Starting /dee2/code/volunteer_pipeline.sh SRR7166155 current disk space = 3110503190528 free memory = 1573867408 SRR7166155 SRAfilesize 7367fae3185132c4664536ac6701b2e3 SRR7166155.sra SRR7166155.sra file validated SRR7166155 is paired end SRR7166155 is conventional basespace SRR7166155 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166155_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.722 25.0 18.0 31.0 18.0 33.0 2 28.7115 31.0 27.0 32.0 25.0 33.0 3 30.5825 31.0 29.0 33.0 27.0 33.0 4 32.2875 33.0 33.0 33.0 31.0 33.0 5 32.7315 33.0 33.0 33.0 32.0 34.0 6 37.0865 38.0 37.0 38.0 36.0 38.0 7 37.3975 38.0 38.0 38.0 37.0 38.0 8 37.582 38.0 38.0 38.0 37.0 38.0 9 37.57525 38.0 38.0 38.0 38.0 38.0 10-14 37.56465000000001 38.0 38.0 38.0 37.8 38.0 15-19 37.5406 38.0 38.0 38.0 37.8 38.0 20-24 37.5065 38.0 38.0 38.0 37.6 38.0 25-29 37.47745 38.0 38.0 38.0 37.2 38.0 30-34 37.44255 38.0 38.0 38.0 37.0 38.0 35-39 37.3834 38.0 38.0 38.0 37.0 38.0 40-44 37.396899999999995 38.0 38.0 38.0 37.0 38.0 45-49 37.4178 38.0 38.0 38.0 37.0 38.0 50-54 37.16325 38.0 38.0 38.0 36.8 38.0 55-59 36.498949999999994 38.0 38.0 38.0 35.8 38.0 60-64 36.7876 38.0 38.0 38.0 35.6 38.0 65-69 37.1178 38.0 38.0 38.0 36.0 38.0 70-74 37.045649999999995 38.0 38.0 38.0 36.0 38.0 75-79 37.00005 38.0 38.0 38.0 36.0 38.0 80-84 36.976299999999995 38.0 38.0 38.0 35.8 38.0 85-89 36.81465000000001 38.0 38.0 38.0 35.2 38.0 90-94 36.6759 38.0 38.0 38.0 35.0 38.0 95-99 36.640049999999995 38.0 38.0 38.0 34.6 38.0 100-104 36.5928 38.0 38.0 38.0 34.4 38.0 105-109 36.3027 38.0 38.0 38.0 34.0 38.0 110-114 36.248450000000005 38.0 38.0 38.0 34.0 38.0 115-119 36.07275 38.0 37.4 38.0 33.0 38.0 120-124 35.8821 38.0 37.0 38.0 32.6 38.0 125-129 35.7208 38.0 36.8 38.0 31.4 38.0 130-134 35.49045 38.0 36.0 38.0 31.0 38.0 135-139 35.24235 38.0 36.0 38.0 30.6 38.0 140-144 34.9288 38.0 36.0 38.0 28.2 38.0 145-149 34.45195 38.0 35.4 38.0 27.2 38.0 150-151 31.380499999999998 36.5 31.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 1.0 11 1.0 12 0.0 13 1.0 14 1.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 7.0 21 8.0 22 6.0 23 15.0 24 7.0 25 14.0 26 13.0 27 18.0 28 22.0 29 23.0 30 46.0 31 60.0 32 51.0 33 100.0 34 148.0 35 296.0 36 681.0 37 2480.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.769828926905134 20.11404872991187 13.011923276308968 31.104199066874028 2 18.8 24.925 36.875 19.400000000000002 3 17.65 31.025000000000002 28.1 23.225 4 20.9 35.825 23.5 19.775000000000002 5 20.605151287821954 36.75918979744936 23.005751437859466 19.629907476869217 6 16.625 37.15 24.725 21.5 7 13.425 19.900000000000002 46.75 19.925 8 17.45 20.974999999999998 28.325 33.25 9 18.375 22.225 30.3 29.099999999999998 10-14 18.755 30.59 26.755000000000003 23.9 15-19 19.2 28.665000000000003 27.91 24.224999999999998 20-24 19.62 28.965000000000003 27.794999999999998 23.62 25-29 18.98 29.509999999999998 27.855 23.655 30-34 19.505 29.225 27.905 23.365 35-39 19.205 29.575000000000003 27.560000000000002 23.66 40-44 20.095 29.044999999999998 27.689999999999998 23.169999999999998 45-49 19.3 29.145 27.675 23.880000000000003 50-54 19.556917512307848 28.694865869587062 27.790615894705113 23.95760072339998 55-59 19.198204631235335 29.531775986942773 27.67520146893808 23.594817912883812 60-64 19.17450103061686 29.3097380724951 27.886984063144137 23.628776833743903 65-69 19.857907639965976 28.708660629409117 27.55290939110422 23.880522339520688 70-74 19.485 29.07 27.91 23.535 75-79 19.615 28.945 27.87 23.57 80-84 19.835 28.975 27.71 23.48 85-89 20.395 28.63 27.62 23.355 90-94 19.785 29.299999999999997 27.46 23.455000000000002 95-99 20.36 28.1 28.17 23.369999999999997 100-104 20.52218276396739 28.610013504726655 27.299554844195466 23.56824888711049 105-109 20.539075440445718 28.705516237514427 27.310144054610248 23.445264267429604 110-114 20.658263305322127 28.7515006002401 27.265906362545017 23.324329731892757 115-119 20.694659926930584 28.88243831640058 27.035683899704722 23.387217856964114 120-124 20.365 29.38 27.435 22.82 125-129 20.43 28.665000000000003 27.41 23.494999999999997 130-134 20.200000000000003 29.330000000000002 26.58 23.89 135-139 20.580000000000002 28.28 27.68 23.46 140-144 20.595 28.660000000000004 26.810000000000002 23.935000000000002 145-149 21.015 29.025000000000002 26.435 23.525 150-151 20.94070552914686 28.621466099574683 26.394796097072803 24.043032274205654 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.0 22 0.0 23 1.0 24 5.0 25 6.5 26 6.0 27 12.5 28 17.5 29 20.5 30 24.0 31 38.5 32 49.0 33 56.0 34 66.0 35 79.0 36 107.5 37 129.5 38 134.0 39 168.5 40 217.0 41 237.0 42 253.5 43 276.0 44 287.5 45 265.0 46 241.0 47 233.0 48 210.5 49 184.5 50 153.0 51 128.5 52 106.0 53 72.0 54 55.0 55 42.0 56 31.0 57 23.0 58 12.5 59 6.5 60 8.0 61 8.5 62 6.5 63 5.5 64 6.0 65 3.5 66 0.5 67 0.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.55 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.47000000000000003 55-59 1.97 60-64 0.545 65-69 0.065 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.034999999999999996 105-109 0.385 110-114 0.04 115-119 0.095 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1625 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.3625 0.0 0.0 0.0 0.0 90-91 0.42500000000000004 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.7375 0.0 0.0 0.0 0.0 96-97 0.9 0.0 0.0 0.0 0.0 98-99 0.95 0.0 0.0 0.0 0.0 100-101 1.1375 0.0 0.0 0.0 0.0 102-103 1.2875 0.0 0.0 0.0 0.0 104-105 1.5625 0.0 0.0 0.0 0.0 106-107 1.9500000000000002 0.0 0.0 0.0 0.0 108-109 2.2750000000000004 0.0 0.0 0.0 0.0 110-111 2.5 0.0 0.0 0.0 0.0 112-113 2.7874999999999996 0.0 0.0 0.0 0.0 114-115 3.3125 0.0 0.0 0.0 0.0 116-117 3.925 0.0 0.0 0.0 0.0 118-119 4.4625 0.0 0.0 0.0 0.0 120-121 4.7875 0.0 0.0 0.0 0.0 122-123 5.2375 0.0 0.0 0.0 0.0 124-125 5.737500000000001 0.0 0.0 0.0 0.0 126-127 6.175000000000001 0.0 0.0 0.0 0.0 128-129 6.8625 0.0 0.0 0.0 0.0 130-131 7.35 0.0 0.0 0.0 0.0 132-133 7.95 0.0 0.0 0.0 0.0 134-135 8.625 0.0 0.0 0.0 0.0 136-137 9.2 0.0 0.0 0.0 0.0 138-139 9.962499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATCTGC 10 0.006832588 144.9875 5 GATCTTG 10 0.006832588 144.9875 5 >>END_MODULE SRR7166155 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166155_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.899 33.0 33.0 34.0 32.0 34.0 2 33.02275 34.0 33.0 34.0 32.0 34.0 3 32.997 34.0 33.0 34.0 32.0 34.0 4 32.98625 34.0 33.0 34.0 32.0 34.0 5 32.9865 34.0 33.0 34.0 32.0 34.0 6 37.1615 38.0 38.0 38.0 37.0 38.0 7 37.2515 38.0 38.0 38.0 37.0 38.0 8 37.17325 38.0 38.0 38.0 37.0 38.0 9 37.09625 38.0 38.0 38.0 37.0 38.0 10-14 37.1736 38.0 38.0 38.0 37.0 38.0 15-19 37.10850000000001 38.0 38.0 38.0 36.8 38.0 20-24 37.085950000000004 38.0 38.0 38.0 36.8 38.0 25-29 37.01825 38.0 38.0 38.0 36.0 38.0 30-34 36.970549999999996 38.0 38.0 38.0 36.2 38.0 35-39 36.873149999999995 38.0 38.0 38.0 36.0 38.0 40-44 36.847899999999996 38.0 38.0 38.0 36.0 38.0 45-49 36.69965 38.0 38.0 38.0 35.4 38.0 50-54 36.585750000000004 38.0 38.0 38.0 34.8 38.0 55-59 36.544799999999995 38.0 38.0 38.0 34.6 38.0 60-64 36.614250000000006 38.0 38.0 38.0 34.8 38.0 65-69 36.5826 38.0 38.0 38.0 35.0 38.0 70-74 36.46595 38.0 38.0 38.0 34.0 38.0 75-79 36.31055 38.0 38.0 38.0 34.0 38.0 80-84 36.35935 38.0 38.0 38.0 34.0 38.0 85-89 36.2279 38.0 38.0 38.0 34.0 38.0 90-94 36.04205 38.0 38.0 38.0 33.4 38.0 95-99 35.80545 38.0 37.2 38.0 31.6 38.0 100-104 35.7638 38.0 37.0 38.0 32.4 38.0 105-109 35.54540000000001 38.0 37.0 38.0 31.0 38.0 110-114 35.315549999999995 38.0 37.0 38.0 30.2 38.0 115-119 35.0525 38.0 36.2 38.0 28.4 38.0 120-124 34.8189 38.0 36.0 38.0 27.6 38.0 125-129 34.51445 38.0 35.2 38.0 26.2 38.0 130-134 34.165800000000004 38.0 35.0 38.0 23.6 38.0 135-139 33.85875 38.0 35.0 38.0 22.2 38.0 140-144 33.356849999999994 38.0 34.2 38.0 17.8 38.0 145-149 32.66315 38.0 33.8 38.0 13.8 38.0 150-151 28.610625 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 4.0 4 1.0 5 2.0 6 1.0 7 1.0 8 2.0 9 4.0 10 1.0 11 2.0 12 0.0 13 0.0 14 3.0 15 4.0 16 8.0 17 4.0 18 10.0 19 11.0 20 10.0 21 7.0 22 13.0 23 17.0 24 20.0 25 26.0 26 26.0 27 27.0 28 25.0 29 33.0 30 47.0 31 57.0 32 68.0 33 124.0 34 182.0 35 275.0 36 698.0 37 2278.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.275 16.75 14.549999999999999 26.424999999999997 2 23.95 22.05 37.3 16.7 3 21.3 25.224999999999998 32.95 20.525 4 23.599999999999998 34.575 22.15 19.675 5 22.525000000000002 37.225 23.575 16.675 6 18.39799749687109 37.77221526908636 24.55569461827284 19.27409261576971 7 16.795994993742177 16.345431789737173 45.98247809762203 20.876095118898625 8 20.32540675844806 22.002503128911137 28.360450563204004 29.311639549436798 9 21.752190237797247 24.055068836045056 28.46057571964956 25.732165206508135 10-14 22.629892882170388 29.117028731604766 27.320052057262988 20.93302632896186 15-19 22.91791791791792 28.163163163163162 28.353353353353356 20.565565565565567 20-24 22.716580751714126 28.897452579950954 27.916520694659923 20.46944597367499 25-29 23.09887359198999 28.28035043804756 28.430538172715895 20.190237797246557 30-34 23.32415519399249 27.614518147684606 28.846057571964955 20.21526908635795 35-39 23.309136420525654 28.130162703379224 28.39549436795995 20.16520650813517 40-44 23.267921505806967 28.484181017220667 27.948538245895072 20.299359231077293 45-49 23.654568210262827 27.95994993742178 28.370463078848562 20.015018773466835 50-54 23.009115496343785 28.633677251327256 28.187919463087248 20.16928778924171 55-59 23.67959949937422 28.28535669586984 28.075093867334168 19.95994993742178 60-64 23.664580725907385 28.105131414267838 28.14518147684606 20.085106382978722 65-69 23.79355226271526 27.563075690829 28.62434921906288 20.01902282739287 70-74 23.981764440659287 27.889384299383796 28.791142728320224 19.33770853163669 75-79 23.821451831070586 28.159911828064725 28.26010720905766 19.758529131807023 80-84 23.075381918357124 27.92887553218132 28.95066366140746 20.045078888054093 85-89 23.659574468085108 28.991239048811014 27.50938673341677 19.83979974968711 90-94 23.561808441395886 28.313222850848646 28.288189055224557 19.836779652530918 95-99 23.367387820512818 27.869591346153843 28.665865384615387 20.09715544871795 100-104 23.402763869417186 28.575005007009814 28.239535349489287 19.782695774083717 105-109 24.20768036849747 28.283182296099735 28.13297952235518 19.376157813047616 110-114 23.895843765648472 28.5778668002003 28.207310966449672 19.31897846770155 115-119 24.40112258193846 28.345193946075973 27.553372757341887 19.70031071464368 120-124 24.43609022556391 27.819548872180448 28.52631578947368 19.218045112781958 125-129 24.670574678090084 27.626634600931908 27.611603787764917 20.091186933213088 130-134 25.404295799329095 27.582236018625146 27.427026485755768 19.58644169628999 135-139 25.53191489361702 28.265331664580728 27.389236545682106 18.81351689612015 140-144 25.586983729662077 27.879849812265334 27.424280350438046 19.108886107634543 145-149 25.33166458072591 28.730913642052563 27.183979974968707 18.753441802252816 150-151 25.86616635397123 28.117573483427144 27.15447154471545 18.86178861788618 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 1.0 3 0.5 4 1.0 5 1.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 1.0 23 2.5 24 2.5 25 1.5 26 3.5 27 6.0 28 7.5 29 13.0 30 22.5 31 26.5 32 34.0 33 49.5 34 63.5 35 73.5 36 88.5 37 109.5 38 135.5 39 181.0 40 221.0 41 244.0 42 260.0 43 277.5 44 282.5 45 273.5 46 270.5 47 252.5 48 212.0 49 178.0 50 155.0 51 134.5 52 112.0 53 80.0 54 52.5 55 36.0 56 32.0 57 30.0 58 21.0 59 12.5 60 10.0 61 7.0 62 4.5 63 5.5 64 4.5 65 2.5 66 1.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.125 7 0.125 8 0.125 9 0.125 10-14 0.11 15-19 0.1 20-24 0.095 25-29 0.125 30-34 0.125 35-39 0.125 40-44 0.12 45-49 0.125 50-54 0.16999999999999998 55-59 0.125 60-64 0.125 65-69 0.12 70-74 0.19499999999999998 75-79 0.19499999999999998 80-84 0.17500000000000002 85-89 0.125 90-94 0.135 95-99 0.16 100-104 0.13999999999999999 105-109 0.135 110-114 0.15 115-119 0.22999999999999998 120-124 0.25 125-129 0.20500000000000002 130-134 0.135 135-139 0.125 140-144 0.125 145-149 0.125 150-151 0.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59778783308195 99.05000000000001 2 0.301659125188537 0.6 3 0.07541478129713425 0.22499999999999998 4 0.0 0.0 5 0.025138260432378077 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCCTATTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1625 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.3625 0.0 0.0 0.0 0.0 90-91 0.42500000000000004 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.7375 0.0 0.0 0.0 0.0 96-97 0.9 0.0 0.0 0.0 0.0 98-99 0.95 0.0 0.0 0.0 0.0 100-101 1.1375 0.0 0.0 0.0 0.0 102-103 1.2875 0.0 0.0 0.0 0.0 104-105 1.5625 0.0 0.0 0.0 0.0 106-107 1.9500000000000002 0.0 0.0 0.0 0.0 108-109 2.2625 0.0 0.0 0.0 0.0 110-111 2.4749999999999996 0.0 0.0 0.0 0.0 112-113 2.775 0.0 0.0 0.0 0.0 114-115 3.3125 0.0 0.0 0.0 0.0 116-117 3.875 0.0 0.0 0.0 0.0 118-119 4.4125 0.0 0.0 0.0 0.0 120-121 4.737500000000001 0.0 0.0 0.0 0.0 122-123 5.15 0.0 0.0 0.0 0.0 124-125 5.637499999999999 0.0 0.0 0.0 0.0 126-127 6.0875 0.0 0.0 0.0 0.0 128-129 6.7875 0.0 0.0 0.0 0.0 130-131 7.275 0.0 0.0 0.0 0.0 132-133 7.875 0.0 0.0 0.0 0.0 134-135 8.5625 0.0 0.0 0.0 0.0 136-137 9.149999999999999 0.0 0.0 0.0 0.0 138-139 9.912500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAAGCT 10 0.006830828 145.0 1 ACCCTAG 10 0.006830828 145.0 5 TGTACCA 10 0.006830828 145.0 7 >>END_MODULE Read 831865 spots for SRR7166155.sra Written 831865 spots for SRR7166155.sra Read 831865 spots for SRR7166155.sra Written 831865 spots for SRR7166155.sra Read 831872 spots for SRR7166155.sra Written 831872 spots for SRR7166155.sra Read 831865 spots for SRR7166155.sra Written 831865 spots for SRR7166155.sra Read 831865 spots for SRR7166155.sra Written 831865 spots for SRR7166155.sra Read 831865 spots for SRR7166155.sra Written 831865 spots for SRR7166155.sra Read 831865 spots for SRR7166155.sra Written 831865 spots for SRR7166155.sra Read 831865 spots for SRR7166155.sra Written 831865 spots for SRR7166155.sra Read 831865 spots for SRR7166155.sra Written 831865 spots for SRR7166155.sra Read 831865 spots for SRR7166155.sra Written 831865 spots for SRR7166155.sra Read 831865 spots for SRR7166155.sra Written 831865 spots for SRR7166155.sra Read 831865 spots for SRR7166155.sra Written 831865 spots for SRR7166155.sra Read 831865 spots for SRR7166155.sra Written 831865 spots for SRR7166155.sra Read 831865 spots for SRR7166155.sra Written 831865 spots for SRR7166155.sra Read 831865 spots for SRR7166155.sra Written 831865 spots for SRR7166155.sra Read 831865 spots for SRR7166155.sra Written 831865 spots for SRR7166155.sra Read 831865 spots for SRR7166155.sra Written 831865 spots for SRR7166155.sra Read 831865 spots for SRR7166155.sra Written 831865 spots for SRR7166155.sra Read 831865 spots for SRR7166155.sra Written 831865 spots for SRR7166155.sra Read 831865 spots for SRR7166155.sra Written 831865 spots for SRR7166155.sra SRR ids: ['SRR7166155.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6ysn5_ik SRR7166155.sra spots: 16637307 blocks: [[1, 831865], [831866, 1663730], [1663731, 2495595], [2495596, 3327460], [3327461, 4159325], [4159326, 4991190], [4991191, 5823055], [5823056, 6654920], [6654921, 7486785], [7486786, 8318650], [8318651, 9150515], [9150516, 9982380], [9982381, 10814245], [10814246, 11646110], [11646111, 12477975], [12477976, 13309840], [13309841, 14141705], [14141706, 14973570], [14973571, 15805435], [15805436, 16637307]] SRR7166155 file size 5616137 SRR7166155 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166155 SRR7166155_1.fastq SRR7166155_2.fastq Input file: SRR7166155_1.fastq Paired file: SRR7166155_2.fastq trimmed: SRR7166155-trimmed-pair1.fastq, SRR7166155-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 18:52:19 2025 >> started Fri Feb 14 18:52:54 2025 >> done (34.239s) 16637307 read pairs processed; of these: 17133 ( 0.10%) short read pairs filtered out after trimming by size control 12739 ( 0.08%) empty read pairs filtered out after trimming by size control 16607435 (99.82%) read pairs available; of these: 7901406 (47.58%) trimmed read pairs available after processing 8706029 (52.42%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 3 0.00% 20 12 0.00% 21 6 0.00% 22 6 0.00% 23 9 0.00% 24 5 0.00% 25 9 0.00% 26 4 0.00% 27 4 0.00% 28 8 0.00% 29 7 0.00% 30 9 0.00% 31 11 0.00% 32 8 0.00% 33 8 0.00% 34 9 0.00% 35 7 0.00% 36 17 0.00% 37 15 0.00% 38 25 0.00% 39 18 0.00% 40 15 0.00% 41 26 0.00% 42 23 0.00% 43 28 0.00% 44 28 0.00% 45 23 0.00% 46 43 0.00% 47 50 0.00% 48 50 0.00% 49 68 0.00% 50 75 0.00% 51 93 0.00% 52 111 0.00% 53 108 0.00% 54 116 0.00% 55 122 0.00% 56 158 0.00% 57 176 0.00% 58 216 0.00% 59 269 0.00% 60 301 0.00% 61 339 0.00% 62 345 0.00% 63 436 0.00% 64 473 0.00% 65 503 0.00% 66 589 0.00% 67 687 0.00% 68 753 0.00% 69 881 0.01% 70 1021 0.01% 71 1193 0.01% 72 1516 0.01% 73 1577 0.01% 74 1813 0.01% 75 1976 0.01% 76 2231 0.01% 77 2442 0.01% 78 2725 0.02% 79 3136 0.02% 80 3510 0.02% 81 4007 0.02% 82 4945 0.03% 83 5681 0.03% 84 7229 0.04% 85 7369 0.04% 86 7908 0.05% 87 8465 0.05% 88 9014 0.05% 89 9783 0.06% 90 10584 0.06% 91 11809 0.07% 92 12883 0.08% 93 14118 0.09% 94 15611 0.09% 95 16177 0.10% 96 16581 0.10% 97 17263 0.10% 98 18310 0.11% 99 19629 0.12% 100 20202 0.12% 101 21504 0.13% 102 23508 0.14% 103 25515 0.15% 104 26844 0.16% 105 28437 0.17% 106 29009 0.17% 107 29890 0.18% 108 30533 0.18% 109 31653 0.19% 110 32686 0.20% 111 34620 0.21% 112 37309 0.22% 113 39427 0.24% 114 41529 0.25% 115 43420 0.26% 116 44918 0.27% 117 45884 0.28% 118 47069 0.28% 119 48030 0.29% 120 48417 0.29% 121 50597 0.30% 122 52757 0.32% 123 55692 0.34% 124 58628 0.35% 125 60995 0.37% 126 63133 0.38% 127 64491 0.39% 128 64616 0.39% 129 66257 0.40% 130 67735 0.41% 131 69216 0.42% 132 73000 0.44% 133 77164 0.46% 134 80900 0.49% 135 84939 0.51% 136 87699 0.53% 137 91991 0.55% 138 95413 0.57% 139 99168 0.60% 140 103493 0.62% 141 111143 0.67% 142 119192 0.72% 143 129974 0.78% 144 148011 0.89% 145 170675 1.03% 146 205161 1.24% 147 262206 1.58% 148 379446 2.28% 149 695325 4.19% 150 3234169 19.47% 151 8706029 52.42% 16607435 reads passed initial QC criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=24 prefix-density=0.60 prefix-fanout=2.0 sequence=CAGGTGCAGTTTGATCCACA criterion=fanout-score sequence-density=0.16 sequence-density-rank=16 fanout-score=22.03 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=8.8 sequence=ACACCAGCAATGATTGT criterion=sequence-density sequence-density=0.77 sequence-density-rank=1 fanout-score=3.49 fanout-score-rank=12 prefix-density=0.78 prefix-fanout=3.4 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.10 sequence-density-rank=23 fanout-score=31.24 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=10.4 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7166155 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 18:53:51 Started mapping on | Feb 14 18:53:51 Finished on | Feb 14 18:55:29 Mapping speed, Million of reads per hour | 610.07 Number of input reads | 16607435 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 15718617 Uniquely mapped reads % | 94.65% Average mapped length | 291.00 Number of splices: Total | 14975814 Number of splices: Annotated (sjdb) | 14648076 Number of splices: GT/AG | 14728800 Number of splices: GC/AG | 188953 Number of splices: AT/AC | 12883 Number of splices: Non-canonical | 45178 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.04% Deletion average length | 2.27 Insertion rate per base | 0.02% Insertion average length | 2.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 419928 % of reads mapped to multiple loci | 2.53% Number of reads mapped to too many loci | 73838 % of reads mapped to too many loci | 0.44% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.26% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 485235 485235 485235 N_multimapping 419928 419928 419928 N_noFeature 576075 15524621 685721 N_ambiguous 158884 903 74006 UnstrandedReadsAssigned:14983658 PositiveStrandReadsAssigned:193093 NegativeStrandReadsAssigned:14958890 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7166155 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166155-trimmed-pair1.fastq SRR7166155-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,607,435 reads, 14,870,534 reads pseudoaligned [quant] estimated average fragment length: 226.255 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,061 rounds 52401 SRR7166155.ke.tsv 34699 SRR7166155.se.tsv 87100 total ==> SRR7166155.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1792.75 1235 41.4023 Potri.005G024800.1.v4.1 1035 809.745 277 20.5593 Potri.004G059700.1.v4.1 961 735.784 43 3.51232 Potri.007G009000.2.v4.1 1416 1190.75 0 0 Potri.003G141000.2.v4.1 2943 2717.75 510.189 11.2823 Potri.016G087400.1.v4.1 270 91.1947 1040.18 685.514 Potri.015G069301.1.v4.1 564 344.461 0 0 Potri.010G195200.1.v4.1 1773 1547.75 516.846 20.0696 Potri.012G127500.1.v4.1 977 751.765 7955 635.967 ==> SRR7166155.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 75 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 797 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 424 SRR7166155 completed mapping pipeline successfully