Starting /dee2/code/volunteer_pipeline.sh SRR7166157 current disk space = 3110870274048 free memory = 1574930080 SRR7166157 SRAfilesize e858f670789f2af8af4069de0dc7fa95 SRR7166157.sra SRR7166157.sra file validated SRR7166157 is paired end SRR7166157 is conventional basespace SRR7166157 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166157_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.365 18.0 18.0 25.0 18.0 33.0 2 20.40025 18.0 18.0 25.0 18.0 28.0 3 26.589 27.0 25.0 29.0 18.0 31.0 4 30.83975 32.0 32.0 32.0 27.0 33.0 5 31.314 32.0 32.0 33.0 28.0 33.0 6 35.73575 37.0 35.0 38.0 32.0 38.0 7 36.886 38.0 37.0 38.0 34.0 38.0 8 37.4235 38.0 38.0 38.0 37.0 38.0 9 37.515 38.0 38.0 38.0 37.0 38.0 10-14 37.543400000000005 38.0 38.0 38.0 38.0 38.0 15-19 37.548899999999996 38.0 38.0 38.0 38.0 38.0 20-24 37.5722 38.0 38.0 38.0 38.0 38.0 25-29 37.5767 38.0 38.0 38.0 38.0 38.0 30-34 37.519000000000005 38.0 38.0 38.0 37.8 38.0 35-39 37.4894 38.0 38.0 38.0 37.6 38.0 40-44 37.44665 38.0 38.0 38.0 37.2 38.0 45-49 37.432249999999996 38.0 38.0 38.0 37.2 38.0 50-54 37.39059999999999 38.0 38.0 38.0 37.0 38.0 55-59 37.124300000000005 38.0 38.0 38.0 36.8 38.0 60-64 37.1928 38.0 38.0 38.0 36.6 38.0 65-69 37.297 38.0 38.0 38.0 36.8 38.0 70-74 37.181650000000005 38.0 38.0 38.0 36.4 38.0 75-79 37.11024999999999 38.0 38.0 38.0 36.0 38.0 80-84 37.05365 38.0 38.0 38.0 36.0 38.0 85-89 36.91095 38.0 38.0 38.0 35.6 38.0 90-94 36.762 38.0 38.0 38.0 34.8 38.0 95-99 36.7892 38.0 38.0 38.0 35.0 38.0 100-104 36.67475 38.0 38.0 38.0 34.6 38.0 105-109 36.4929 38.0 38.0 38.0 34.0 38.0 110-114 36.5023 38.0 38.0 38.0 34.0 38.0 115-119 36.23815 38.0 37.6 38.0 33.8 38.0 120-124 36.0961 38.0 37.4 38.0 33.6 38.0 125-129 35.994350000000004 38.0 37.0 38.0 33.0 38.0 130-134 35.75795 38.0 36.4 38.0 31.8 38.0 135-139 35.5884 38.0 36.0 38.0 31.0 38.0 140-144 35.27265 38.0 35.8 38.0 30.4 38.0 145-149 34.90345 38.0 35.4 38.0 29.6 38.0 150-151 31.418499999999998 36.5 31.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 1.0 4 0.0 5 0.0 6 0.0 7 3.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 3.0 16 0.0 17 2.0 18 1.0 19 3.0 20 4.0 21 2.0 22 3.0 23 3.0 24 2.0 25 3.0 26 14.0 27 12.0 28 21.0 29 25.0 30 30.0 31 37.0 32 73.0 33 87.0 34 143.0 35 304.0 36 862.0 37 2360.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.080694586312564 28.983656792645558 12.027579162410623 34.90806945863126 2 14.825 27.474999999999998 38.925 18.775 3 16.1 32.324999999999996 29.225 22.35 4 20.4 36.8 23.599999999999998 19.2 5 19.06312625250501 38.75250501002004 24.223446893787575 17.960921843687373 6 16.175 37.724999999999994 24.85 21.25 7 12.35 21.15 45.574999999999996 20.925 8 17.474999999999998 21.95 28.4 32.175 9 17.849999999999998 23.3 31.0 27.85 10-14 18.855 31.759999999999998 26.295 23.09 15-19 19.025 30.64 26.974999999999998 23.36 20-24 19.48 30.125 27.705000000000002 22.689999999999998 25-29 19.52 29.78 27.900000000000002 22.8 30-34 19.275000000000002 30.23 27.735 22.759999999999998 35-39 19.685 30.070000000000004 27.85 22.395 40-44 19.595000000000002 30.115 27.485 22.805 45-49 19.605 29.134999999999998 27.944999999999997 23.315 50-54 19.634999999999998 29.73 27.634999999999998 23.0 55-59 19.592657782247926 30.082977118430975 27.885340709077195 22.439024390243905 60-64 19.93295642167409 29.404112673237602 27.27272727272727 23.390203632361033 65-69 19.509999999999998 29.37 27.944999999999997 23.175 70-74 19.73 29.37 28.185 22.715 75-79 19.759999999999998 29.294999999999998 27.63 23.315 80-84 19.869999999999997 29.04 28.15 22.939999999999998 85-89 19.575 28.999999999999996 27.62 23.805 90-94 20.31 29.14 27.965 22.585 95-99 20.21 28.865000000000002 27.74 23.185 100-104 19.819864898674005 29.156867650738054 27.265449086815114 23.757818363772827 105-109 19.731704875362897 29.802783061367506 27.014716187806588 23.450795875463008 110-114 20.200000000000003 29.38 27.105 23.315 115-119 21.275 29.125 26.55 23.05 120-124 20.549999999999997 28.82 26.974999999999998 23.655 125-129 20.815 28.77 27.250000000000004 23.165 130-134 20.775 28.744999999999997 26.915 23.565 135-139 21.07 29.255 26.605 23.07 140-144 20.830000000000002 29.044999999999998 26.590000000000003 23.535 145-149 20.635 28.735 26.669999999999998 23.96 150-151 21.07769423558897 27.994987468671678 26.416040100250626 24.51127819548872 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.5 21 3.0 22 4.5 23 3.0 24 3.5 25 7.0 26 10.0 27 14.0 28 20.0 29 28.5 30 37.5 31 47.0 32 54.5 33 64.5 34 83.5 35 104.5 36 122.0 37 147.0 38 177.5 39 202.5 40 213.0 41 226.5 42 246.0 43 262.5 44 265.0 45 242.0 46 230.0 47 219.5 48 195.5 49 158.5 50 129.5 51 111.0 52 90.0 53 72.5 54 56.0 55 43.5 56 29.0 57 18.5 58 14.5 59 9.0 60 4.5 61 4.5 62 5.0 63 5.0 64 4.0 65 2.5 66 0.5 67 0.0 68 0.5 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.1 2 0.0 3 0.0 4 0.0 5 0.2 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.575 60-64 0.065 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.075 105-109 0.11 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.25 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42036290322581 98.625 2 0.4788306451612903 0.95 3 0.05040322580645161 0.15 4 0.025201612903225805 0.1 5 0.0 0.0 6 0.0 0.0 7 0.025201612903225805 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAAACATGAGCTGACCAACTGATAGATTAACTACTGCTTTGTTGGAACCA 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.8625 0.0 0.0 0.0 0.0 98-99 1.0499999999999998 0.0 0.0 0.0 0.0 100-101 1.2125 0.0 0.0 0.0 0.0 102-103 1.375 0.0 0.0 0.0 0.0 104-105 1.6625 0.0 0.0 0.0 0.0 106-107 1.9875 0.0 0.0 0.0 0.0 108-109 2.3125 0.0 0.0 0.0 0.0 110-111 2.6500000000000004 0.0 0.0 0.0 0.0 112-113 2.8 0.0 0.0 0.0 0.0 114-115 3.0999999999999996 0.0 0.0 0.0 0.0 116-117 3.525 0.0 0.0 0.0 0.0 118-119 3.9749999999999996 0.0 0.0 0.0 0.0 120-121 4.375 0.0 0.0 0.0 0.0 122-123 4.85 0.0 0.0 0.0 0.0 124-125 5.35 0.0 0.0 0.0 0.0 126-127 6.0625 0.0 0.0 0.0 0.0 128-129 6.699999999999999 0.0 0.0 0.0 0.0 130-131 7.387499999999999 0.0 0.0 0.0 0.0 132-133 8.0125 0.0 0.0 0.0 0.0 134-135 8.675 0.0 0.0 0.0 0.0 136-137 9.45 0.0 0.0 0.0 0.0 138-139 10.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCTGCT 10 0.0068661636 144.75 6 TTTAGCT 10 0.0068661636 144.75 7 >>END_MODULE SRR7166157 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166157_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.92475 33.0 33.0 34.0 32.0 34.0 2 33.0715 33.0 33.0 34.0 32.0 34.0 3 33.10875 34.0 33.0 34.0 32.0 34.0 4 33.148 34.0 33.0 34.0 33.0 34.0 5 33.14025 34.0 33.0 34.0 32.0 34.0 6 37.33225 38.0 38.0 38.0 37.0 38.0 7 37.4135 38.0 38.0 38.0 37.0 38.0 8 37.29725 38.0 38.0 38.0 37.0 38.0 9 37.3525 38.0 38.0 38.0 37.0 38.0 10-14 37.37805 38.0 38.0 38.0 37.0 38.0 15-19 37.40005 38.0 38.0 38.0 37.0 38.0 20-24 37.36045 38.0 38.0 38.0 37.0 38.0 25-29 37.29305 38.0 38.0 38.0 37.0 38.0 30-34 37.2844 38.0 38.0 38.0 37.0 38.0 35-39 37.180150000000005 38.0 38.0 38.0 36.6 38.0 40-44 37.1507 38.0 38.0 38.0 36.2 38.0 45-49 37.11039999999999 38.0 38.0 38.0 36.0 38.0 50-54 36.948899999999995 38.0 38.0 38.0 35.6 38.0 55-59 36.864200000000004 38.0 38.0 38.0 35.0 38.0 60-64 36.848850000000006 38.0 38.0 38.0 35.6 38.0 65-69 36.849900000000005 38.0 38.0 38.0 35.2 38.0 70-74 36.7281 38.0 38.0 38.0 34.6 38.0 75-79 36.6173 38.0 38.0 38.0 34.0 38.0 80-84 36.4847 38.0 38.0 38.0 34.0 38.0 85-89 36.309 38.0 37.0 38.0 33.6 38.0 90-94 36.091300000000004 38.0 37.0 38.0 33.0 38.0 95-99 35.95334999999999 38.0 37.0 38.0 32.0 38.0 100-104 35.92545 38.0 37.0 38.0 32.6 38.0 105-109 35.586349999999996 38.0 36.6 38.0 31.0 38.0 110-114 35.274699999999996 38.0 36.0 38.0 28.6 38.0 115-119 34.998000000000005 38.0 35.8 38.0 27.8 38.0 120-124 34.715199999999996 38.0 35.0 38.0 26.4 38.0 125-129 34.5552 38.0 35.0 38.0 26.0 38.0 130-134 34.073699999999995 38.0 34.4 38.0 23.8 38.0 135-139 33.533449999999995 38.0 34.0 38.0 21.4 38.0 140-144 32.749399999999994 37.4 33.2 38.0 15.8 38.0 145-149 31.634499999999996 37.0 31.2 38.0 10.8 38.0 150-151 26.877000000000002 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 2.0 13 4.0 14 2.0 15 3.0 16 3.0 17 3.0 18 2.0 19 3.0 20 4.0 21 7.0 22 11.0 23 10.0 24 9.0 25 19.0 26 25.0 27 26.0 28 23.0 29 40.0 30 61.0 31 69.0 32 102.0 33 140.0 34 220.0 35 419.0 36 937.0 37 1851.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.224999999999994 17.325 14.899999999999999 29.549999999999997 2 24.775 22.425 36.975 15.825 3 19.175 27.0 32.125 21.7 4 24.275 35.449999999999996 21.15 19.125 5 23.825 36.95 21.6 17.625 6 17.775 37.525 24.975 19.725 7 17.65 15.6 46.025 20.724999999999998 8 20.7 20.424999999999997 29.2 29.675 9 22.5 23.799999999999997 28.349999999999998 25.35 10-14 23.165 28.765 26.790000000000003 21.279999999999998 15-19 22.905 28.49 27.98 20.625 20-24 22.900000000000002 28.955 27.800000000000004 20.345 25-29 22.875 28.24 28.075 20.810000000000002 30-34 22.57 28.12 28.315 20.995 35-39 23.035 28.244999999999997 28.355000000000004 20.365 40-44 22.830000000000002 28.275 28.225 20.669999999999998 45-49 23.02 28.065 28.705000000000002 20.21 50-54 22.98 27.944999999999997 28.92 20.155 55-59 23.325000000000003 27.650000000000002 28.865000000000002 20.16 60-64 22.88 27.92 29.409999999999997 19.79 65-69 23.255 27.825 28.810000000000002 20.11 70-74 22.74 27.779999999999998 28.82 20.66 75-79 22.795 28.244999999999997 29.035 19.925 80-84 23.325000000000003 28.439999999999998 28.425 19.81 85-89 23.43 28.025 28.475 20.07 90-94 23.285 27.825 28.804999999999996 20.085 95-99 23.145 28.244999999999997 28.37 20.24 100-104 23.29 28.16 28.205000000000002 20.345 105-109 23.23 28.88 27.834999999999997 20.055 110-114 23.150000000000002 28.12 28.585 20.145 115-119 23.565 28.235 28.689999999999998 19.509999999999998 120-124 24.060000000000002 27.49 28.744999999999997 19.705000000000002 125-129 23.919999999999998 27.855 28.605000000000004 19.62 130-134 24.73 28.044999999999998 28.15 19.075 135-139 24.709999999999997 28.139999999999997 28.225 18.925 140-144 25.53 27.584999999999997 27.99 18.895 145-149 25.415 27.97 28.299999999999997 18.315 150-151 25.535110777318813 27.525347352609835 27.788208787082237 19.15133308298911 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 2.0 22 1.0 23 1.0 24 1.5 25 3.5 26 5.0 27 6.0 28 9.0 29 12.0 30 15.0 31 26.0 32 40.5 33 55.5 34 68.0 35 77.0 36 93.0 37 116.5 38 148.5 39 177.5 40 207.5 41 232.5 42 261.5 43 289.0 44 281.5 45 263.5 46 260.0 47 242.0 48 220.0 49 188.5 50 140.5 51 114.0 52 108.0 53 96.0 54 63.5 55 43.5 56 33.0 57 22.0 58 22.0 59 19.0 60 10.0 61 4.5 62 2.5 63 3.0 64 3.0 65 1.5 66 2.0 67 3.0 68 2.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.13749999999999998 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.16666666666667 98.175 2 0.6565656565656566 1.3 3 0.17676767676767677 0.525 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.85 0.0 0.0 0.0 0.0 98-99 1.025 0.0 0.0 0.0 0.0 100-101 1.1875 0.0 0.0 0.0 0.0 102-103 1.325 0.0 0.0 0.0 0.0 104-105 1.6375 0.0 0.0 0.0 0.0 106-107 1.95 0.0 0.0 0.0 0.0 108-109 2.2625 0.0 0.0 0.0 0.0 110-111 2.5999999999999996 0.0 0.0 0.0 0.0 112-113 2.75 0.0 0.0 0.0 0.0 114-115 3.0375 0.0 0.0 0.0 0.0 116-117 3.4375 0.0 0.0 0.0 0.0 118-119 3.875 0.0 0.0 0.0 0.0 120-121 4.275 0.0 0.0 0.0 0.0 122-123 4.75 0.0 0.0 0.0 0.0 124-125 5.2375 0.0 0.0 0.0 0.0 126-127 5.9375 0.0 0.0 0.0 0.0 128-129 6.574999999999999 0.0 0.0 0.0 0.0 130-131 7.262499999999999 0.0 0.0 0.0 0.0 132-133 7.8999999999999995 0.0 0.0 0.0 0.0 134-135 8.5375 0.0 0.0 0.0 0.0 136-137 9.25 0.0 0.0 0.0 0.0 138-139 9.712499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATTTGA 10 0.006830828 145.0 4 ACATTTG 10 0.006830828 145.0 3 ATTTGAA 10 0.006830828 145.0 5 >>END_MODULE Read 646889 spots for SRR7166157.sra Written 646889 spots for SRR7166157.sra Read 646889 spots for SRR7166157.sra Written 646889 spots for SRR7166157.sra Read 646889 spots for SRR7166157.sra Written 646889 spots for SRR7166157.sra Read 646889 spots for SRR7166157.sra Written 646889 spots for SRR7166157.sra Read 646889 spots for SRR7166157.sra Written 646889 spots for SRR7166157.sra Read 646889 spots for SRR7166157.sra Written 646889 spots for SRR7166157.sra Read 646889 spots for SRR7166157.sra Written 646889 spots for SRR7166157.sra Read 646889 spots for SRR7166157.sra Written 646889 spots for SRR7166157.sra Read 646889 spots for SRR7166157.sra Written 646889 spots for SRR7166157.sra Read 646889 spots for SRR7166157.sra Written 646889 spots for SRR7166157.sra Read 646889 spots for SRR7166157.sra Written 646889 spots for SRR7166157.sra Read 646889 spots for SRR7166157.sra Written 646889 spots for SRR7166157.sra Read 646889 spots for SRR7166157.sra Written 646889 spots for SRR7166157.sra Read 646889 spots for SRR7166157.sra Written 646889 spots for SRR7166157.sra Read 646889 spots for SRR7166157.sra Written 646889 spots for SRR7166157.sra Read 646889 spots for SRR7166157.sra Written 646889 spots for SRR7166157.sra Read 646900 spots for SRR7166157.sra Written 646900 spots for SRR7166157.sra Read 646889 spots for SRR7166157.sra Written 646889 spots for SRR7166157.sra Read 646889 spots for SRR7166157.sra Written 646889 spots for SRR7166157.sra Read 646889 spots for SRR7166157.sra Written 646889 spots for SRR7166157.sra SRR ids: ['SRR7166157.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3ywssebe SRR7166157.sra spots: 12937791 blocks: [[1, 646889], [646890, 1293778], [1293779, 1940667], [1940668, 2587556], [2587557, 3234445], [3234446, 3881334], [3881335, 4528223], [4528224, 5175112], [5175113, 5822001], [5822002, 6468890], [6468891, 7115779], [7115780, 7762668], [7762669, 8409557], [8409558, 9056446], [9056447, 9703335], [9703336, 10350224], [10350225, 10997113], [10997114, 11644002], [11644003, 12290891], [12290892, 12937791]] SRR7166157 file size 4362492 SRR7166157 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166157 SRR7166157_1.fastq SRR7166157_2.fastq Input file: SRR7166157_1.fastq Paired file: SRR7166157_2.fastq trimmed: SRR7166157-trimmed-pair1.fastq, SRR7166157-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 17:59:46 2025 >> started Fri Feb 14 18:00:02 2025 >> done (15.413s) 12937791 read pairs processed; of these: 5362 ( 0.04%) short read pairs filtered out after trimming by size control 7223 ( 0.06%) empty read pairs filtered out after trimming by size control 12925206 (99.90%) read pairs available; of these: 6563109 (50.78%) trimmed read pairs available after processing 6362097 (49.22%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 6 0.00% 20 2 0.00% 21 5 0.00% 22 3 0.00% 23 6 0.00% 24 6 0.00% 25 4 0.00% 26 4 0.00% 27 5 0.00% 28 6 0.00% 29 3 0.00% 30 4 0.00% 31 8 0.00% 32 5 0.00% 33 6 0.00% 34 12 0.00% 35 4 0.00% 36 4 0.00% 37 7 0.00% 38 7 0.00% 39 5 0.00% 40 11 0.00% 41 6 0.00% 42 11 0.00% 43 9 0.00% 44 21 0.00% 45 14 0.00% 46 14 0.00% 47 14 0.00% 48 32 0.00% 49 30 0.00% 50 35 0.00% 51 65 0.00% 52 58 0.00% 53 57 0.00% 54 58 0.00% 55 73 0.00% 56 79 0.00% 57 114 0.00% 58 117 0.00% 59 114 0.00% 60 167 0.00% 61 173 0.00% 62 195 0.00% 63 239 0.00% 64 242 0.00% 65 257 0.00% 66 308 0.00% 67 376 0.00% 68 420 0.00% 69 518 0.00% 70 572 0.00% 71 644 0.00% 72 825 0.01% 73 897 0.01% 74 1069 0.01% 75 1137 0.01% 76 1340 0.01% 77 1421 0.01% 78 1602 0.01% 79 1844 0.01% 80 2167 0.02% 81 2518 0.02% 82 2803 0.02% 83 3173 0.02% 84 3853 0.03% 85 4420 0.03% 86 4597 0.04% 87 5248 0.04% 88 5502 0.04% 89 5828 0.05% 90 6459 0.05% 91 7291 0.06% 92 8229 0.06% 93 8753 0.07% 94 9673 0.07% 95 10406 0.08% 96 11019 0.09% 97 11551 0.09% 98 12200 0.09% 99 13101 0.10% 100 13649 0.11% 101 14623 0.11% 102 15595 0.12% 103 16818 0.13% 104 18259 0.14% 105 19436 0.15% 106 20040 0.16% 107 20633 0.16% 108 21020 0.16% 109 21887 0.17% 110 22703 0.18% 111 23757 0.18% 112 25570 0.20% 113 27734 0.21% 114 28762 0.22% 115 30388 0.24% 116 31338 0.24% 117 31928 0.25% 118 32714 0.25% 119 33318 0.26% 120 34178 0.26% 121 35657 0.28% 122 37364 0.29% 123 39390 0.30% 124 41308 0.32% 125 43568 0.34% 126 45252 0.35% 127 46002 0.36% 128 46976 0.36% 129 48836 0.38% 130 50287 0.39% 131 51697 0.40% 132 54881 0.42% 133 57626 0.45% 134 60641 0.47% 135 63941 0.49% 136 67218 0.52% 137 70284 0.54% 138 73460 0.57% 139 77989 0.60% 140 82689 0.64% 141 89626 0.69% 142 98284 0.76% 143 108813 0.84% 144 125225 0.97% 145 146965 1.14% 146 179952 1.39% 147 236886 1.83% 148 346590 2.68% 149 645796 5.00% 150 2831474 21.91% 151 6362097 49.22% 12925206 reads passed initial QC criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=3.14 fanout-score-rank=22 prefix-density=0.86 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.08 sequence-density-rank=28 fanout-score=41.27 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=10.1 sequence=CCTTCCTTGTCCTGGATCTTGGCCTTCAC criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=28 prefix-density=0.68 prefix-fanout=2.0 sequence=GGCAGTGGCTGCAAATGTGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=29 fanout-score=19.93 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=5.8 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTC SRR7166157 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 18:01:44 Started mapping on | Feb 14 18:01:44 Finished on | Feb 14 18:04:10 Mapping speed, Million of reads per hour | 318.70 Number of input reads | 12925206 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 11743862 Uniquely mapped reads % | 90.86% Average mapped length | 291.77 Number of splices: Total | 10766220 Number of splices: Annotated (sjdb) | 10541810 Number of splices: GT/AG | 10588440 Number of splices: GC/AG | 136840 Number of splices: AT/AC | 9224 Number of splices: Non-canonical | 31716 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.04% Deletion average length | 2.46 Insertion rate per base | 0.03% Insertion average length | 2.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 317824 % of reads mapped to multiple loci | 2.46% Number of reads mapped to too many loci | 31532 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.36% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 869018 869018 869018 N_multimapping 317824 317824 317824 N_noFeature 407500 11596117 483129 N_ambiguous 137338 844 64687 UnstrandedReadsAssigned:11199024 PositiveStrandReadsAssigned:146901 NegativeStrandReadsAssigned:11196046 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7166157 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166157-trimmed-pair1.fastq SRR7166157-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,925,206 reads, 11,098,911 reads pseudoaligned [quant] estimated average fragment length: 226.743 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,073 rounds 52401 SRR7166157.ke.tsv 34699 SRR7166157.se.tsv 87100 total ==> SRR7166157.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1792.26 976 40.2293 Potri.005G024800.1.v4.1 1035 809.257 364 33.2283 Potri.004G059700.1.v4.1 961 735.282 11 1.10518 Potri.007G009000.2.v4.1 1416 1190.26 0 0 Potri.003G141000.2.v4.1 2943 2717.26 337 9.16204 Potri.016G087400.1.v4.1 270 88.3444 958 801.087 Potri.015G069301.1.v4.1 564 342.243 0 0 Potri.010G195200.1.v4.1 1773 1547.26 509 24.3024 Potri.012G127500.1.v4.1 977 751.277 7537 741.125 ==> SRR7166157.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 12 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 466 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 476 SRR7166157 completed mapping pipeline successfully