Starting /dee2/code/volunteer_pipeline.sh SRR7166156 current disk space = 3111674036224 free memory = 1414107100 SRR7166156 SRAfilesize 83e4d90ec22088f87e191032e9d98c19 SRR7166156.sra SRR7166156.sra file validated SRR7166156 is paired end SRR7166156 is conventional basespace SRR7166156 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166156_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.79025 33.0 32.0 34.0 25.0 34.0 2 32.60575 33.0 33.0 34.0 31.0 34.0 3 32.6545 33.0 33.0 34.0 31.0 34.0 4 33.0335 34.0 33.0 34.0 32.0 34.0 5 33.18325 34.0 33.0 34.0 32.0 34.0 6 37.0415 38.0 37.0 38.0 36.0 38.0 7 37.41875 38.0 38.0 38.0 37.0 38.0 8 37.4875 38.0 38.0 38.0 37.0 38.0 9 37.50525 38.0 38.0 38.0 37.0 38.0 10-14 37.46640000000001 38.0 38.0 38.0 37.0 38.0 15-19 37.467650000000006 38.0 38.0 38.0 37.2 38.0 20-24 37.4755 38.0 38.0 38.0 37.0 38.0 25-29 37.41165 38.0 38.0 38.0 37.0 38.0 30-34 37.36970000000001 38.0 38.0 38.0 37.0 38.0 35-39 37.33815 38.0 38.0 38.0 37.0 38.0 40-44 37.2709 38.0 38.0 38.0 36.8 38.0 45-49 37.314 38.0 38.0 38.0 37.0 38.0 50-54 37.143950000000004 38.0 38.0 38.0 36.6 38.0 55-59 36.792649999999995 38.0 38.0 38.0 36.0 38.0 60-64 36.9307 38.0 38.0 38.0 36.0 38.0 65-69 37.042950000000005 38.0 38.0 38.0 36.0 38.0 70-74 37.0269 38.0 38.0 38.0 36.0 38.0 75-79 36.8929 38.0 38.0 38.0 35.6 38.0 80-84 36.751549999999995 38.0 38.0 38.0 34.8 38.0 85-89 36.5739 38.0 38.0 38.0 34.4 38.0 90-94 36.6062 38.0 38.0 38.0 34.2 38.0 95-99 36.44525 38.0 38.0 38.0 34.0 38.0 100-104 36.3434 38.0 38.0 38.0 34.0 38.0 105-109 36.075149999999994 38.0 37.2 38.0 33.2 38.0 110-114 36.1974 38.0 37.6 38.0 33.6 38.0 115-119 35.77535 38.0 37.0 38.0 31.4 38.0 120-124 35.4446 38.0 36.4 38.0 29.8 38.0 125-129 35.4009 38.0 36.2 38.0 30.2 38.0 130-134 35.351150000000004 38.0 36.0 38.0 30.6 38.0 135-139 34.98325 38.0 36.0 38.0 28.0 38.0 140-144 34.71065 38.0 35.4 38.0 27.8 38.0 145-149 34.15035 38.0 35.0 38.0 25.0 38.0 150-151 30.800875 36.5 29.5 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 3.0 18 0.0 19 4.0 20 5.0 21 4.0 22 11.0 23 11.0 24 8.0 25 15.0 26 24.0 27 16.0 28 23.0 29 40.0 30 56.0 31 46.0 32 68.0 33 112.0 34 157.0 35 271.0 36 616.0 37 2506.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.348228043143294 18.69542886492039 9.65588084232152 45.300462249614796 2 16.900000000000002 25.424999999999997 44.074999999999996 13.600000000000001 3 16.475 29.425 27.425 26.674999999999997 4 19.650000000000002 36.4 22.275 21.675 5 20.655163790947736 37.78444611152788 22.58064516129032 18.97974493623406 6 16.775000000000002 36.55 24.349999999999998 22.325 7 12.45 20.125 46.2 21.224999999999998 8 17.2 19.650000000000002 30.975 32.175 9 17.724999999999998 20.549999999999997 31.574999999999996 30.15 10-14 19.08 30.23 26.174999999999997 24.515 15-19 19.744999999999997 28.610000000000003 27.275 24.37 20-24 19.605 28.125 28.305000000000003 23.965 25-29 19.33 28.65 28.27 23.75 30-34 19.78 28.439999999999998 27.955000000000002 23.825 35-39 19.869999999999997 28.994999999999997 27.075 24.060000000000002 40-44 20.015 28.93 27.32 23.735 45-49 19.74 28.335 27.77 24.154999999999998 50-54 20.138366671679954 28.761217225647968 27.23717852308618 23.863237579585903 55-59 19.872669395179628 28.507907634783486 27.99757465514628 23.621848314890606 60-64 19.99298491757278 28.957258104925586 27.33376760034073 23.715989377160895 65-69 20.45 27.994999999999997 27.88 23.674999999999997 70-74 20.235 28.78 27.900000000000002 23.085 75-79 20.225 28.655 27.68 23.44 80-84 19.74 28.645 27.79 23.825 85-89 20.02 28.24 27.99 23.75 90-94 20.195 28.470000000000002 27.045 24.29 95-99 20.315 28.13 27.595 23.96 100-104 20.32 28.535 27.534999999999997 23.61 105-109 20.335923790423667 28.22762597142141 27.259964903484583 24.176485334670346 110-114 20.765 27.975 27.534999999999997 23.724999999999998 115-119 20.8 28.050000000000004 27.445000000000004 23.705000000000002 120-124 20.515 28.384999999999998 26.784999999999997 24.315 125-129 20.830000000000002 28.749999999999996 26.935 23.485 130-134 21.015 28.475 26.57 23.94 135-139 20.855 28.410000000000004 26.735 24.0 140-144 21.07 28.64 26.41 23.880000000000003 145-149 20.805 28.599999999999998 26.305 24.29 150-151 20.545204451669377 29.310991621858197 26.2348380642741 23.908965862198325 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.0 25 2.5 26 8.0 27 9.0 28 9.5 29 16.0 30 20.0 31 27.0 32 37.5 33 50.0 34 70.5 35 83.5 36 85.5 37 103.0 38 136.5 39 163.5 40 193.0 41 228.5 42 258.0 43 271.5 44 272.0 45 272.5 46 265.0 47 241.5 48 213.0 49 193.5 50 176.0 51 150.5 52 114.0 53 86.5 54 65.5 55 44.0 56 33.0 57 27.5 58 20.5 59 12.0 60 9.5 61 7.0 62 5.0 63 5.5 64 4.5 65 2.0 66 0.0 67 1.0 68 2.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.65 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.265 55-59 1.045 60-64 0.215 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.27499999999999997 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.45 0.0 0.0 0.0 0.0 92-93 0.5 0.0 0.0 0.0 0.0 94-95 0.675 0.0 0.0 0.0 0.0 96-97 0.8999999999999999 0.0 0.0 0.0 0.0 98-99 1.1124999999999998 0.0 0.0 0.0 0.0 100-101 1.3 0.0 0.0 0.0 0.0 102-103 1.6 0.0 0.0 0.0 0.0 104-105 1.7875 0.0 0.0 0.0 0.0 106-107 1.9375 0.0 0.0 0.0 0.0 108-109 2.3 0.0 0.0 0.0 0.0 110-111 2.4625 0.0 0.0 0.0 0.0 112-113 2.6625 0.0 0.0 0.0 0.0 114-115 2.95 0.0 0.0 0.0 0.0 116-117 3.3875 0.0 0.0 0.0 0.0 118-119 3.7625 0.0 0.0 0.0 0.0 120-121 4.0875 0.0 0.0 0.0 0.0 122-123 4.512499999999999 0.0 0.0 0.0 0.0 124-125 4.9 0.0 0.0 0.0 0.0 126-127 5.45 0.0 0.0 0.0 0.0 128-129 5.9625 0.0 0.0 0.0 0.0 130-131 6.5875 0.0 0.0 0.0 0.0 132-133 7.1625 0.0 0.0 0.0 0.0 134-135 7.8625 0.0 0.0 0.0 0.0 136-137 8.412500000000001 0.0 0.0 0.0 0.0 138-139 9.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7166156 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166156_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.96025 33.0 33.0 34.0 32.0 34.0 2 33.0505 34.0 33.0 34.0 32.0 34.0 3 33.125 34.0 33.0 34.0 32.0 34.0 4 33.147 34.0 33.0 34.0 33.0 34.0 5 33.0815 34.0 33.0 34.0 33.0 34.0 6 37.2945 38.0 38.0 38.0 37.0 38.0 7 37.3375 38.0 38.0 38.0 37.0 38.0 8 37.1965 38.0 38.0 38.0 37.0 38.0 9 37.26725 38.0 38.0 38.0 37.0 38.0 10-14 37.2438 38.0 38.0 38.0 37.0 38.0 15-19 37.21920000000001 38.0 38.0 38.0 37.0 38.0 20-24 37.1406 38.0 38.0 38.0 36.6 38.0 25-29 37.1011 38.0 38.0 38.0 36.4 38.0 30-34 37.03895 38.0 38.0 38.0 36.0 38.0 35-39 36.96815 38.0 38.0 38.0 36.0 38.0 40-44 36.9297 38.0 38.0 38.0 36.0 38.0 45-49 36.7396 38.0 38.0 38.0 35.2 38.0 50-54 36.68575 38.0 38.0 38.0 35.0 38.0 55-59 36.56869999999999 38.0 38.0 38.0 34.2 38.0 60-64 36.59205000000001 38.0 38.0 38.0 34.6 38.0 65-69 36.546749999999996 38.0 38.0 38.0 34.4 38.0 70-74 36.4914 38.0 38.0 38.0 34.2 38.0 75-79 36.258849999999995 38.0 38.0 38.0 33.8 38.0 80-84 36.21995 38.0 38.0 38.0 33.4 38.0 85-89 36.10045 38.0 37.2 38.0 33.2 38.0 90-94 35.89515 38.0 37.0 38.0 32.2 38.0 95-99 35.74735 38.0 37.0 38.0 31.0 38.0 100-104 35.4722 38.0 36.8 38.0 29.8 38.0 105-109 35.3103 38.0 36.6 38.0 29.0 38.0 110-114 35.080200000000005 38.0 36.0 38.0 28.0 38.0 115-119 34.7728 38.0 35.4 38.0 26.8 38.0 120-124 34.482899999999994 38.0 35.0 38.0 26.0 38.0 125-129 34.3232 38.0 35.0 38.0 24.2 38.0 130-134 33.75705000000001 38.0 34.6 38.0 19.8 38.0 135-139 33.205600000000004 38.0 34.0 38.0 16.2 38.0 140-144 32.66665 38.0 33.4 38.0 14.0 38.0 145-149 31.237099999999998 37.0 31.4 38.0 8.6 38.0 150-151 26.894375 33.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 1.0 5 3.0 6 3.0 7 2.0 8 0.0 9 1.0 10 2.0 11 2.0 12 2.0 13 2.0 14 4.0 15 1.0 16 2.0 17 9.0 18 14.0 19 6.0 20 11.0 21 6.0 22 14.0 23 16.0 24 18.0 25 22.0 26 29.0 27 31.0 28 39.0 29 46.0 30 54.0 31 69.0 32 102.0 33 140.0 34 217.0 35 370.0 36 776.0 37 1983.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.375 14.674999999999999 12.425 43.525000000000006 2 21.475 22.575 42.225 13.725000000000001 3 18.525 24.625 32.775 24.075 4 22.95 34.625 21.025 21.4 5 22.925 38.550000000000004 21.6 16.925 6 17.30432608152038 37.98449612403101 24.23105776444111 20.4801200300075 7 15.878969742435608 15.27881970492623 46.33658414603651 22.50562640660165 8 18.404601150287572 20.005001250312578 29.557389347336834 32.03300825206302 9 21.655413853463365 21.230307576894223 30.307576894223555 26.806701675418854 10-14 21.18605930296515 28.046402320116005 28.056402820141006 22.71113555677784 15-19 23.12615630781539 27.806390319515977 27.69638481924096 21.371068553427673 20-24 22.53915828454186 28.639343441925636 27.428314066956915 21.39318420657559 25-29 22.714542908581716 27.800560112022403 28.21564312862572 21.269253850770152 30-34 22.97067360624562 27.509758782904616 28.125312781503354 21.394254829346412 35-39 22.38402642245909 28.239003152679775 28.434169043687135 20.942801381173997 40-44 23.01726294721041 27.840880660495372 28.00100075056292 21.1408556417313 45-49 22.98798798798799 27.932932932932935 27.872872872872872 21.206206206206208 50-54 23.131601341542773 27.65179956950493 28.42268608900235 20.793912999949942 55-59 23.40457480354372 27.664047249612096 27.75914710445968 21.172230842384504 60-64 23.180498548403243 28.436279907898687 27.400140154169588 20.983081389528483 65-69 23.099254216927775 27.68406827168527 27.85424695930727 21.362430552079683 70-74 23.18782539046856 27.948538245895072 27.6231477773328 21.240488586303563 75-79 23.211693447464583 28.147369474896127 27.897081643890477 20.743855433748813 80-84 23.447274911165607 27.77638756818978 28.31189630148641 20.4644412191582 85-89 24.046451096205825 27.14986485133647 27.745520072079287 21.058163980378417 90-94 23.26640965303159 27.817553697491615 28.153006558854454 20.76303009062234 95-99 24.111344748172627 27.726043857014123 27.535796535496143 20.626814859317115 100-104 24.003804565478575 27.858430116139367 27.748297957549056 20.389467360833 105-109 24.092706612604495 27.82700105120889 28.092306152074887 19.987986184111726 110-114 23.969756146412298 27.85539031595814 28.306043763457012 19.86880977417255 115-119 24.19007560963397 27.935506484402385 27.730208802764007 20.14420910319964 120-124 24.810938047778837 28.141433365052336 27.390193819802672 19.657434767366155 125-129 24.763430631352325 27.64231712812297 27.106593901767383 20.487658338757324 130-134 24.257747959745657 27.89766184348871 27.632303609873325 20.212286586892304 135-139 25.564399058917754 27.371477198778592 27.261350553136104 19.802773189167546 140-144 25.24024024024024 28.213213213213212 26.476476476476474 20.07007007007007 145-149 25.971165398478174 28.033640368442132 26.566880256307567 19.428313976772127 150-151 26.075537768884445 26.738369184592298 27.201100550275136 19.984992496248125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 1.0 16 1.0 17 0.5 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 1.0 24 1.5 25 2.5 26 4.5 27 4.5 28 5.0 29 8.0 30 16.0 31 22.0 32 25.0 33 32.0 34 40.5 35 59.5 36 74.5 37 92.5 38 135.5 39 170.5 40 197.0 41 219.5 42 255.0 43 297.0 44 293.5 45 276.5 46 265.0 47 244.5 48 238.0 49 211.0 50 161.5 51 131.5 52 119.0 53 101.0 54 72.5 55 53.5 56 41.0 57 28.5 58 24.0 59 21.5 60 12.0 61 6.5 62 6.5 63 6.0 64 3.5 65 2.5 66 2.0 67 2.0 68 2.0 69 1.0 70 0.0 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.025 8 0.025 9 0.025 10-14 0.005 15-19 0.005 20-24 0.08499999999999999 25-29 0.02 30-34 0.09 35-39 0.08499999999999999 40-44 0.075 45-49 0.1 50-54 0.11499999999999999 55-59 0.105 60-64 0.11 65-69 0.105 70-74 0.12 75-79 0.11499999999999999 80-84 0.095 85-89 0.11 90-94 0.135 95-99 0.13 100-104 0.12 105-109 0.11499999999999999 110-114 0.145 115-119 0.145 120-124 0.165 125-129 0.135 130-134 0.135 135-139 0.11499999999999999 140-144 0.1 145-149 0.12 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5227329816629 99.05000000000001 2 0.4772670183371013 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.07500000000000001 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.32499999999999996 0.0 0.0 0.0 0.0 90-91 0.45 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.675 0.0 0.0 0.0 0.0 96-97 0.8999999999999999 0.0 0.0 0.0 0.0 98-99 1.1124999999999998 0.0 0.0 0.0 0.0 100-101 1.3125 0.0 0.0 0.0 0.0 102-103 1.625 0.0 0.0 0.0 0.0 104-105 1.7875 0.0 0.0 0.0 0.0 106-107 1.9375 0.0 0.0 0.0 0.0 108-109 2.3125 0.0 0.0 0.0 0.0 110-111 2.4625 0.0 0.0 0.0 0.0 112-113 2.6625 0.0 0.0 0.0 0.0 114-115 2.925 0.0 0.0 0.0 0.0 116-117 3.3625 0.0 0.0 0.0 0.0 118-119 3.7375 0.0 0.0 0.0 0.0 120-121 4.0625 0.0 0.0 0.0 0.0 122-123 4.512499999999999 0.0 0.0 0.0 0.0 124-125 4.9 0.0 0.0 0.0 0.0 126-127 5.425 0.0 0.0 0.0 0.0 128-129 5.949999999999999 0.0 0.0 0.0 0.0 130-131 6.6 0.0 0.0 0.0 0.0 132-133 7.1625 0.0 0.0 0.0 0.0 134-135 7.8375 0.0 0.0 0.0 0.0 136-137 8.375 0.0 0.0 0.0 0.0 138-139 8.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1078675 spots for SRR7166156.sra Written 1078675 spots for SRR7166156.sra Read 1078675 spots for SRR7166156.sra Written 1078675 spots for SRR7166156.sra Read 1078675 spots for SRR7166156.sra Written 1078675 spots for SRR7166156.sra Read 1078675 spots for SRR7166156.sra Written 1078675 spots for SRR7166156.sra Read 1078675 spots for SRR7166156.sra Written 1078675 spots for SRR7166156.sra Read 1078675 spots for SRR7166156.sra Written 1078675 spots for SRR7166156.sra Read 1078675 spots for SRR7166156.sra Written 1078675 spots for SRR7166156.sra Read 1078675 spots for SRR7166156.sra Written 1078675 spots for SRR7166156.sra Read 1078675 spots for SRR7166156.sra Written 1078675 spots for SRR7166156.sra Read 1078675 spots for SRR7166156.sra Written 1078675 spots for SRR7166156.sra Read 1078675 spots for SRR7166156.sra Written 1078675 spots for SRR7166156.sra Read 1078675 spots for SRR7166156.sra Written 1078675 spots for SRR7166156.sra Read 1078675 spots for SRR7166156.sra Written 1078675 spots for SRR7166156.sra Read 1078675 spots for SRR7166156.sra Written 1078675 spots for SRR7166156.sra Read 1078675 spots for SRR7166156.sra Written 1078675 spots for SRR7166156.sra Read 1078688 spots for SRR7166156.sra Written 1078688 spots for SRR7166156.sra Read 1078675 spots for SRR7166156.sra Written 1078675 spots for SRR7166156.sra Read 1078675 spots for SRR7166156.sra Written 1078675 spots for SRR7166156.sra Read 1078675 spots for SRR7166156.sra Written 1078675 spots for SRR7166156.sra Read 1078675 spots for SRR7166156.sra Written 1078675 spots for SRR7166156.sra SRR ids: ['SRR7166156.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tmi2kz8j SRR7166156.sra spots: 21573513 blocks: [[1, 1078675], [1078676, 2157350], [2157351, 3236025], [3236026, 4314700], [4314701, 5393375], [5393376, 6472050], [6472051, 7550725], [7550726, 8629400], [8629401, 9708075], [9708076, 10786750], [10786751, 11865425], [11865426, 12944100], [12944101, 14022775], [14022776, 15101450], [15101451, 16180125], [16180126, 17258800], [17258801, 18337475], [18337476, 19416150], [19416151, 20494825], [20494826, 21573513]] SRR7166156 file size 7288855 SRR7166156 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166156 SRR7166156_1.fastq SRR7166156_2.fastq Input file: SRR7166156_1.fastq Paired file: SRR7166156_2.fastq trimmed: SRR7166156-trimmed-pair1.fastq, SRR7166156-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 17:01:24 2025 >> started Fri Feb 14 17:01:54 2025 >> done (30.048s) 21573513 read pairs processed; of these: 11402 ( 0.05%) short read pairs filtered out after trimming by size control 5990 ( 0.03%) empty read pairs filtered out after trimming by size control 21556121 (99.92%) read pairs available; of these: 10237248 (47.49%) trimmed read pairs available after processing 11318873 (52.51%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 7 0.00% 20 13 0.00% 21 10 0.00% 22 20 0.00% 23 6 0.00% 24 9 0.00% 25 15 0.00% 26 12 0.00% 27 17 0.00% 28 15 0.00% 29 17 0.00% 30 15 0.00% 31 15 0.00% 32 14 0.00% 33 12 0.00% 34 14 0.00% 35 18 0.00% 36 15 0.00% 37 11 0.00% 38 21 0.00% 39 20 0.00% 40 16 0.00% 41 31 0.00% 42 25 0.00% 43 26 0.00% 44 36 0.00% 45 46 0.00% 46 29 0.00% 47 52 0.00% 48 55 0.00% 49 65 0.00% 50 68 0.00% 51 95 0.00% 52 99 0.00% 53 118 0.00% 54 130 0.00% 55 128 0.00% 56 169 0.00% 57 188 0.00% 58 224 0.00% 59 286 0.00% 60 282 0.00% 61 348 0.00% 62 366 0.00% 63 449 0.00% 64 491 0.00% 65 554 0.00% 66 587 0.00% 67 751 0.00% 68 843 0.00% 69 915 0.00% 70 1022 0.00% 71 1228 0.01% 72 1424 0.01% 73 1665 0.01% 74 1860 0.01% 75 2081 0.01% 76 2263 0.01% 77 2634 0.01% 78 2889 0.01% 79 3480 0.02% 80 3942 0.02% 81 4267 0.02% 82 5214 0.02% 83 5955 0.03% 84 8145 0.04% 85 7692 0.04% 86 7771 0.04% 87 8712 0.04% 88 9484 0.04% 89 10495 0.05% 90 11777 0.05% 91 12485 0.06% 92 13885 0.06% 93 15083 0.07% 94 16361 0.08% 95 17670 0.08% 96 18621 0.09% 97 19354 0.09% 98 21160 0.10% 99 23804 0.11% 100 23682 0.11% 101 25153 0.12% 102 27334 0.13% 103 28868 0.13% 104 30638 0.14% 105 32394 0.15% 106 34089 0.16% 107 35301 0.16% 108 36500 0.17% 109 38077 0.18% 110 39774 0.18% 111 41831 0.19% 112 43736 0.20% 113 46634 0.22% 114 48685 0.23% 115 50834 0.24% 116 52325 0.24% 117 54029 0.25% 118 55487 0.26% 119 57298 0.27% 120 58854 0.27% 121 61727 0.29% 122 62861 0.29% 123 66216 0.31% 124 69153 0.32% 125 72139 0.33% 126 74404 0.35% 127 75841 0.35% 128 78490 0.36% 129 80712 0.37% 130 83015 0.39% 131 86436 0.40% 132 89919 0.42% 133 93857 0.44% 134 98324 0.46% 135 101789 0.47% 136 106630 0.49% 137 111037 0.52% 138 117282 0.54% 139 123506 0.57% 140 130632 0.61% 141 139579 0.65% 142 151481 0.70% 143 167715 0.78% 144 190380 0.88% 145 220254 1.02% 146 266771 1.24% 147 351692 1.63% 148 510790 2.37% 149 948475 4.40% 150 4374414 20.29% 151 11318873 52.51% 21556121 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.47 fanout-score-rank=35 prefix-density=0.16 prefix-fanout=2.4 sequence=GATGTTAGCTTTGATGGCAGTGCAAAGGCAAACAGCAGCCTCGAGATCAAGAAGGCCTTGAATGA criterion=fanout-score sequence-density=0.09 sequence-density-rank=6 fanout-score=360.50 fanout-score-rank=1 prefix-density=0.96 prefix-fanout=34.8 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=4.24 fanout-score-rank=31 prefix-density=0.16 prefix-fanout=3.3 sequence=AATGGCCACTGTTGAGGTTG criterion=fanout-score sequence-density=0.08 sequence-density-rank=17 fanout-score=279.08 fanout-score-rank=1 prefix-density=0.78 prefix-fanout=29.2 sequence=GAAGAAGAAGAAA SRR7166156 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 17:03:03 Started mapping on | Feb 14 17:03:03 Finished on | Feb 14 17:05:19 Mapping speed, Million of reads per hour | 570.60 Number of input reads | 21556121 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 20469462 Uniquely mapped reads % | 94.96% Average mapped length | 291.87 Number of splices: Total | 20931713 Number of splices: Annotated (sjdb) | 20611606 Number of splices: GT/AG | 20607738 Number of splices: GC/AG | 258343 Number of splices: AT/AC | 13952 Number of splices: Non-canonical | 51680 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.38 Insertion rate per base | 0.02% Insertion average length | 2.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 531921 % of reads mapped to multiple loci | 2.47% Number of reads mapped to too many loci | 54752 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.26% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 563742 563742 563742 N_multimapping 531921 531921 531921 N_noFeature 508863 20258349 637951 N_ambiguous 175989 877 93487 UnstrandedReadsAssigned:19784610 PositiveStrandReadsAssigned:210236 NegativeStrandReadsAssigned:19738024 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7166156 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166156-trimmed-pair1.fastq SRR7166156-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,556,121 reads, 19,577,731 reads pseudoaligned [quant] estimated average fragment length: 233.224 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,195 rounds 52401 SRR7166156.ke.tsv 34699 SRR7166156.se.tsv 87100 total ==> SRR7166156.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1785.78 1006 30.3642 Potri.005G024800.1.v4.1 1035 802.776 476 31.9598 Potri.004G059700.1.v4.1 961 728.806 23 1.70101 Potri.007G009000.2.v4.1 1416 1183.78 0 0 Potri.003G141000.2.v4.1 2943 2710.78 668.748 13.2972 Potri.016G087400.1.v4.1 270 90.0649 1560.56 933.932 Potri.015G069301.1.v4.1 564 338.251 0 0 Potri.010G195200.1.v4.1 1773 1540.78 89 3.11345 Potri.012G127500.1.v4.1 977 744.781 3107 224.856 ==> SRR7166156.se.tsv <== Potri.001G166300.v4.1 2 Potri.001G448400.v4.1 19 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 274 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 68 SRR7166156 completed mapping pipeline successfully