153.sra Written 789510 spots for SRR7166153.sra Read 789499 spots for SRR7166153.sra Written 789499 spots for SRR7166153.sra Read 789499 spots for SRR7166153.sra Written 789499 spots for SRR7166153.sra Read 789499 spots for SRR7166153.sra Written 789499 spots for SRR7166153.sra Read 789499 spots for SRR7166153.sra Written 789499 spots for SRR7166153.sra Read 789499 spots for SRR7166153.sra Written 789499 spots for SRR7166153.sra Read 789499 spots for SRR7166153.sra Written 789499 spots for SRR7166153.sra SRR ids: ['SRR7166153.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3qdszaip SRR7166153.sra spots: 15789991 blocks: [[1, 789499], [789500, 1578998], [1578999, 2368497], [2368498, 3157996], [3157997, 3947495], [3947496, 4736994], [4736995, 5526493], [5526494, 6315992], [6315993, 7105491], [7105492, 7894990], [7894991, 8684489], [8684490, 9473988], [9473989, 10263487], [10263488, 11052986], [11052987, 11842485], [11842486, 12631984], [12631985, 13421483], [13421484, 14210982], [14210983, 15000481], [15000482, 15789991]] SRR7166153 file size 5329009 SRR7166153 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166153 SRR7166153_1.fastq SRR7166153_2.fastq Input file: SRR7166153_1.fastq Paired file: SRR7166153_2.fastq trimmed: SRR7166153-trimmed-pair1.fastq, SRR7166153-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 16:30:17 2025 >> started Fri Feb 14 16:30:43 2025 >> done (25.842s) 15789991 read pairs processed; of these: 19365 ( 0.12%) short read pairs filtered out after trimming by size control 15505 ( 0.10%) empty read pairs filtered out after trimming by size control 15755121 (99.78%) read pairs available; of these: 11176473 (70.94%) trimmed read pairs available after processing 4578648 (29.06%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 8 0.00% 20 5 0.00% 21 3 0.00% 22 4 0.00% 23 5 0.00% 24 4 0.00% 25 2 0.00% 26 4 0.00% 27 3 0.00% 28 5 0.00% 29 5 0.00% 30 5 0.00% 31 9 0.00% 32 6 0.00% 33 5 0.00% 34 5 0.00% 35 14 0.00% 36 12 0.00% 37 11 0.00% 38 21 0.00% 39 10 0.00% 40 15 0.00% 41 20 0.00% 42 30 0.00% 43 27 0.00% 44 26 0.00% 45 22 0.00% 46 35 0.00% 47 41 0.00% 48 50 0.00% 49 68 0.00% 50 70 0.00% 51 90 0.00% 52 92 0.00% 53 122 0.00% 54 106 0.00% 55 108 0.00% 56 120 0.00% 57 162 0.00% 58 157 0.00% 59 195 0.00% 60 230 0.00% 61 245 0.00% 62 292 0.00% 63 344 0.00% 64 340 0.00% 65 426 0.00% 66 542 0.00% 67 532 0.00% 68 585 0.00% 69 742 0.00% 70 900 0.01% 71 1006 0.01% 72 1110 0.01% 73 1346 0.01% 74 1537 0.01% 75 1637 0.01% 76 1807 0.01% 77 1929 0.01% 78 2266 0.01% 79 2580 0.02% 80 3026 0.02% 81 3284 0.02% 82 3852 0.02% 83 4347 0.03% 84 5290 0.03% 85 6214 0.04% 86 6656 0.04% 87 7159 0.05% 88 7573 0.05% 89 8115 0.05% 90 9023 0.06% 91 9787 0.06% 92 10667 0.07% 93 11619 0.07% 94 12350 0.08% 95 13116 0.08% 96 13832 0.09% 97 15051 0.10% 98 16119 0.10% 99 17198 0.11% 100 18819 0.12% 101 20186 0.13% 102 21554 0.14% 103 23087 0.15% 104 24043 0.15% 105 25721 0.16% 106 27107 0.17% 107 27849 0.18% 108 29723 0.19% 109 31080 0.20% 110 33193 0.21% 111 34755 0.22% 112 37188 0.24% 113 39399 0.25% 114 42404 0.27% 115 44272 0.28% 116 45796 0.29% 117 48304 0.31% 118 50161 0.32% 119 53388 0.34% 120 55550 0.35% 121 58674 0.37% 122 61371 0.39% 123 65498 0.42% 124 69883 0.44% 125 73683 0.47% 126 77757 0.49% 127 81855 0.52% 128 85690 0.54% 129 91812 0.58% 130 96361 0.61% 131 102509 0.65% 132 111072 0.70% 133 119582 0.76% 134 129765 0.82% 135 142011 0.90% 136 148793 0.94% 137 154461 0.98% 138 166288 1.06% 139 181234 1.15% 140 201668 1.28% 141 203932 1.29% 142 224124 1.42% 143 250306 1.59% 144 286430 1.82% 145 342849 2.18% 146 418770 2.66% 147 544149 3.45% 148 756795 4.80% 149 1303815 8.28% 150 3685378 23.39% 151 4578648 29.06% 15755121 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.44 fanout-score-rank=32 prefix-density=0.22 prefix-fanout=2.3 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.06 sequence-density-rank=25 fanout-score=476.49 fanout-score-rank=1 prefix-density=0.92 prefix-fanout=32.9 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=5.76 fanout-score-rank=18 prefix-density=0.46 prefix-fanout=3.7 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.07 sequence-density-rank=22 fanout-score=333.90 fanout-score-rank=1 prefix-density=0.78 prefix-fanout=30.9 sequence=GAAGAAGAAGAAA SRR7166153 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 16:31:45 Started mapping on | Feb 14 16:31:46 Finished on | Feb 14 16:33:36 Mapping speed, Million of reads per hour | 515.62 Number of input reads | 15755121 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 15023763 Uniquely mapped reads % | 95.36% Average mapped length | 288.19 Number of splices: Total | 15086079 Number of splices: Annotated (sjdb) | 14822409 Number of splices: GT/AG | 14851995 Number of splices: GC/AG | 186288 Number of splices: AT/AC | 10407 Number of splices: Non-canonical | 37389 Mismatch rate per base, % | 0.48% Deletion rate per base | 0.03% Deletion average length | 2.48 Insertion rate per base | 0.02% Insertion average length | 2.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 415333 % of reads mapped to multiple loci | 2.64% Number of reads mapped to too many loci | 23853 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.78% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 334732 334732 334732 N_multimapping 415333 415333 415333 N_noFeature 435679 14885070 506122 N_ambiguous 140774 583 72229 UnstrandedReadsAssigned:14447310 PositiveStrandReadsAssigned:138110 NegativeStrandReadsAssigned:14445412 Dataset is classified negative stranded MeadianReadLen=149 20thPercentileLength=137 echo kmer=133 SRR7166153 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166153-trimmed-pair1.fastq SRR7166153-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,755,121 reads, 14,379,167 reads pseudoaligned [quant] estimated average fragment length: 224.709 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,191 rounds 52401 SRR7166153.ke.tsv 34699 SRR7166153.se.tsv 87100 total ==> SRR7166153.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1794.29 838 33.7625 Potri.005G024800.1.v4.1 1035 811.291 372 33.1474 Potri.004G059700.1.v4.1 961 737.296 27 2.64731 Potri.007G009000.2.v4.1 1416 1192.29 12 0.727582 Potri.003G141000.2.v4.1 2943 2719.29 521.138 13.8542 Potri.016G087400.1.v4.1 270 87.7118 1291.59 1064.51 Potri.015G069301.1.v4.1 564 343.576 0 0 Potri.010G195200.1.v4.1 1773 1549.29 156 7.27905 Potri.012G127500.1.v4.1 977 753.296 2122 203.64 ==> SRR7166153.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 38 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 387 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 171 SRR7166153 completed mapping pipeline successfully