Starting /dee2/code/volunteer_pipeline.sh SRR7166159 current disk space = 3110935846912 free memory = 1574978180 SRR7166159 SRAfilesize 4e7cfbc00079222781c28211df88f23f SRR7166159.sra SRR7166159.sra file validated SRR7166159 is paired end SRR7166159 is conventional basespace SRR7166159 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166159_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.83875 32.0 27.0 33.0 18.0 34.0 2 29.54225 31.0 29.0 33.0 18.0 33.0 3 31.87875 33.0 31.0 33.0 29.0 34.0 4 32.633 33.0 33.0 34.0 32.0 34.0 5 32.86675 33.0 33.0 34.0 32.0 34.0 6 36.7035 38.0 37.0 38.0 34.0 38.0 7 37.3265 38.0 38.0 38.0 36.0 38.0 8 37.36775 38.0 38.0 38.0 37.0 38.0 9 37.4255 38.0 38.0 38.0 37.0 38.0 10-14 37.4672 38.0 38.0 38.0 37.2 38.0 15-19 37.48219999999999 38.0 38.0 38.0 37.4 38.0 20-24 37.51145 38.0 38.0 38.0 37.4 38.0 25-29 37.462900000000005 38.0 38.0 38.0 37.0 38.0 30-34 37.412 38.0 38.0 38.0 37.0 38.0 35-39 37.41185 38.0 38.0 38.0 37.0 38.0 40-44 37.294349999999994 38.0 38.0 38.0 37.0 38.0 45-49 37.3005 38.0 38.0 38.0 37.0 38.0 50-54 37.14925 38.0 38.0 38.0 36.6 38.0 55-59 36.72005 38.0 38.0 38.0 35.8 38.0 60-64 36.9227 38.0 38.0 38.0 36.0 38.0 65-69 37.0815 38.0 38.0 38.0 36.0 38.0 70-74 37.05375 38.0 38.0 38.0 36.0 38.0 75-79 36.8441 38.0 38.0 38.0 35.8 38.0 80-84 36.65245 38.0 38.0 38.0 34.6 38.0 85-89 36.5338 38.0 38.0 38.0 34.2 38.0 90-94 36.509 38.0 38.0 38.0 34.0 38.0 95-99 36.367399999999996 38.0 38.0 38.0 33.8 38.0 100-104 36.307550000000006 38.0 38.0 38.0 33.8 38.0 105-109 35.92815 38.0 37.2 38.0 32.4 38.0 110-114 36.012750000000004 38.0 37.4 38.0 33.4 38.0 115-119 35.6624 38.0 37.0 38.0 31.2 38.0 120-124 35.329600000000006 38.0 36.6 38.0 29.2 38.0 125-129 35.3038 38.0 36.4 38.0 29.2 38.0 130-134 35.18845 38.0 36.0 38.0 28.6 38.0 135-139 34.831900000000005 38.0 35.8 38.0 28.0 38.0 140-144 34.39765 38.0 35.0 38.0 25.0 38.0 145-149 33.8383 38.0 35.0 38.0 22.6 38.0 150-151 30.366374999999998 36.5 29.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 1.0 15 0.0 16 3.0 17 0.0 18 4.0 19 2.0 20 4.0 21 12.0 22 11.0 23 12.0 24 6.0 25 19.0 26 18.0 27 37.0 28 23.0 29 37.0 30 33.0 31 61.0 32 82.0 33 100.0 34 165.0 35 294.0 36 637.0 37 2437.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.657407407407405 19.855967078189302 10.133744855967079 31.352880658436217 2 19.025 24.474999999999998 38.05 18.45 3 15.8 32.525 28.799999999999997 22.875 4 20.724999999999998 38.0 22.075 19.2 5 20.355088772193046 38.759689922480625 22.280570142535634 18.6046511627907 6 16.0 37.6 23.799999999999997 22.6 7 12.25 19.525000000000002 47.075 21.15 8 17.7 20.625 29.049999999999997 32.625 9 17.724999999999998 21.775 30.825000000000003 29.675 10-14 19.33 29.375 27.029999999999998 24.265 15-19 19.98 27.905 27.99 24.125 20-24 19.650000000000002 29.49 27.235 23.625 25-29 19.875 28.965000000000003 27.43 23.73 30-34 19.715 28.26 28.349999999999998 23.674999999999997 35-39 19.495 28.505000000000003 27.939999999999998 24.060000000000002 40-44 19.6 28.985 27.815 23.599999999999998 45-49 19.71 28.455000000000002 28.1 23.735 50-54 18.974590287174863 29.0683105297449 28.17621410314238 23.780885079937857 55-59 19.81580811658739 28.11456330330938 28.069021354113953 24.000607225989274 60-64 19.512928442573664 28.21707757065544 28.347364201242737 23.922629785528162 65-69 20.044999999999998 28.165000000000003 27.915 23.875 70-74 19.515 28.384999999999998 28.63 23.47 75-79 20.24 29.060000000000002 27.155 23.544999999999998 80-84 20.115 28.76 27.92 23.205000000000002 85-89 19.73 28.845 27.76 23.665 90-94 20.349999999999998 28.689999999999998 27.72 23.24 95-99 20.16 29.015 27.765 23.06 100-104 20.315 28.515 27.544999999999998 23.625 105-109 20.729751403368084 28.31796311146752 27.054931836407377 23.897353648757015 110-114 20.89 28.444999999999997 27.22 23.445 115-119 20.630000000000003 28.9 27.095000000000002 23.375 120-124 21.005 28.375 27.134999999999998 23.485 125-129 20.771038551927596 28.31641582079104 27.571378568928445 23.34116705835292 130-134 21.02 28.775000000000002 26.529999999999998 23.674999999999997 135-139 20.48102405120256 28.446422321116057 27.246362318115906 23.826191309565477 140-144 21.026051302565126 28.346417320866042 26.766338316915846 23.861193059652983 145-149 20.835 29.025000000000002 26.83 23.31 150-151 21.533074903088657 28.785794673002375 25.834688008003 23.846442415905962 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.5 21 0.5 22 1.0 23 2.0 24 3.5 25 6.0 26 6.5 27 10.0 28 14.5 29 16.0 30 24.0 31 29.0 32 38.5 33 50.0 34 62.0 35 84.0 36 99.0 37 123.5 38 152.0 39 171.0 40 203.0 41 237.0 42 247.5 43 256.0 44 282.0 45 284.5 46 267.0 47 243.5 48 219.5 49 186.5 50 151.5 51 120.0 52 84.5 53 71.5 54 63.5 55 46.5 56 32.5 57 26.0 58 19.5 59 12.5 60 11.0 61 11.0 62 6.5 63 6.5 64 4.0 65 2.0 66 4.5 67 3.5 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.8000000000000003 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.23500000000000001 55-59 1.1900000000000002 60-64 0.22 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.24 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.005 130-134 0.0 135-139 0.005 140-144 0.005 145-149 0.0 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.6 0.0 0.0 0.0 0.0 96-97 0.7250000000000001 0.0 0.0 0.0 0.0 98-99 0.825 0.0 0.0 0.0 0.0 100-101 0.9625 0.0 0.0 0.0 0.0 102-103 1.125 0.0 0.0 0.0 0.0 104-105 1.3375 0.0 0.0 0.0 0.0 106-107 1.575 0.0 0.0 0.0 0.0 108-109 1.7625000000000002 0.0 0.0 0.0 0.0 110-111 2.1625 0.0 0.0 0.0 0.0 112-113 2.3125 0.0 0.0 0.0 0.0 114-115 2.6375 0.0 0.0 0.0 0.0 116-117 2.9 0.0 0.0 0.0 0.0 118-119 3.2874999999999996 0.0 0.0 0.0 0.0 120-121 3.675 0.0 0.0 0.0 0.0 122-123 3.9875 0.0 0.0 0.0 0.0 124-125 4.4 0.0 0.0 0.0 0.0 126-127 4.9875 0.0 0.0 0.0 0.0 128-129 5.5 0.0 0.0 0.0 0.0 130-131 5.9625 0.0 0.0 0.0 0.0 132-133 6.449999999999999 0.0 0.0 0.0 0.0 134-135 7.050000000000001 0.0 0.0 0.0 0.0 136-137 7.637499999999999 0.0 0.0 0.0 0.0 138-139 8.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7166159 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166159_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.69325 33.0 33.0 34.0 32.0 34.0 2 32.8025 33.0 33.0 34.0 32.0 34.0 3 32.82025 33.0 33.0 34.0 32.0 34.0 4 32.7435 34.0 33.0 34.0 32.0 34.0 5 32.70925 33.0 33.0 34.0 32.0 34.0 6 36.91775 38.0 38.0 38.0 36.0 38.0 7 36.95 38.0 38.0 38.0 36.0 38.0 8 36.92425 38.0 38.0 38.0 36.0 38.0 9 36.8705 38.0 38.0 38.0 36.0 38.0 10-14 36.8608 38.0 38.0 38.0 36.0 38.0 15-19 36.806200000000004 38.0 38.0 38.0 36.0 38.0 20-24 36.7164 38.0 38.0 38.0 36.0 38.0 25-29 36.7089 38.0 38.0 38.0 36.0 38.0 30-34 36.601549999999996 38.0 38.0 38.0 35.4 38.0 35-39 36.565000000000005 38.0 38.0 38.0 35.2 38.0 40-44 36.52525 38.0 38.0 38.0 35.0 38.0 45-49 36.3345 38.0 38.0 38.0 34.4 38.0 50-54 36.15690000000001 38.0 38.0 38.0 33.6 38.0 55-59 36.061099999999996 38.0 38.0 38.0 33.4 38.0 60-64 36.086850000000005 38.0 38.0 38.0 33.8 38.0 65-69 36.03475 38.0 38.0 38.0 33.2 38.0 70-74 35.9726 38.0 37.8 38.0 33.0 38.0 75-79 35.7993 38.0 37.0 38.0 32.2 38.0 80-84 35.61024999999999 38.0 37.0 38.0 31.4 38.0 85-89 35.468 38.0 37.0 38.0 29.8 38.0 90-94 35.25025000000001 38.0 37.0 38.0 29.0 38.0 95-99 35.0869 38.0 36.6 38.0 28.6 38.0 100-104 34.80069999999999 38.0 36.0 38.0 26.8 38.0 105-109 34.6577 38.0 36.0 38.0 26.2 38.0 110-114 34.180049999999994 38.0 35.0 38.0 23.2 38.0 115-119 33.9868 38.0 35.0 38.0 23.0 38.0 120-124 33.60510000000001 38.0 34.2 38.0 17.8 38.0 125-129 33.411899999999996 38.0 34.0 38.0 16.2 38.0 130-134 32.8275 38.0 33.6 38.0 14.8 38.0 135-139 32.17909999999999 38.0 33.0 38.0 14.0 38.0 140-144 31.78705 38.0 32.8 38.0 13.4 38.0 145-149 29.9874 36.4 29.0 38.0 2.0 38.0 150-151 25.516750000000002 33.5 13.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 22.0 3 5.0 4 4.0 5 6.0 6 0.0 7 1.0 8 1.0 9 1.0 10 1.0 11 5.0 12 7.0 13 5.0 14 6.0 15 0.0 16 14.0 17 10.0 18 9.0 19 8.0 20 17.0 21 22.0 22 9.0 23 21.0 24 25.0 25 32.0 26 29.0 27 25.0 28 40.0 29 52.0 30 73.0 31 95.0 32 107.0 33 151.0 34 236.0 35 372.0 36 792.0 37 1797.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.325 16.325 14.174999999999999 29.175 2 22.3 23.599999999999998 36.55 17.549999999999997 3 20.125 26.85 32.5 20.525 4 23.625 34.775 21.825 19.775000000000002 5 22.650000000000002 37.625 21.95 17.775 6 16.816816816816818 39.33933933933934 23.5985985985986 20.245245245245243 7 17.271589486858574 15.369211514392992 45.65707133917397 21.70212765957447 8 19.22403003754693 21.877346683354194 28.260325406758447 30.638297872340424 9 21.97747183979975 22.728410513141426 28.986232790988737 26.307884856070086 10-14 22.796656823982783 28.45703418247335 27.591211651068516 21.15509734247535 15-19 22.340106095485936 28.105294765288757 28.23040736662997 21.324191772595334 20-24 22.869168712732375 28.15553439895776 27.88996342135592 21.08533346695395 25-29 23.741115226749425 27.310041045149664 28.48633496846531 20.4625087596356 30-34 22.698341101588735 27.735177667518666 28.23134365759535 21.33513757329725 35-39 22.80130293159609 28.338762214983714 27.857679779503886 21.002255073916313 40-44 22.773964022648695 28.466202335020295 27.85989878238212 20.89993485994889 45-49 22.65390014036495 28.088028875075192 28.83998395829156 20.418087026268296 50-54 23.229689067201605 27.7432296890672 28.10431293881645 20.922768304914744 55-59 23.028327901729757 27.87164702933066 28.76410127851592 20.335923790423667 60-64 22.901414100892588 27.41450205596229 28.94895196068599 20.735131882459132 65-69 22.984356197352586 27.812876052948255 28.22904131568392 20.973726434015244 70-74 23.496664827724558 27.910125883946037 28.356487286222983 20.236722002106426 75-79 22.636778496564865 28.293465723885465 28.333584073015395 20.736171706534275 80-84 23.36607858861267 28.54851643945469 27.44587008821171 20.63953488372093 85-89 23.053006368787923 28.458953914046436 28.273406549320494 20.214633167845143 90-94 23.507874410673086 28.633764670478485 27.384893168823353 20.47346775002508 95-99 23.271796929868565 28.183003912912614 28.29838466940905 20.246814487809772 100-104 23.708755390632835 28.106508875739642 28.056363454016648 20.128372279610872 105-109 23.440320962888666 28.505516549648945 28.2296890672016 19.824473420260784 110-114 23.81573665194701 28.18145323163388 27.97069450020072 20.032115616218384 115-119 24.627427367153395 28.53128606553264 27.11626273270109 19.725023834612877 120-124 24.194196204438196 27.969675670248016 28.210663721257156 19.625464404056633 125-129 24.05920722528851 28.314099347717008 27.19518314099348 20.431510286001004 130-134 24.344118384750438 28.196639077000253 27.208427389014293 20.250815149235013 135-139 25.08523866827116 28.254111512234253 27.39169675090253 19.268953068592058 140-144 24.72304376159206 28.09664644844353 27.184320016040903 19.995989773923505 145-149 24.663991975927782 28.274824473420264 27.5827482447342 19.478435305917756 150-151 25.284766554011767 27.46276129678308 27.412692452121668 19.83977969708349 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.5 5 1.5 6 1.0 7 0.0 8 0.0 9 1.0 10 1.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 1.0 17 1.5 18 2.5 19 1.5 20 0.0 21 0.5 22 0.5 23 3.0 24 4.0 25 5.5 26 8.0 27 7.5 28 8.0 29 10.5 30 19.5 31 24.5 32 30.0 33 40.0 34 51.0 35 73.5 36 92.0 37 109.5 38 144.5 39 172.5 40 199.5 41 240.0 42 271.5 43 267.5 44 265.0 45 270.5 46 259.0 47 246.5 48 221.0 49 189.0 50 155.5 51 132.0 52 111.5 53 76.5 54 55.0 55 46.5 56 37.0 57 32.5 58 26.0 59 16.5 60 14.5 61 13.0 62 7.5 63 6.5 64 6.0 65 3.5 66 2.0 67 2.0 68 1.5 69 2.0 70 2.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.1 7 0.125 8 0.125 9 0.125 10-14 0.095 15-19 0.09 20-24 0.215 25-29 0.11 30-34 0.23500000000000001 35-39 0.22499999999999998 40-44 0.215 45-49 0.26 50-54 0.3 55-59 0.27499999999999997 60-64 0.29 65-69 0.27999999999999997 70-74 0.305 75-79 0.295 80-84 0.24 85-89 0.295 90-94 0.31 95-99 0.33 100-104 0.29 105-109 0.3 110-114 0.36 115-119 0.35500000000000004 120-124 0.41000000000000003 125-129 0.35000000000000003 130-134 0.325 135-139 0.27999999999999997 140-144 0.255 145-149 0.3 150-151 0.13749999999999998 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67377666248431 99.3 2 0.27603513174404015 0.5499999999999999 3 0.05018820577164366 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.5375000000000001 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.75 0.0 0.0 0.0 0.0 98-99 0.8625 0.0 0.0 0.0 0.0 100-101 1.0 0.0 0.0 0.0 0.0 102-103 1.1749999999999998 0.0 0.0 0.0 0.0 104-105 1.4125 0.0 0.0 0.0 0.0 106-107 1.7125 0.0 0.0 0.0 0.0 108-109 1.9125 0.0 0.0 0.0 0.0 110-111 2.3 0.0 0.0 0.0 0.0 112-113 2.45 0.0 0.0 0.0 0.0 114-115 2.725 0.0 0.0 0.0 0.0 116-117 2.975 0.0 0.0 0.0 0.0 118-119 3.3875 0.0 0.0 0.0 0.0 120-121 3.775 0.0 0.0 0.0 0.0 122-123 4.1125 0.0 0.0 0.0 0.0 124-125 4.55 0.0 0.0 0.0 0.0 126-127 5.1125 0.0 0.0 0.0 0.0 128-129 5.6 0.0 0.0 0.0 0.0 130-131 6.0375 0.0 0.0 0.0 0.0 132-133 6.574999999999999 0.0 0.0 0.0 0.0 134-135 7.15 0.0 0.0 0.0 0.0 136-137 7.75 0.0 0.0 0.0 0.0 138-139 8.162500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1120493 spots for SRR7166159.sra Written 1120493 spots for SRR7166159.sra Read 1120493 spots for SRR7166159.sra Written 1120493 spots for SRR7166159.sra Read 1120493 spots for SRR7166159.sra Written 1120493 spots for SRR7166159.sra Read 1120493 spots for SRR7166159.sra Written 1120493 spots for SRR7166159.sra Read 1120493 spots for SRR7166159.sra Written 1120493 spots for SRR7166159.sra Read 1120510 spots for SRR7166159.sra Written 1120510 spots for SRR7166159.sra Read 1120493 spots for SRR7166159.sra Written 1120493 spots for SRR7166159.sra Read 1120493 spots for SRR7166159.sra Written 1120493 spots for SRR7166159.sra Read 1120493 spots for SRR7166159.sra Written 1120493 spots for SRR7166159.sra Read 1120493 spots for SRR7166159.sra Written 1120493 spots for SRR7166159.sra Read 1120493 spots for SRR7166159.sra Written 1120493 spots for SRR7166159.sra Read 1120493 spots for SRR7166159.sra Written 1120493 spots for SRR7166159.sra Read 1120493 spots for SRR7166159.sra Written 1120493 spots for SRR7166159.sra Read 1120493 spots for SRR7166159.sra Written 1120493 spots for SRR7166159.sra Read 1120493 spots for SRR7166159.sra Written 1120493 spots for SRR7166159.sra Read 1120493 spots for SRR7166159.sra Written 1120493 spots for SRR7166159.sra Read 1120493 spots for SRR7166159.sra Written 1120493 spots for SRR7166159.sra Read 1120493 spots for SRR7166159.sra Written 1120493 spots for SRR7166159.sra Read 1120493 spots for SRR7166159.sra Written 1120493 spots for SRR7166159.sra Read 1120493 spots for SRR7166159.sra Written 1120493 spots for SRR7166159.sra SRR ids: ['SRR7166159.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_km6jukrl SRR7166159.sra spots: 22409877 blocks: [[1, 1120493], [1120494, 2240986], [2240987, 3361479], [3361480, 4481972], [4481973, 5602465], [5602466, 6722958], [6722959, 7843451], [7843452, 8963944], [8963945, 10084437], [10084438, 11204930], [11204931, 12325423], [12325424, 13445916], [13445917, 14566409], [14566410, 15686902], [15686903, 16807395], [16807396, 17927888], [17927889, 19048381], [19048382, 20168874], [20168875, 21289367], [21289368, 22409877]] SRR7166159 file size 7572271 SRR7166159 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166159 SRR7166159_1.fastq SRR7166159_2.fastq Input file: SRR7166159_1.fastq Paired file: SRR7166159_2.fastq trimmed: SRR7166159-trimmed-pair1.fastq, SRR7166159-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 17:59:48 2025 >> started Fri Feb 14 18:00:12 2025 >> done (24.596s) 22409877 read pairs processed; of these: 44144 ( 0.20%) short read pairs filtered out after trimming by size control 84514 ( 0.38%) empty read pairs filtered out after trimming by size control 22281219 (99.43%) read pairs available; of these: 10687380 (47.97%) trimmed read pairs available after processing 11593839 (52.03%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 8 0.00% 20 4 0.00% 21 7 0.00% 22 11 0.00% 23 7 0.00% 24 8 0.00% 25 9 0.00% 26 7 0.00% 27 4 0.00% 28 10 0.00% 29 14 0.00% 30 9 0.00% 31 10 0.00% 32 12 0.00% 33 17 0.00% 34 15 0.00% 35 19 0.00% 36 21 0.00% 37 19 0.00% 38 15 0.00% 39 21 0.00% 40 20 0.00% 41 25 0.00% 42 28 0.00% 43 30 0.00% 44 42 0.00% 45 46 0.00% 46 43 0.00% 47 55 0.00% 48 79 0.00% 49 75 0.00% 50 89 0.00% 51 103 0.00% 52 104 0.00% 53 122 0.00% 54 145 0.00% 55 155 0.00% 56 193 0.00% 57 220 0.00% 58 247 0.00% 59 300 0.00% 60 338 0.00% 61 356 0.00% 62 454 0.00% 63 482 0.00% 64 564 0.00% 65 606 0.00% 66 707 0.00% 67 815 0.00% 68 905 0.00% 69 1019 0.00% 70 1234 0.01% 71 1399 0.01% 72 1611 0.01% 73 1894 0.01% 74 2084 0.01% 75 2444 0.01% 76 2593 0.01% 77 2968 0.01% 78 3140 0.01% 79 3520 0.02% 80 3972 0.02% 81 4877 0.02% 82 5496 0.02% 83 6690 0.03% 84 9908 0.04% 85 9708 0.04% 86 9827 0.04% 87 10055 0.05% 88 10804 0.05% 89 11447 0.05% 90 12187 0.05% 91 13155 0.06% 92 14341 0.06% 93 16115 0.07% 94 17033 0.08% 95 17943 0.08% 96 18697 0.08% 97 19543 0.09% 98 20474 0.09% 99 22774 0.10% 100 22589 0.10% 101 24492 0.11% 102 26315 0.12% 103 27805 0.12% 104 29474 0.13% 105 31201 0.14% 106 32604 0.15% 107 33273 0.15% 108 34624 0.16% 109 35892 0.16% 110 36678 0.16% 111 38831 0.17% 112 41895 0.19% 113 44347 0.20% 114 47004 0.21% 115 48934 0.22% 116 50351 0.23% 117 52160 0.23% 118 53183 0.24% 119 54426 0.24% 120 56157 0.25% 121 58907 0.26% 122 61046 0.27% 123 64137 0.29% 124 67560 0.30% 125 70925 0.32% 126 73690 0.33% 127 75876 0.34% 128 77016 0.35% 129 79867 0.36% 130 82623 0.37% 131 85247 0.38% 132 89515 0.40% 133 94679 0.42% 134 99781 0.45% 135 104972 0.47% 136 109538 0.49% 137 115257 0.52% 138 120898 0.54% 139 127350 0.57% 140 133847 0.60% 141 144293 0.65% 142 157744 0.71% 143 175181 0.79% 144 201977 0.91% 145 235245 1.06% 146 287219 1.29% 147 378699 1.70% 148 551859 2.48% 149 1023730 4.59% 150 4629913 20.78% 151 11593839 52.03% 22281219 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.94 fanout-score-rank=24 prefix-density=0.44 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACCA criterion=fanout-score sequence-density=0.09 sequence-density-rank=20 fanout-score=41.54 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=11.8 sequence=ACACCAGCAATGATTGT criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.74 fanout-score-rank=24 prefix-density=0.43 prefix-fanout=2.6 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.10 sequence-density-rank=22 fanout-score=25.45 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=9.7 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7166159 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 18:01:44 Started mapping on | Feb 14 18:01:44 Finished on | Feb 14 18:05:03 Mapping speed, Million of reads per hour | 403.08 Number of input reads | 22281219 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 20630144 Uniquely mapped reads % | 92.59% Average mapped length | 292.19 Number of splices: Total | 19696279 Number of splices: Annotated (sjdb) | 19284176 Number of splices: GT/AG | 19362206 Number of splices: GC/AG | 259234 Number of splices: AT/AC | 15971 Number of splices: Non-canonical | 58868 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.04% Deletion average length | 2.36 Insertion rate per base | 0.02% Insertion average length | 2.28 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 572051 % of reads mapped to multiple loci | 2.57% Number of reads mapped to too many loci | 48292 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.56% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1105387 1105387 1105387 N_multimapping 572051 572051 572051 N_noFeature 802603 20386624 956291 N_ambiguous 196756 1668 105703 UnstrandedReadsAssigned:19630785 PositiveStrandReadsAssigned:241852 NegativeStrandReadsAssigned:19568150 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7166159 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166159-trimmed-pair1.fastq SRR7166159-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,281,219 reads, 19,476,732 reads pseudoaligned [quant] estimated average fragment length: 234.368 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,251 rounds 52401 SRR7166159.ke.tsv 34699 SRR7166159.se.tsv 87100 total ==> SRR7166159.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1784.63 2005 62.7504 Potri.005G024800.1.v4.1 1035 801.632 376 26.1977 Potri.004G059700.1.v4.1 961 727.642 44 3.37742 Potri.007G009000.2.v4.1 1416 1182.63 0 0 Potri.003G141000.2.v4.1 2943 2709.63 936.874 19.3117 Potri.016G087400.1.v4.1 270 86.7801 1169.58 752.764 Potri.015G069301.1.v4.1 564 335.915 0 0 Potri.010G195200.1.v4.1 1773 1539.63 543.858 19.7296 Potri.012G127500.1.v4.1 977 743.637 9076 681.685 ==> SRR7166159.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 69 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 455 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 632 SRR7166159 completed mapping pipeline successfully