Starting /dee2/code/volunteer_pipeline.sh SRR7166154 current disk space = 3110869733376 free memory = 1568480568 SRR7166154 SRAfilesize a7af0f570a576c63ffb3ae16e01932c6 SRR7166154.sra SRR7166154.sra file validated SRR7166154 is paired end SRR7166154 is conventional basespace SRR7166154 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166154_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.592 30.0 18.0 33.0 18.0 33.0 2 31.7055 33.0 31.0 33.0 29.0 34.0 3 31.959 33.0 31.0 33.0 29.0 34.0 4 32.62325 33.0 33.0 33.0 32.0 34.0 5 32.8525 33.0 33.0 34.0 32.0 34.0 6 36.26675 38.0 36.0 38.0 33.0 38.0 7 37.11025 38.0 38.0 38.0 36.0 38.0 8 37.45375 38.0 38.0 38.0 37.0 38.0 9 37.57225 38.0 38.0 38.0 38.0 38.0 10-14 37.51335 38.0 38.0 38.0 37.4 38.0 15-19 37.500099999999996 38.0 38.0 38.0 37.4 38.0 20-24 37.4874 38.0 38.0 38.0 37.6 38.0 25-29 37.499199999999995 38.0 38.0 38.0 37.6 38.0 30-34 37.46255000000001 38.0 38.0 38.0 37.0 38.0 35-39 37.440900000000006 38.0 38.0 38.0 37.0 38.0 40-44 37.38275 38.0 38.0 38.0 37.0 38.0 45-49 37.39195 38.0 38.0 38.0 37.0 38.0 50-54 37.21185 38.0 38.0 38.0 36.8 38.0 55-59 36.87235 38.0 38.0 38.0 36.2 38.0 60-64 37.04695 38.0 38.0 38.0 36.0 38.0 65-69 37.19655 38.0 38.0 38.0 36.4 38.0 70-74 37.182100000000005 38.0 38.0 38.0 36.2 38.0 75-79 37.03305 38.0 38.0 38.0 36.0 38.0 80-84 36.840149999999994 38.0 38.0 38.0 35.4 38.0 85-89 36.74335 38.0 38.0 38.0 34.6 38.0 90-94 36.7771 38.0 38.0 38.0 34.8 38.0 95-99 36.6325 38.0 38.0 38.0 34.2 38.0 100-104 36.531349999999996 38.0 38.0 38.0 34.2 38.0 105-109 36.19675 38.0 38.0 38.0 33.8 38.0 110-114 36.33565 38.0 38.0 38.0 34.0 38.0 115-119 36.09575 38.0 37.2 38.0 32.8 38.0 120-124 35.739999999999995 38.0 36.6 38.0 31.6 38.0 125-129 35.709799999999994 38.0 36.8 38.0 31.4 38.0 130-134 35.5702 38.0 36.0 38.0 31.0 38.0 135-139 35.286350000000006 38.0 36.0 38.0 30.6 38.0 140-144 34.9738 38.0 35.6 38.0 29.2 38.0 145-149 34.547450000000005 38.0 35.0 38.0 27.6 38.0 150-151 31.023375 36.5 30.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 3.0 16 0.0 17 1.0 18 1.0 19 3.0 20 3.0 21 2.0 22 3.0 23 10.0 24 7.0 25 12.0 26 18.0 27 20.0 28 15.0 29 24.0 30 48.0 31 63.0 32 67.0 33 90.0 34 174.0 35 253.0 36 702.0 37 2481.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.131551901336074 18.96197327852004 12.564234326824256 29.342240493319633 2 19.725 25.900000000000002 36.375 18.0 3 17.575 32.0 27.85 22.575 4 19.775000000000002 38.5 22.900000000000002 18.825 5 19.904976244061015 37.859464866216555 23.63090772693173 18.6046511627907 6 16.0 37.05 24.8 22.15 7 12.3 20.875 45.675 21.15 8 17.7 21.75 28.050000000000004 32.5 9 18.099999999999998 23.45 30.099999999999998 28.349999999999998 10-14 18.895 31.22 25.82 24.065 15-19 19.46 29.5 27.455000000000002 23.585 20-24 19.055 29.535 28.110000000000003 23.3 25-29 19.845 30.165 26.534999999999997 23.455000000000002 30-34 19.555 30.005 26.895000000000003 23.544999999999998 35-39 19.805 29.335 27.245 23.615 40-44 19.72 29.509999999999998 27.36 23.41 45-49 19.580000000000002 29.43 27.22 23.77 50-54 20.232604772408262 29.085622618808905 27.195708842991777 23.48606376579106 55-59 19.776440240756664 29.4067067927773 27.17616711344899 23.640685853017047 60-64 19.666299228379597 29.38671209540034 27.13197715201924 23.81501152420082 65-69 19.985 29.07 27.284999999999997 23.66 70-74 20.07 29.015 27.395000000000003 23.52 75-79 20.18 28.92 27.200000000000003 23.7 80-84 19.939999999999998 28.675 27.810000000000002 23.575 85-89 20.11 28.775000000000002 27.3 23.815 90-94 20.605 29.354999999999997 26.93 23.11 95-99 20.585 28.89 27.224999999999998 23.3 100-104 20.150000000000002 28.804999999999996 27.435 23.61 105-109 20.345864661654137 28.56140350877193 27.29824561403509 23.794486215538846 110-114 20.674999999999997 28.810000000000002 26.889999999999997 23.625 115-119 21.205 28.185 26.924999999999997 23.685000000000002 120-124 20.305 28.73 27.05 23.915 125-129 20.885 27.93 27.295 23.89 130-134 21.17 28.32 27.155 23.355 135-139 21.515 28.365000000000002 26.640000000000004 23.48 140-144 21.12 28.815 26.555 23.51 145-149 21.490000000000002 28.754999999999995 25.885 23.87 150-151 22.011005502751377 28.639319659829916 25.42521260630315 23.92446223111556 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 1.0 21 1.0 22 0.5 23 1.5 24 2.5 25 3.5 26 6.5 27 10.0 28 16.5 29 24.5 30 33.5 31 43.5 32 52.5 33 59.5 34 66.5 35 91.5 36 115.5 37 133.0 38 154.0 39 169.0 40 202.0 41 229.5 42 231.0 43 230.0 44 235.5 45 249.5 46 249.5 47 233.0 48 208.5 49 186.5 50 159.0 51 131.5 52 111.0 53 87.5 54 65.0 55 48.0 56 35.5 57 26.5 58 23.0 59 17.0 60 17.0 61 12.5 62 6.0 63 4.5 64 2.5 65 3.0 66 1.5 67 0.5 68 2.5 69 2.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.7 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.26 55-59 1.145 60-64 0.21 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.25 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.6875 0.0 0.0 0.0 0.0 100-101 0.875 0.0 0.0 0.0 0.0 102-103 1.0375 0.0 0.0 0.0 0.0 104-105 1.225 0.0 0.0 0.0 0.0 106-107 1.55 0.0 0.0 0.0 0.0 108-109 1.825 0.0 0.0 0.0 0.0 110-111 2.025 0.0 0.0 0.0 0.0 112-113 2.2875 0.0 0.0 0.0 0.0 114-115 2.65 0.0 0.0 0.0 0.0 116-117 3.05 0.0 0.0 0.0 0.0 118-119 3.3499999999999996 0.0 0.0 0.0 0.0 120-121 3.675 0.0 0.0 0.0 0.0 122-123 4.1 0.0 0.0 0.0 0.0 124-125 4.6125 0.0 0.0 0.0 0.0 126-127 5.125 0.0 0.0 0.0 0.0 128-129 5.675 0.0 0.0 0.0 0.0 130-131 6.35 0.0 0.0 0.0 0.0 132-133 6.925 0.0 0.0 0.0 0.0 134-135 7.487500000000001 0.0 0.0 0.0 0.0 136-137 8.2 0.0 0.0 0.0 0.0 138-139 8.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGTTGCA 10 0.0068449317 144.90001 7 >>END_MODULE SRR7166154 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166154_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.928 33.0 33.0 34.0 32.0 34.0 2 33.03125 34.0 33.0 34.0 32.0 34.0 3 33.05825 34.0 33.0 34.0 32.0 34.0 4 33.05175 34.0 33.0 34.0 33.0 34.0 5 33.014 34.0 33.0 34.0 32.0 34.0 6 37.16475 38.0 38.0 38.0 37.0 38.0 7 37.1085 38.0 38.0 38.0 36.0 38.0 8 37.14375 38.0 38.0 38.0 37.0 38.0 9 37.1245 38.0 38.0 38.0 37.0 38.0 10-14 37.1178 38.0 38.0 38.0 36.8 38.0 15-19 37.1363 38.0 38.0 38.0 36.8 38.0 20-24 37.03465 38.0 38.0 38.0 36.0 38.0 25-29 37.06505000000001 38.0 38.0 38.0 36.4 38.0 30-34 36.97645 38.0 38.0 38.0 36.0 38.0 35-39 36.91115 38.0 38.0 38.0 36.0 38.0 40-44 36.9097 38.0 38.0 38.0 36.0 38.0 45-49 36.73175 38.0 38.0 38.0 35.4 38.0 50-54 36.642849999999996 38.0 38.0 38.0 35.0 38.0 55-59 36.52695 38.0 38.0 38.0 34.4 38.0 60-64 36.494299999999996 38.0 38.0 38.0 34.6 38.0 65-69 36.5634 38.0 38.0 38.0 35.0 38.0 70-74 36.470749999999995 38.0 38.0 38.0 34.2 38.0 75-79 36.37185 38.0 38.0 38.0 34.0 38.0 80-84 36.2769 38.0 38.0 38.0 34.0 38.0 85-89 36.10305 38.0 37.6 38.0 33.2 38.0 90-94 35.97305 38.0 37.2 38.0 33.0 38.0 95-99 35.856350000000006 38.0 37.0 38.0 32.6 38.0 100-104 35.557399999999994 38.0 37.0 38.0 30.6 38.0 105-109 35.4639 38.0 37.0 38.0 29.8 38.0 110-114 35.060449999999996 38.0 36.0 38.0 28.2 38.0 115-119 34.836200000000005 38.0 36.0 38.0 27.2 38.0 120-124 34.5164 38.0 35.0 38.0 26.0 38.0 125-129 34.35845 38.0 35.0 38.0 24.8 38.0 130-134 33.88334999999999 38.0 34.6 38.0 21.0 38.0 135-139 33.37635 38.0 34.0 38.0 19.8 38.0 140-144 32.9722 38.0 34.0 38.0 14.6 38.0 145-149 31.618800000000004 37.4 32.6 38.0 8.8 38.0 150-151 27.083750000000002 33.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 0.0 4 2.0 5 1.0 6 5.0 7 1.0 8 2.0 9 2.0 10 3.0 11 1.0 12 1.0 13 2.0 14 2.0 15 5.0 16 2.0 17 6.0 18 3.0 19 14.0 20 6.0 21 12.0 22 17.0 23 16.0 24 13.0 25 15.0 26 29.0 27 36.0 28 46.0 29 39.0 30 46.0 31 73.0 32 80.0 33 131.0 34 204.0 35 343.0 36 770.0 37 2063.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.425000000000004 16.5 13.8 27.275 2 24.575 22.85 35.375 17.2 3 21.275 26.474999999999998 31.324999999999996 20.925 4 25.05 34.625 21.65 18.675 5 23.0 38.574999999999996 20.9 17.525 6 17.95 38.525 23.9 19.625 7 16.579144786196547 16.22905726431608 46.28657164291073 20.905226306576644 8 20.730182545636406 20.730182545636406 27.556889222305575 30.9827456864216 9 22.405601400350086 24.8062015503876 27.981995498874717 24.8062015503876 10-14 23.905 28.43 26.255 21.41 15-19 23.955000000000002 27.735 27.27 21.04 20-24 23.551196076468823 27.444700230207186 27.88509658692824 21.119007106395756 25-29 23.625906476619154 27.666916729182294 27.406851712928233 21.30032508127032 30-34 23.372203593413744 27.581202142034932 28.216805965667387 20.82978829888394 35-39 23.563563563563562 27.66766766766767 27.912912912912912 20.855855855855857 40-44 23.491142027825042 27.334601141026926 27.970173155840257 21.20408367530778 45-49 23.56091700870958 27.40514566022625 27.850635699269194 21.183301631794972 50-54 23.50673409102288 27.562208982125867 28.158013317979275 20.773043608871976 55-59 23.849812265331664 27.594493116395498 27.924906132665832 20.63078848560701 60-64 23.770902172824673 27.866226093922098 27.776108941624113 20.586762791629116 65-69 23.67959949937422 27.304130162703377 28.400500625782225 20.615769712140175 70-74 23.456666499774695 27.376958894507585 28.653682471336307 20.512692134381417 75-79 23.425453089015722 27.42064684089316 28.341844397717033 20.812055672374086 80-84 23.565922514766243 27.905696265892484 28.4212633897287 20.107117829612577 85-89 23.74705852901417 27.301857507635308 27.902668602613527 21.048415360736993 90-94 23.067294211896655 27.833967554576404 28.65511716402964 20.443621069497297 95-99 23.960941412118178 27.85177766649975 27.801702553830747 20.385578367551325 100-104 23.459324155193993 27.844806007509387 28.170212765957448 20.52565707133917 105-109 24.30402563589025 27.828960544762666 27.763869417184058 20.10314440216303 110-114 23.800701051577366 27.711567351026538 28.33249874812218 20.15523284927391 115-119 24.091136705057586 28.41261892839259 27.225838758137204 20.27040560841262 120-124 23.920665130722227 28.0777321446459 28.182910948612644 19.818691776019232 125-129 25.172759138708063 27.541311967951927 27.47120681021532 19.814722083124686 130-134 25.488232348522782 27.646469704556836 27.856785177766653 19.00851276915373 135-139 24.58072590738423 27.98498122653317 27.774718397997493 19.659574468085104 140-144 25.44671905500776 27.97937834726463 27.21857950848391 19.355323089243708 145-149 25.66593230522732 27.618666132585616 27.233126376927697 19.48227518525936 150-151 26.666666666666668 26.49155722326454 27.054409005628514 19.787367104440275 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 1.5 15 1.0 16 1.0 17 2.0 18 1.0 19 0.0 20 0.5 21 0.5 22 1.0 23 1.0 24 1.5 25 3.0 26 2.5 27 4.0 28 6.5 29 8.5 30 14.5 31 17.5 32 23.0 33 38.0 34 48.0 35 65.5 36 84.0 37 104.5 38 129.0 39 151.5 40 168.5 41 200.0 42 250.0 43 280.5 44 285.0 45 273.5 46 252.5 47 247.0 48 233.5 49 213.0 50 183.5 51 144.0 52 126.5 53 102.5 54 85.0 55 60.5 56 42.0 57 34.5 58 23.0 59 17.0 60 13.5 61 12.5 62 7.0 63 4.5 64 5.0 65 2.5 66 4.0 67 5.5 68 2.0 69 2.0 70 2.0 71 0.0 72 1.5 73 1.5 74 0.5 75 0.5 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.025 8 0.025 9 0.025 10-14 0.0 15-19 0.0 20-24 0.09 25-29 0.025 30-34 0.095 35-39 0.1 40-44 0.09 45-49 0.11 50-54 0.135 55-59 0.125 60-64 0.13 65-69 0.125 70-74 0.135 75-79 0.13 80-84 0.11 85-89 0.135 90-94 0.13999999999999999 95-99 0.15 100-104 0.125 105-109 0.13999999999999999 110-114 0.15 115-119 0.15 120-124 0.16999999999999998 125-129 0.15 130-134 0.15 135-139 0.125 140-144 0.105 145-149 0.13999999999999999 150-151 0.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64868255959848 99.275 2 0.32622333751568383 0.65 3 0.02509410288582183 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.6875 0.0 0.0 0.0 0.0 100-101 0.875 0.0 0.0 0.0 0.0 102-103 1.0375 0.0 0.0 0.0 0.0 104-105 1.225 0.0 0.0 0.0 0.0 106-107 1.525 0.0 0.0 0.0 0.0 108-109 1.8 0.0 0.0 0.0 0.0 110-111 2.0 0.0 0.0 0.0 0.0 112-113 2.3 0.0 0.0 0.0 0.0 114-115 2.675 0.0 0.0 0.0 0.0 116-117 3.05 0.0 0.0 0.0 0.0 118-119 3.3499999999999996 0.0 0.0 0.0 0.0 120-121 3.6625 0.0 0.0 0.0 0.0 122-123 4.1 0.0 0.0 0.0 0.0 124-125 4.6125 0.0 0.0 0.0 0.0 126-127 5.1375 0.0 0.0 0.0 0.0 128-129 5.7125 0.0 0.0 0.0 0.0 130-131 6.3875 0.0 0.0 0.0 0.0 132-133 7.0 0.0 0.0 0.0 0.0 134-135 7.6 0.0 0.0 0.0 0.0 136-137 8.2625 0.0 0.0 0.0 0.0 138-139 8.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATGCTT 10 0.006830828 145.0 9 GCTGAAA 10 0.006830828 145.0 1 >>END_MODULE Read 937474 spots for SRR7166154.sra Written 937474 spots for SRR7166154.sra Read 937474 spots for SRR7166154.sra Written 937474 spots for SRR7166154.sra Read 937474 spots for SRR7166154.sra Written 937474 spots for SRR7166154.sra Read 937474 spots for SRR7166154.sra Written 937474 spots for SRR7166154.sra Read 937474 spots for SRR7166154.sra Written 937474 spots for SRR7166154.sra Read 937474 spots for SRR7166154.sra Written 937474 spots for SRR7166154.sra Read 937474 spots for SRR7166154.sra Written 937474 spots for SRR7166154.sra Read 937474 spots for SRR7166154.sra Written 937474 spots for SRR7166154.sra Read 937474 spots for SRR7166154.sra Written 937474 spots for SRR7166154.sra Read 937474 spots for SRR7166154.sra Written 937474 spots for SRR7166154.sra Read 937474 spots for SRR7166154.sra Written 937474 spots for SRR7166154.sra Read 937474 spots for SRR7166154.sra Written 937474 spots for SRR7166154.sra Read 937474 spots for SRR7166154.sra Written 937474 spots for SRR7166154.sra Read 937490 spots for SRR7166154.sra Written 937490 spots for SRR7166154.sra Read 937474 spots for SRR7166154.sra Written 937474 spots for SRR7166154.sra Read 937474 spots for SRR7166154.sra Written 937474 spots for SRR7166154.sra Read 937474 spots for SRR7166154.sra Written 937474 spots for SRR7166154.sra Read 937474 spots for SRR7166154.sra Written 937474 spots for SRR7166154.sra Read 937474 spots for SRR7166154.sra Written 937474 spots for SRR7166154.sra Read 937474 spots for SRR7166154.sra Written 937474 spots for SRR7166154.sra SRR ids: ['SRR7166154.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ak0o1vt4 SRR7166154.sra spots: 18749496 blocks: [[1, 937474], [937475, 1874948], [1874949, 2812422], [2812423, 3749896], [3749897, 4687370], [4687371, 5624844], [5624845, 6562318], [6562319, 7499792], [7499793, 8437266], [8437267, 9374740], [9374741, 10312214], [10312215, 11249688], [11249689, 12187162], [12187163, 13124636], [13124637, 14062110], [14062111, 14999584], [14999585, 15937058], [15937059, 16874532], [16874533, 17812006], [17812007, 18749496]] SRR7166154 file size 6331888 SRR7166154 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166154 SRR7166154_1.fastq SRR7166154_2.fastq Input file: SRR7166154_1.fastq Paired file: SRR7166154_2.fastq trimmed: SRR7166154-trimmed-pair1.fastq, SRR7166154-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 18:00:58 2025 >> started Fri Feb 14 18:01:28 2025 >> done (30.066s) 18749496 read pairs processed; of these: 20615 ( 0.11%) short read pairs filtered out after trimming by size control 13839 ( 0.07%) empty read pairs filtered out after trimming by size control 18715042 (99.82%) read pairs available; of these: 8840416 (47.24%) trimmed read pairs available after processing 9874626 (52.76%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 3 0.00% 21 7 0.00% 22 7 0.00% 23 10 0.00% 24 7 0.00% 25 13 0.00% 26 2 0.00% 27 6 0.00% 28 7 0.00% 29 3 0.00% 30 5 0.00% 31 15 0.00% 32 8 0.00% 33 9 0.00% 34 6 0.00% 35 14 0.00% 36 18 0.00% 37 20 0.00% 38 17 0.00% 39 17 0.00% 40 18 0.00% 41 24 0.00% 42 15 0.00% 43 25 0.00% 44 30 0.00% 45 38 0.00% 46 34 0.00% 47 36 0.00% 48 46 0.00% 49 67 0.00% 50 47 0.00% 51 84 0.00% 52 100 0.00% 53 78 0.00% 54 89 0.00% 55 114 0.00% 56 147 0.00% 57 184 0.00% 58 217 0.00% 59 231 0.00% 60 280 0.00% 61 319 0.00% 62 336 0.00% 63 364 0.00% 64 420 0.00% 65 425 0.00% 66 527 0.00% 67 600 0.00% 68 682 0.00% 69 849 0.00% 70 959 0.01% 71 1106 0.01% 72 1316 0.01% 73 1517 0.01% 74 1674 0.01% 75 2037 0.01% 76 2228 0.01% 77 2393 0.01% 78 2639 0.01% 79 3000 0.02% 80 3414 0.02% 81 4108 0.02% 82 4662 0.02% 83 5338 0.03% 84 7422 0.04% 85 7582 0.04% 86 7726 0.04% 87 8653 0.05% 88 9092 0.05% 89 9949 0.05% 90 10970 0.06% 91 11806 0.06% 92 12984 0.07% 93 14407 0.08% 94 15370 0.08% 95 16181 0.09% 96 17060 0.09% 97 17749 0.09% 98 19036 0.10% 99 21388 0.11% 100 20991 0.11% 101 22374 0.12% 102 24439 0.13% 103 26294 0.14% 104 27586 0.15% 105 29261 0.16% 106 30094 0.16% 107 31420 0.17% 108 32207 0.17% 109 33615 0.18% 110 35300 0.19% 111 37032 0.20% 112 39261 0.21% 113 41764 0.22% 114 43865 0.23% 115 45863 0.25% 116 47175 0.25% 117 48773 0.26% 118 49433 0.26% 119 51033 0.27% 120 52219 0.28% 121 54191 0.29% 122 56326 0.30% 123 59256 0.32% 124 62122 0.33% 125 63936 0.34% 126 66457 0.36% 127 68062 0.36% 128 69604 0.37% 129 71680 0.38% 130 73011 0.39% 131 75703 0.40% 132 78580 0.42% 133 82737 0.44% 134 86850 0.46% 135 90535 0.48% 136 94301 0.50% 137 98156 0.52% 138 102721 0.55% 139 106702 0.57% 140 111469 0.60% 141 120036 0.64% 142 129804 0.69% 143 141839 0.76% 144 160103 0.86% 145 185224 0.99% 146 223172 1.19% 147 291158 1.56% 148 421658 2.25% 149 788670 4.21% 150 3785961 20.23% 151 9874626 52.76% 18715042 reads passed initial QC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.26 fanout-score-rank=30 prefix-density=0.42 prefix-fanout=2.2 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.10 sequence-density-rank=24 fanout-score=37.51 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=11.3 sequence=TTCTTTCCACAGACATTGAGAAGCAAGCTTAGAGA criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=4.33 fanout-score-rank=14 prefix-density=0.76 prefix-fanout=3.1 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=40.70 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=3.7 sequence=CTCTTCTATAGCTTCTATTAGCTAGTATTCACTGTAGCTTCTAAATTCAAAAGGAGCTATTAGCTTTTGATAGAAATGGCTTCCAAAAGCACAGCATCACTTGCTCTCTTTCTTGCACTCAACCTCCTCTTCTTTTCCCTAGTCACGGCCTGTGGAGGGGGTTGCCCGTCTCCAAAACCAAAACCAAAGCCAAA SRR7166154 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 18:03:05 Started mapping on | Feb 14 18:03:05 Finished on | Feb 14 18:06:11 Mapping speed, Million of reads per hour | 362.23 Number of input reads | 18715042 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 17023974 Uniquely mapped reads % | 90.96% Average mapped length | 291.68 Number of splices: Total | 15106178 Number of splices: Annotated (sjdb) | 14819324 Number of splices: GT/AG | 14858112 Number of splices: GC/AG | 188879 Number of splices: AT/AC | 10992 Number of splices: Non-canonical | 48195 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.04% Deletion average length | 2.18 Insertion rate per base | 0.02% Insertion average length | 2.20 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 515567 % of reads mapped to multiple loci | 2.75% Number of reads mapped to too many loci | 56648 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.85% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1192989 1192989 1192989 N_multimapping 515567 515567 515567 N_noFeature 452217 16807337 550649 N_ambiguous 197774 1245 78782 UnstrandedReadsAssigned:16373983 PositiveStrandReadsAssigned:215392 NegativeStrandReadsAssigned:16394543 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7166154 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166154-trimmed-pair1.fastq SRR7166154-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,715,042 reads, 16,305,074 reads pseudoaligned [quant] estimated average fragment length: 225.884 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,076 rounds 52401 SRR7166154.ke.tsv 34699 SRR7166154.se.tsv 87100 total ==> SRR7166154.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1793.12 948 27.5726 Potri.005G024800.1.v4.1 1035 810.116 411 26.4589 Potri.004G059700.1.v4.1 961 736.145 28 1.98368 Potri.007G009000.2.v4.1 1416 1191.12 1 0.0437848 Potri.003G141000.2.v4.1 2943 2718.12 531 10.1884 Potri.016G087400.1.v4.1 270 89.084 1211.49 709.247 Potri.015G069301.1.v4.1 564 343.145 0 0 Potri.010G195200.1.v4.1 1773 1548.12 395 13.3067 Potri.012G127500.1.v4.1 977 752.141 4965 344.269 ==> SRR7166154.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 24 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 765 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 483 SRR7166154 completed mapping pipeline successfully