Starting /dee2/code/volunteer_pipeline.sh SRR7166158 current disk space = 3111169589248 free memory = 1462910580 SRR7166158 SRAfilesize da377d776bb29799614f1faf76881aec SRR7166158.sra SRR7166158.sra file validated SRR7166158 is paired end SRR7166158 is conventional basespace SRR7166158 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166158_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.67375 33.0 32.0 34.0 28.0 34.0 2 32.07625 33.0 33.0 34.0 29.0 34.0 3 31.9385 33.0 31.0 34.0 28.0 34.0 4 32.27375 33.0 33.0 34.0 31.0 34.0 5 32.26875 33.0 33.0 34.0 31.0 34.0 6 36.4915 38.0 37.0 38.0 34.0 38.0 7 36.88125 38.0 38.0 38.0 35.0 38.0 8 37.063 38.0 38.0 38.0 36.0 38.0 9 37.041 38.0 38.0 38.0 35.0 38.0 10-14 36.881800000000005 38.0 38.0 38.0 35.0 38.0 15-19 36.74305 38.0 38.0 38.0 34.6 38.0 20-24 36.857350000000004 38.0 38.0 38.0 35.0 38.0 25-29 36.536300000000004 38.0 38.0 38.0 34.0 38.0 30-34 36.3055 38.0 37.2 38.0 33.0 38.0 35-39 36.153400000000005 38.0 37.0 38.0 32.2 38.0 40-44 36.0377 38.0 37.0 38.0 31.2 38.0 45-49 35.99495 38.0 37.0 38.0 31.4 38.0 50-54 35.94925 38.0 37.0 38.0 30.8 38.0 55-59 35.7368 38.0 36.4 38.0 29.8 38.0 60-64 35.50815 38.0 36.0 38.0 28.8 38.0 65-69 35.641450000000006 38.0 36.2 38.0 29.4 38.0 70-74 35.456050000000005 38.0 36.0 38.0 29.0 38.0 75-79 34.78445 38.0 35.8 38.0 27.0 38.0 80-84 34.4311 38.0 35.0 38.0 26.0 38.0 85-89 34.3215 38.0 34.2 38.0 25.2 38.0 90-94 34.795249999999996 38.0 35.0 38.0 26.8 38.0 95-99 34.08239999999999 38.0 34.4 38.0 20.8 38.0 100-104 33.6241 37.6 33.6 38.0 16.8 38.0 105-109 33.4176 37.4 33.0 38.0 19.8 38.0 110-114 32.375 37.0 30.2 38.0 15.0 38.0 115-119 32.584649999999996 37.0 31.0 38.0 15.0 38.0 120-124 31.81155 36.4 28.8 38.0 15.0 38.0 125-129 31.626399999999997 36.6 29.2 38.0 15.0 38.0 130-134 30.032050000000005 35.2 25.0 38.0 14.0 38.0 135-139 28.935200000000002 33.6 22.6 38.0 13.0 38.0 140-144 27.40655 33.6 17.2 38.0 2.0 38.0 145-149 25.719750000000005 33.0 10.8 38.0 2.0 38.0 150-151 19.580625 17.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 4.0 14 1.0 15 1.0 16 3.0 17 4.0 18 8.0 19 9.0 20 13.0 21 14.0 22 25.0 23 39.0 24 43.0 25 57.0 26 68.0 27 102.0 28 113.0 29 124.0 30 157.0 31 185.0 32 260.0 33 333.0 34 399.0 35 583.0 36 771.0 37 683.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.07637835103693 18.411734951947395 11.406170966110269 33.10571573090541 2 18.675 25.924999999999997 37.125 18.275 3 16.675 32.675 27.525 23.125 4 19.675 39.0 22.225 19.1 5 18.05 39.275 24.224999999999998 18.45 6 15.4 39.275 24.625 20.7 7 12.35 20.65 46.75 20.25 8 17.075000000000003 22.225 28.575 32.125 9 16.775000000000002 23.875 29.825000000000003 29.525000000000002 10-14 18.755 31.900000000000002 26.255 23.09 15-19 19.035 30.020000000000003 27.525 23.419999999999998 20-24 18.93 30.470000000000002 27.29 23.31 25-29 19.189999999999998 30.535 27.71 22.564999999999998 30-34 19.13 30.020000000000003 27.224999999999998 23.625 35-39 19.134999999999998 30.080000000000002 27.105 23.68 40-44 19.005 30.270000000000003 27.800000000000004 22.925 45-49 19.345000000000002 30.0 27.139999999999997 23.515 50-54 19.205 30.415 27.415 22.965 55-59 19.314999999999998 29.995 27.29 23.400000000000002 60-64 19.405 29.485 27.805000000000003 23.305 65-69 19.525000000000002 29.470000000000002 28.065 22.939999999999998 70-74 19.211132245470015 29.83782160376414 27.54529982981279 23.405746320953046 75-79 19.70713849908481 29.174293268253 27.923530608094367 23.195037624567828 80-84 19.246456612623636 30.238605078005502 27.37330478229836 23.1416335270725 85-89 18.970000000000002 30.270000000000003 27.860000000000003 22.900000000000002 90-94 19.189999999999998 29.849999999999998 27.450000000000003 23.51 95-99 19.465 29.725 27.045 23.765 100-104 19.39 29.205 27.715 23.69 105-109 19.45 29.28 27.73 23.54 110-114 20.22 28.92 27.625 23.235 115-119 20.24 29.580000000000002 26.979999999999997 23.200000000000003 120-124 20.305152576288144 28.429214607303656 27.453726863431715 23.81190595297649 125-129 20.714678944997747 28.226815474700967 27.260897852960316 23.797607727340974 130-134 19.925267622702485 29.10018178145829 26.85821046253282 24.1163401333064 135-139 20.526948507313165 28.26086956521739 27.419354838709676 23.79282708875977 140-144 21.292775665399237 28.031819091454874 27.086251751050632 23.589153492095257 145-149 20.469158127385974 28.661844484629295 26.285915209965843 24.583082178018888 150-151 21.32380594208349 26.23793406042372 26.977560486398396 25.460699511094397 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 1.0 17 1.0 18 0.5 19 1.0 20 0.5 21 1.0 22 3.0 23 4.5 24 5.0 25 7.5 26 14.0 27 18.5 28 17.5 29 20.5 30 35.0 31 48.5 32 57.0 33 69.5 34 94.5 35 114.5 36 128.5 37 152.5 38 186.0 39 202.5 40 204.5 41 216.0 42 235.0 43 255.0 44 257.0 45 243.5 46 228.5 47 212.0 48 201.5 49 169.0 50 129.5 51 108.5 52 80.0 53 69.0 54 58.5 55 37.0 56 27.0 57 25.0 58 18.5 59 12.5 60 9.0 61 4.5 62 5.0 63 3.5 64 1.0 65 2.0 66 2.0 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.11 75-79 1.66 80-84 1.9300000000000002 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.05 125-129 0.095 130-134 0.98 135-139 0.18 140-144 0.06 145-149 0.45999999999999996 150-151 0.2875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34541792547836 98.65 2 0.6042296072507553 1.2 3 0.050352467270896276 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.07500000000000001 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.5625 0.0 0.0 0.0 0.0 96-97 0.7 0.0 0.0 0.0 0.0 98-99 0.825 0.0 0.0 0.0 0.0 100-101 1.0125 0.0 0.0 0.0 0.0 102-103 1.1625 0.0 0.0 0.0 0.0 104-105 1.35 0.0 0.0 0.0 0.0 106-107 1.6 0.0 0.0 0.0 0.0 108-109 1.8875 0.0 0.0 0.0 0.0 110-111 2.175 0.0 0.0 0.0 0.0 112-113 2.4000000000000004 0.0 0.0 0.0 0.0 114-115 2.6500000000000004 0.0 0.0 0.0 0.0 116-117 2.95 0.0 0.0 0.0 0.0 118-119 3.3625 0.0 0.0 0.0 0.0 120-121 3.8125 0.0 0.0 0.0 0.0 122-123 4.0875 0.0 0.0 0.0 0.0 124-125 4.375 0.0 0.0 0.0 0.0 126-127 4.7125 0.0 0.0 0.0 0.0 128-129 5.1375 0.0 0.0 0.0 0.0 130-131 5.574999999999999 0.0 0.0 0.0 0.0 132-133 6.1625 0.0 0.0 0.0 0.0 134-135 6.85 0.0 0.0 0.0 0.0 136-137 7.5375 0.0 0.0 0.0 0.0 138-139 8.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7166158 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166158_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.58775 33.0 33.0 34.0 32.0 34.0 2 32.6305 33.0 33.0 34.0 32.0 34.0 3 32.6825 33.0 33.0 34.0 32.0 34.0 4 32.69225 34.0 33.0 34.0 32.0 34.0 5 32.6255 33.0 33.0 34.0 32.0 34.0 6 36.6825 38.0 38.0 38.0 34.0 38.0 7 36.729 38.0 38.0 38.0 35.0 38.0 8 36.68825 38.0 38.0 38.0 35.0 38.0 9 36.697 38.0 38.0 38.0 35.0 38.0 10-14 36.53055 38.0 38.0 38.0 34.0 38.0 15-19 36.43125 38.0 38.0 38.0 34.0 38.0 20-24 36.2315 38.0 38.0 38.0 33.0 38.0 25-29 36.44500000000001 38.0 38.0 38.0 34.0 38.0 30-34 36.45525 38.0 38.0 38.0 34.2 38.0 35-39 36.242650000000005 38.0 38.0 38.0 33.0 38.0 40-44 36.163349999999994 38.0 38.0 38.0 33.0 38.0 45-49 35.88415 38.0 37.0 38.0 31.4 38.0 50-54 35.77065 38.0 37.0 38.0 30.0 38.0 55-59 35.84385 38.0 37.0 38.0 30.8 38.0 60-64 35.703199999999995 38.0 37.0 38.0 30.2 38.0 65-69 35.659 38.0 37.0 38.0 29.4 38.0 70-74 35.472899999999996 38.0 37.0 38.0 29.0 38.0 75-79 35.3663 38.0 36.8 38.0 28.8 38.0 80-84 35.3269 38.0 37.0 38.0 29.0 38.0 85-89 35.2014 38.0 36.4 38.0 28.6 38.0 90-94 34.9508 38.0 36.0 38.0 27.6 38.0 95-99 34.5449 38.0 35.4 38.0 25.0 38.0 100-104 34.34585 38.0 34.8 38.0 24.2 38.0 105-109 34.41994999999999 38.0 35.0 38.0 24.8 38.0 110-114 34.0533 38.0 34.0 38.0 23.0 38.0 115-119 33.637699999999995 38.0 34.0 38.0 21.0 38.0 120-124 32.93055 38.0 33.2 38.0 15.0 38.0 125-129 32.154849999999996 37.4 31.0 38.0 15.0 38.0 130-134 31.3211 36.8 30.4 38.0 13.6 38.0 135-139 30.702050000000003 36.0 28.8 38.0 13.2 38.0 140-144 30.036649999999998 36.0 27.8 38.0 6.0 38.0 145-149 27.45645 34.2 17.8 38.0 2.0 38.0 150-151 21.67 27.0 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 9.0 4 1.0 5 2.0 6 3.0 7 3.0 8 2.0 9 2.0 10 4.0 11 2.0 12 2.0 13 4.0 14 1.0 15 5.0 16 6.0 17 8.0 18 4.0 19 9.0 20 17.0 21 22.0 22 21.0 23 33.0 24 45.0 25 37.0 26 52.0 27 45.0 28 84.0 29 99.0 30 114.0 31 121.0 32 136.0 33 214.0 34 315.0 35 479.0 36 774.0 37 1314.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.2 16.575 15.625 29.599999999999998 2 22.8 25.074999999999996 35.55 16.575 3 20.549999999999997 26.650000000000002 32.0 20.8 4 23.85596399099775 37.23430857714429 20.80520130032508 18.104526131532882 5 23.330832708177045 37.35933983495874 21.255313828457115 18.0545136284071 6 18.975 37.3 24.575 19.15 7 17.0 15.125 47.099999999999994 20.775 8 22.7 21.875 25.85 29.575000000000003 9 22.7 23.150000000000002 29.075 25.074999999999996 10-14 23.18 28.999999999999996 26.955000000000002 20.865000000000002 15-19 23.235 28.105000000000004 28.07 20.59 20-24 23.745 28.155 28.29 19.81 25-29 22.755 27.939999999999998 28.825 20.48 30-34 23.244999999999997 28.055000000000003 28.439999999999998 20.26 35-39 23.125 28.075 28.655 20.145 40-44 23.200000000000003 28.095 28.32 20.385 45-49 23.16 28.044999999999998 28.93 19.865 50-54 23.375 27.725 28.994999999999997 19.905 55-59 23.330000000000002 27.97 28.9 19.8 60-64 23.415 28.205000000000002 28.59 19.79 65-69 23.125 28.13 28.799999999999997 19.945 70-74 23.189999999999998 28.185 28.79 19.835 75-79 23.05 27.345000000000002 29.365000000000002 20.24 80-84 23.565 27.955000000000002 28.665000000000003 19.814999999999998 85-89 23.11 28.23 28.875 19.785 90-94 24.16 28.225 28.215 19.400000000000002 95-99 23.835 27.935 29.17 19.06 100-104 24.18983796759352 27.91058211642328 28.595719143828767 19.30386077215443 105-109 23.520880220055012 28.49212303075769 28.482120530132534 19.504876219054765 110-114 24.141035258814703 28.632158039509875 28.20205051262816 19.024756189047263 115-119 23.82 28.294999999999998 28.62 19.265 120-124 24.085 27.700000000000003 29.14 19.075 125-129 24.235 27.845 28.935 18.985 130-134 24.295 27.97 28.315 19.42 135-139 24.095 28.110000000000003 28.355000000000004 19.439999999999998 140-144 25.445 27.065 28.754999999999995 18.735 145-149 25.19 27.61 27.955000000000002 19.245 150-151 26.3625 27.1375 28.3125 18.1875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 0.0 22 0.0 23 1.5 24 3.5 25 3.0 26 3.0 27 8.0 28 16.0 29 17.5 30 18.0 31 25.5 32 33.5 33 48.0 34 64.0 35 73.0 36 97.5 37 132.5 38 156.5 39 193.0 40 219.0 41 225.5 42 243.5 43 265.5 44 266.0 45 264.0 46 260.0 47 230.5 48 223.0 49 208.0 50 162.0 51 124.0 52 99.5 53 79.5 54 62.0 55 49.5 56 34.0 57 24.0 58 17.5 59 10.5 60 10.0 61 7.5 62 5.5 63 5.0 64 3.0 65 2.0 66 0.5 67 0.0 68 0.5 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.025 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.02 105-109 0.025 110-114 0.025 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21796165489405 98.32499999999999 2 0.6811301715438951 1.35 3 0.07568113017154389 0.22499999999999998 4 0.025227043390514632 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.07500000000000001 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.5625 0.0 0.0 0.0 0.0 96-97 0.7 0.0 0.0 0.0 0.0 98-99 0.825 0.0 0.0 0.0 0.0 100-101 0.9874999999999999 0.0 0.0 0.0 0.0 102-103 1.1375 0.0 0.0 0.0 0.0 104-105 1.325 0.0 0.0 0.0 0.0 106-107 1.5625 0.0 0.0 0.0 0.0 108-109 1.825 0.0 0.0 0.0 0.0 110-111 2.075 0.0 0.0 0.0 0.0 112-113 2.3125 0.0 0.0 0.0 0.0 114-115 2.5625 0.0 0.0 0.0 0.0 116-117 2.875 0.0 0.0 0.0 0.0 118-119 3.2625 0.0 0.0 0.0 0.0 120-121 3.6624999999999996 0.0 0.0 0.0 0.0 122-123 3.9875000000000003 0.0 0.0 0.0 0.0 124-125 4.3125 0.0 0.0 0.0 0.0 126-127 4.725 0.0 0.0 0.0 0.0 128-129 5.1625 0.0 0.0 0.0 0.0 130-131 5.65 0.0 0.0 0.0 0.0 132-133 6.275 0.0 0.0 0.0 0.0 134-135 6.9375 0.0 0.0 0.0 0.0 136-137 7.612500000000001 0.0 0.0 0.0 0.0 138-139 8.287500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAAACA 10 0.006843168 144.91249 8 >>END_MODULE Read 814799 spots for SRR7166158.sra Written 814799 spots for SRR7166158.sra Read 814799 spots for SRR7166158.sra Written 814799 spots for SRR7166158.sra Read 814799 spots for SRR7166158.sra Written 814799 spots for SRR7166158.sra Read 814799 spots for SRR7166158.sra Written 814799 spots for SRR7166158.sra Read 814799 spots for SRR7166158.sra Written 814799 spots for SRR7166158.sra Read 814799 spots for SRR7166158.sra Written 814799 spots for SRR7166158.sra Read 814799 spots for SRR7166158.sra Written 814799 spots for SRR7166158.sra Read 814799 spots for SRR7166158.sra Written 814799 spots for SRR7166158.sra Read 814799 spots for SRR7166158.sra Written 814799 spots for SRR7166158.sra Read 814799 spots for SRR7166158.sra Written 814799 spots for SRR7166158.sra Read 814799 spots for SRR7166158.sra Written 814799 spots for SRR7166158.sra Read 814799 spots for SRR7166158.sra Written 814799 spots for SRR7166158.sra Read 814799 spots for SRR7166158.sra Written 814799 spots for SRR7166158.sra Read 814799 spots for SRR7166158.sra Written 814799 spots for SRR7166158.sra Read 814799 spots for SRR7166158.sra Written 814799 spots for SRR7166158.sra Read 814816 spots for SRR7166158.sra Written 814816 spots for SRR7166158.sra Read 814799 spots for SRR7166158.sra Written 814799 spots for SRR7166158.sra Read 814799 spots for SRR7166158.sra Written 814799 spots for SRR7166158.sra Read 814799 spots for SRR7166158.sra Written 814799 spots for SRR7166158.sra Read 814799 spots for SRR7166158.sra Written 814799 spots for SRR7166158.sra SRR ids: ['SRR7166158.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6rgtdjgl SRR7166158.sra spots: 16295997 blocks: [[1, 814799], [814800, 1629598], [1629599, 2444397], [2444398, 3259196], [3259197, 4073995], [4073996, 4888794], [4888795, 5703593], [5703594, 6518392], [6518393, 7333191], [7333192, 8147990], [8147991, 8962789], [8962790, 9777588], [9777589, 10592387], [10592388, 11407186], [11407187, 12221985], [12221986, 13036784], [13036785, 13851583], [13851584, 14666382], [14666383, 15481181], [15481182, 16295997]] SRR7166158 file size 5500478 SRR7166158 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166158 SRR7166158_1.fastq SRR7166158_2.fastq Input file: SRR7166158_1.fastq Paired file: SRR7166158_2.fastq trimmed: SRR7166158-trimmed-pair1.fastq, SRR7166158-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 17:32:01 2025 >> started Fri Feb 14 17:32:59 2025 >> done (58.162s) 16295997 read pairs processed; of these: 20012 ( 0.12%) short read pairs filtered out after trimming by size control 16180 ( 0.10%) empty read pairs filtered out after trimming by size control 16259805 (99.78%) read pairs available; of these: 10658051 (65.55%) trimmed read pairs available after processing 5601754 (34.45%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 8 0.00% 21 8 0.00% 22 6 0.00% 23 6 0.00% 24 4 0.00% 25 3 0.00% 26 4 0.00% 27 5 0.00% 28 10 0.00% 29 12 0.00% 30 10 0.00% 31 10 0.00% 32 8 0.00% 33 6 0.00% 34 7 0.00% 35 11 0.00% 36 11 0.00% 37 11 0.00% 38 13 0.00% 39 11 0.00% 40 16 0.00% 41 18 0.00% 42 17 0.00% 43 21 0.00% 44 23 0.00% 45 24 0.00% 46 26 0.00% 47 28 0.00% 48 39 0.00% 49 41 0.00% 50 39 0.00% 51 54 0.00% 52 68 0.00% 53 84 0.00% 54 89 0.00% 55 97 0.00% 56 112 0.00% 57 133 0.00% 58 141 0.00% 59 177 0.00% 60 209 0.00% 61 201 0.00% 62 245 0.00% 63 266 0.00% 64 318 0.00% 65 378 0.00% 66 424 0.00% 67 516 0.00% 68 542 0.00% 69 649 0.00% 70 736 0.00% 71 849 0.01% 72 1003 0.01% 73 1115 0.01% 74 1211 0.01% 75 1388 0.01% 76 1554 0.01% 77 1755 0.01% 78 2012 0.01% 79 2329 0.01% 80 2595 0.02% 81 3016 0.02% 82 3427 0.02% 83 3866 0.02% 84 4928 0.03% 85 5735 0.04% 86 6104 0.04% 87 6769 0.04% 88 7094 0.04% 89 7436 0.05% 90 8420 0.05% 91 9213 0.06% 92 10026 0.06% 93 10581 0.07% 94 11438 0.07% 95 12063 0.07% 96 13038 0.08% 97 13729 0.08% 98 14728 0.09% 99 15673 0.10% 100 16949 0.10% 101 18010 0.11% 102 19167 0.12% 103 20250 0.12% 104 21486 0.13% 105 23352 0.14% 106 24067 0.15% 107 24974 0.15% 108 26133 0.16% 109 27402 0.17% 110 29091 0.18% 111 31177 0.19% 112 33159 0.20% 113 35498 0.22% 114 37062 0.23% 115 39857 0.25% 116 40376 0.25% 117 42228 0.26% 118 44084 0.27% 119 46221 0.28% 120 48529 0.30% 121 51007 0.31% 122 54036 0.33% 123 56482 0.35% 124 60907 0.37% 125 63861 0.39% 126 67624 0.42% 127 70769 0.44% 128 74048 0.46% 129 78757 0.48% 130 83183 0.51% 131 88281 0.54% 132 95055 0.58% 133 102181 0.63% 134 110106 0.68% 135 118634 0.73% 136 124568 0.77% 137 130333 0.80% 138 141910 0.87% 139 157816 0.97% 140 179779 1.11% 141 175462 1.08% 142 192783 1.19% 143 213002 1.31% 144 249755 1.54% 145 300320 1.85% 146 380145 2.34% 147 505812 3.11% 148 703788 4.33% 149 1244744 7.66% 150 3944834 24.26% 151 5601754 34.45% 16259805 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.80 fanout-score-rank=22 prefix-density=0.65 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=28 fanout-score=93.82 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=8.1 sequence=GAAGAAAAACATTACGATTATTACATTACATGCGCAATTGGGATAAAAAGGCCCTTGAAGAAATACACGTCACTGTTATAGCACGCGCTTACTTATAGGTACAAATGCACAAAAGGCCAACACGGAGAAAATGGAACAAACTGGGCTTGATTTTCATCTTTAATACATCATCAAATGGCCAAAAGTAAAGCATCACAATCATCACTTCTTGAAAGGAATGGCTCT criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.67 fanout-score-rank=17 prefix-density=0.59 prefix-fanout=2.6 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=23 fanout-score=20.76 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=1.4 sequence=CTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCC SRR7166158 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 17:34:13 Started mapping on | Feb 14 17:34:13 Finished on | Feb 14 17:37:09 Mapping speed, Million of reads per hour | 332.59 Number of input reads | 16259805 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 15005619 Uniquely mapped reads % | 92.29% Average mapped length | 289.95 Number of splices: Total | 13639593 Number of splices: Annotated (sjdb) | 13353232 Number of splices: GT/AG | 13417030 Number of splices: GC/AG | 168919 Number of splices: AT/AC | 12183 Number of splices: Non-canonical | 41461 Mismatch rate per base, % | 0.47% Deletion rate per base | 0.04% Deletion average length | 2.36 Insertion rate per base | 0.02% Insertion average length | 2.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 391343 % of reads mapped to multiple loci | 2.41% Number of reads mapped to too many loci | 35588 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.00% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 881545 881545 881545 N_multimapping 391343 391343 391343 N_noFeature 524667 14796728 633035 N_ambiguous 177831 1095 76653 UnstrandedReadsAssigned:14303121 PositiveStrandReadsAssigned:207796 NegativeStrandReadsAssigned:14295931 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=143 echo kmer=139 SRR7166158 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166158-trimmed-pair1.fastq SRR7166158-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,259,805 reads, 14,226,850 reads pseudoaligned [quant] estimated average fragment length: 229.68 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,138 rounds 52401 SRR7166158.ke.tsv 34699 SRR7166158.se.tsv 87100 total ==> SRR7166158.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1789.32 1255 39.327 Potri.005G024800.1.v4.1 1035 806.32 519 36.0907 Potri.004G059700.1.v4.1 961 732.32 50 3.82828 Potri.007G009000.2.v4.1 1416 1187.32 0 0 Potri.003G141000.2.v4.1 2943 2714.32 654.244 13.5149 Potri.016G087400.1.v4.1 270 84.4116 1443.98 959.164 Potri.015G069301.1.v4.1 564 337.963 0 0 Potri.010G195200.1.v4.1 1773 1544.32 227 8.24183 Potri.012G127500.1.v4.1 977 748.32 7846 587.89 ==> SRR7166158.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 371 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 905 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 186 SRR7166158 completed mapping pipeline successfully