Starting /dee2/code/volunteer_pipeline.sh SRR7166160 current disk space = 3111310721024 free memory = 1447991140 SRR7166160 SRAfilesize 652a3bd099cd86412e94931e791829d2 SRR7166160.sra SRR7166160.sra file validated SRR7166160 is paired end SRR7166160 is conventional basespace SRR7166160 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166160_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.75675 33.0 32.0 34.0 30.0 34.0 2 32.08825 33.0 31.0 34.0 29.0 34.0 3 32.08125 33.0 32.0 34.0 28.0 34.0 4 31.958 33.0 32.0 34.0 30.0 34.0 5 32.279 33.0 33.0 34.0 31.0 34.0 6 36.15675 38.0 37.0 38.0 33.0 38.0 7 36.6985 38.0 37.0 38.0 34.0 38.0 8 36.7085 38.0 38.0 38.0 34.0 38.0 9 36.89625 38.0 38.0 38.0 35.0 38.0 10-14 36.89295 38.0 38.0 38.0 34.8 38.0 15-19 36.859249999999996 38.0 38.0 38.0 35.0 38.0 20-24 36.93765 38.0 38.0 38.0 35.0 38.0 25-29 36.625350000000005 38.0 38.0 38.0 34.2 38.0 30-34 36.42745000000001 38.0 37.8 38.0 33.6 38.0 35-39 36.3582 38.0 37.2 38.0 33.6 38.0 40-44 36.20385 38.0 37.2 38.0 33.2 38.0 45-49 36.1036 38.0 37.0 38.0 32.8 38.0 50-54 35.9773 38.0 37.0 38.0 31.4 38.0 55-59 35.82715 38.0 37.0 38.0 30.6 38.0 60-64 35.8553 38.0 36.6 38.0 30.8 38.0 65-69 35.555249999999994 38.0 36.0 38.0 29.0 38.0 70-74 35.53385 38.0 36.0 38.0 29.0 38.0 75-79 34.899449999999995 38.0 36.0 38.0 27.6 38.0 80-84 34.633500000000005 38.0 35.2 38.0 26.2 38.0 85-89 34.907849999999996 38.0 35.0 38.0 27.6 38.0 90-94 34.637950000000004 38.0 34.8 38.0 26.2 38.0 95-99 34.28394999999999 38.0 34.0 38.0 24.6 38.0 100-104 34.10505 38.0 34.0 38.0 23.4 38.0 105-109 33.4454 37.2 33.2 38.0 16.6 38.0 110-114 33.34935 37.0 33.2 38.0 15.0 38.0 115-119 32.678549999999994 37.0 31.0 38.0 15.0 38.0 120-124 32.2081 36.8 30.6 38.0 15.0 38.0 125-129 31.6007 36.2 30.0 38.0 14.8 38.0 130-134 29.7974 34.2 24.8 38.0 13.2 38.0 135-139 28.200349999999997 33.0 21.0 38.0 12.2 38.0 140-144 27.54895 33.0 18.6 38.0 2.0 38.0 145-149 25.19005 33.0 8.6 38.0 2.0 38.0 150-151 19.179125 17.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 1.0 12 1.0 13 0.0 14 0.0 15 0.0 16 4.0 17 6.0 18 5.0 19 11.0 20 12.0 21 13.0 22 19.0 23 36.0 24 47.0 25 63.0 26 67.0 27 75.0 28 103.0 29 121.0 30 142.0 31 183.0 32 244.0 33 331.0 34 444.0 35 616.0 36 908.0 37 547.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.71667511403953 16.4977192093259 12.366953877344146 38.41865179929042 2 18.0 27.900000000000002 36.0 18.099999999999998 3 16.725 32.324999999999996 26.1 24.85 4 20.474999999999998 37.824999999999996 21.275 20.424999999999997 5 20.275000000000002 39.574999999999996 22.75 17.4 6 15.5 35.975 26.400000000000002 22.125 7 12.8 19.575 46.525 21.099999999999998 8 17.549999999999997 20.974999999999998 27.700000000000003 33.775 9 16.625 21.75 31.6 30.025000000000002 10-14 19.45 30.025000000000002 26.895000000000003 23.630000000000003 15-19 19.21 28.499999999999996 28.575 23.715 20-24 18.965 29.404999999999998 28.205000000000002 23.425 25-29 19.84 29.64 27.560000000000002 22.96 30-34 19.36 29.165000000000003 28.09 23.385 35-39 19.470000000000002 29.134999999999998 27.965 23.43 40-44 19.16 29.21 27.915 23.715 45-49 19.685 28.895 27.805000000000003 23.615 50-54 19.93 28.939999999999998 27.839999999999996 23.29 55-59 19.725 29.42 28.000000000000004 22.855 60-64 19.37 29.160000000000004 28.025 23.445 65-69 19.985 29.080000000000002 27.49 23.445 70-74 20.093013952092814 29.30939640946142 27.35410311546732 23.243486522978447 75-79 19.670552458185504 29.239736441966546 28.14495691839838 22.94475418144957 80-84 19.75233455136013 29.13621599675193 27.85728786033293 23.254161591555015 85-89 19.465 29.439999999999998 27.650000000000002 23.445 90-94 19.545 28.904999999999998 27.87 23.68 95-99 19.57 28.95 28.310000000000002 23.169999999999998 100-104 20.47 28.694999999999997 27.63 23.205000000000002 105-109 20.080000000000002 28.67 27.755000000000003 23.494999999999997 110-114 20.330000000000002 28.32 27.584999999999997 23.765 115-119 20.285 28.52 27.48 23.715 120-124 20.417250350210125 28.517110266159694 27.936762057234343 23.128877326395838 125-129 20.223033455018253 29.054358153723058 27.714157123568533 23.008451267690152 130-134 20.692261185006046 28.693067311567916 27.231962918178155 23.382708585247883 135-139 20.5745458185276 28.071668084680446 27.541164105900606 23.812621990891348 140-144 20.6855141356017 28.04103077307981 27.535651738804102 23.737803352514387 145-149 20.57096984596859 28.52340574983694 27.083437860619135 23.822186543575334 150-151 21.36409227683049 27.31945837512538 27.181544633901705 24.134904714142426 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 1.5 23 4.5 24 6.0 25 6.0 26 8.0 27 9.0 28 12.0 29 19.0 30 26.0 31 40.5 32 48.0 33 56.5 34 72.5 35 89.5 36 108.5 37 138.5 38 156.5 39 173.5 40 212.0 41 233.5 42 248.0 43 258.5 44 280.5 45 278.0 46 258.5 47 241.0 48 199.0 49 172.5 50 157.0 51 128.0 52 93.0 53 68.0 54 57.5 55 41.0 56 26.5 57 24.5 58 17.0 59 10.0 60 7.5 61 4.5 62 3.0 63 1.5 64 0.0 65 0.0 66 0.0 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.35 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.015 75-79 1.35 80-84 1.48 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.06 125-129 0.015 130-134 0.76 135-139 0.095 140-144 0.075 145-149 0.345 150-151 0.3 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8246492985972 99.625 2 0.15030060120240482 0.3 3 0.0250501002004008 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.07500000000000001 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.38749999999999996 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.5625 0.0 0.0 0.0 0.0 96-97 0.65 0.0 0.0 0.0 0.0 98-99 0.8 0.0 0.0 0.0 0.0 100-101 0.9624999999999999 0.0 0.0 0.0 0.0 102-103 1.0625 0.0 0.0 0.0 0.0 104-105 1.125 0.0 0.0 0.0 0.0 106-107 1.1749999999999998 0.0 0.0 0.0 0.0 108-109 1.3375 0.0 0.0 0.0 0.0 110-111 1.6125 0.0 0.0 0.0 0.0 112-113 1.85 0.0 0.0 0.0 0.0 114-115 2.05 0.0 0.0 0.0 0.0 116-117 2.2249999999999996 0.0 0.0 0.0 0.0 118-119 2.5375 0.0 0.0 0.0 0.0 120-121 2.8625 0.0 0.0 0.0 0.0 122-123 3.0999999999999996 0.0 0.0 0.0 0.0 124-125 3.4125 0.0 0.0 0.0 0.0 126-127 3.625 0.0 0.0 0.0 0.0 128-129 3.8875 0.0 0.0 0.0 0.0 130-131 4.475 0.0 0.0 0.0 0.0 132-133 4.8375 0.0 0.0 0.0 0.0 134-135 5.3625 0.0 0.0 0.0 0.0 136-137 5.862500000000001 0.0 0.0 0.0 0.0 138-139 6.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7166160 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166160_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.494 33.0 33.0 34.0 32.0 34.0 2 32.61175 33.0 33.0 34.0 32.0 34.0 3 32.7175 33.0 33.0 34.0 32.0 34.0 4 32.51525 33.0 33.0 34.0 31.0 34.0 5 32.60675 33.0 33.0 34.0 32.0 34.0 6 36.70525 38.0 38.0 38.0 35.0 38.0 7 36.734 38.0 38.0 38.0 35.0 38.0 8 36.642 38.0 38.0 38.0 34.0 38.0 9 36.5525 38.0 38.0 38.0 34.0 38.0 10-14 36.47685 38.0 38.0 38.0 34.2 38.0 15-19 36.4001 38.0 38.0 38.0 33.8 38.0 20-24 36.217400000000005 38.0 38.0 38.0 33.0 38.0 25-29 36.367650000000005 38.0 38.0 38.0 34.0 38.0 30-34 36.36675 38.0 38.0 38.0 34.0 38.0 35-39 36.1742 38.0 38.0 38.0 33.0 38.0 40-44 36.05265000000001 38.0 37.6 38.0 32.6 38.0 45-49 35.88119999999999 38.0 37.2 38.0 31.0 38.0 50-54 35.77225 38.0 37.0 38.0 30.8 38.0 55-59 35.81135 38.0 37.0 38.0 31.0 38.0 60-64 35.83775000000001 38.0 37.0 38.0 31.0 38.0 65-69 35.693200000000004 38.0 37.0 38.0 30.2 38.0 70-74 35.52565 38.0 37.0 38.0 29.4 38.0 75-79 35.3332 38.0 36.6 38.0 28.8 38.0 80-84 35.0753 38.0 36.0 38.0 27.8 38.0 85-89 34.954550000000005 38.0 36.0 38.0 27.4 38.0 90-94 34.7214 38.0 35.8 38.0 26.0 38.0 95-99 34.576499999999996 38.0 35.0 38.0 25.4 38.0 100-104 34.251999999999995 38.0 34.6 38.0 24.0 38.0 105-109 34.0786 38.0 34.2 38.0 21.6 38.0 110-114 33.891999999999996 38.0 34.0 38.0 21.4 38.0 115-119 33.302499999999995 38.0 33.8 38.0 15.0 38.0 120-124 33.053399999999996 38.0 33.0 38.0 15.0 38.0 125-129 32.40905 37.4 31.8 38.0 15.0 38.0 130-134 31.4116 36.8 31.0 38.0 13.4 38.0 135-139 30.51325 36.0 29.0 38.0 12.8 38.0 140-144 29.2726 36.0 25.6 38.0 3.8 38.0 145-149 27.120000000000005 33.4 17.0 38.0 2.0 38.0 150-151 21.878375 27.0 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 2.0 4 3.0 5 5.0 6 1.0 7 4.0 8 1.0 9 1.0 10 3.0 11 7.0 12 5.0 13 1.0 14 4.0 15 5.0 16 5.0 17 14.0 18 7.0 19 7.0 20 18.0 21 20.0 22 24.0 23 34.0 24 44.0 25 51.0 26 64.0 27 55.0 28 69.0 29 101.0 30 100.0 31 108.0 32 183.0 33 221.0 34 305.0 35 446.0 36 812.0 37 1263.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.724999999999994 14.7 16.175 31.4 2 22.15 23.75 37.875 16.225 3 20.45 25.624999999999996 31.6 22.325 4 23.075000000000003 37.175000000000004 19.650000000000002 20.1 5 23.849999999999998 37.475 21.4 17.275 6 17.549999999999997 37.775 24.474999999999998 20.200000000000003 7 15.75 15.174999999999999 47.425 21.65 8 19.775000000000002 20.575 28.525 31.125000000000004 9 22.6 23.1 28.075 26.224999999999998 10-14 22.915 28.975 27.16 20.95 15-19 23.064999999999998 28.26 28.24 20.435 20-24 22.884999999999998 28.57 28.255000000000003 20.29 25-29 22.255 28.689999999999998 28.999999999999996 20.055 30-34 23.04 27.445000000000004 28.744999999999997 20.77 35-39 22.8 28.050000000000004 28.360000000000003 20.79 40-44 22.88 28.255000000000003 28.675 20.19 45-49 23.225 27.99 28.355000000000004 20.43 50-54 22.720000000000002 28.349999999999998 28.615000000000002 20.315 55-59 22.98 27.42 29.015 20.585 60-64 22.63 28.215 28.43 20.724999999999998 65-69 22.835 28.044999999999998 28.244999999999997 20.875 70-74 23.674999999999997 28.475 28.24 19.61 75-79 22.82 28.315 28.32 20.544999999999998 80-84 23.335 28.665000000000003 27.875 20.125 85-89 23.49 28.125 28.23 20.155 90-94 23.494999999999997 27.98 28.689999999999998 19.835 95-99 23.735 27.61 28.485 20.169999999999998 100-104 23.785 28.24 28.444999999999997 19.53 105-109 23.580000000000002 27.92 28.475 20.025000000000002 110-114 23.62 28.939999999999998 27.73 19.71 115-119 23.935000000000002 28.249999999999996 28.12 19.695 120-124 24.085 28.365000000000002 28.415000000000003 19.134999999999998 125-129 24.085 28.02 28.355000000000004 19.54 130-134 24.52 27.85 28.310000000000002 19.32 135-139 24.58 27.939999999999998 28.075 19.405 140-144 24.085 28.470000000000002 28.32 19.125 145-149 24.36 28.185 27.884999999999998 19.57 150-151 25.7 27.237499999999997 28.449999999999996 18.6125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.5 17 1.5 18 0.5 19 0.0 20 0.5 21 0.5 22 1.5 23 2.0 24 0.5 25 1.5 26 3.5 27 4.5 28 8.0 29 15.0 30 18.0 31 18.5 32 30.5 33 41.5 34 55.0 35 67.0 36 87.5 37 129.5 38 157.5 39 178.0 40 205.0 41 228.0 42 261.5 43 286.5 44 288.0 45 278.5 46 264.0 47 254.0 48 231.5 49 202.0 50 167.5 51 129.0 52 99.0 53 76.0 54 57.5 55 45.0 56 33.0 57 21.5 58 15.5 59 10.5 60 7.5 61 5.5 62 3.0 63 1.0 64 0.5 65 1.0 66 1.0 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69879518072288 99.3 2 0.25100401606425704 0.5 3 0.0251004016064257 0.075 4 0.0 0.0 5 0.0251004016064257 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCCTATTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.07500000000000001 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.38749999999999996 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.5625 0.0 0.0 0.0 0.0 96-97 0.65 0.0 0.0 0.0 0.0 98-99 0.7875 0.0 0.0 0.0 0.0 100-101 0.9375 0.0 0.0 0.0 0.0 102-103 1.0375 0.0 0.0 0.0 0.0 104-105 1.1 0.0 0.0 0.0 0.0 106-107 1.1625 0.0 0.0 0.0 0.0 108-109 1.35 0.0 0.0 0.0 0.0 110-111 1.6125 0.0 0.0 0.0 0.0 112-113 1.85 0.0 0.0 0.0 0.0 114-115 2.075 0.0 0.0 0.0 0.0 116-117 2.2750000000000004 0.0 0.0 0.0 0.0 118-119 2.5875 0.0 0.0 0.0 0.0 120-121 2.9125 0.0 0.0 0.0 0.0 122-123 3.125 0.0 0.0 0.0 0.0 124-125 3.5 0.0 0.0 0.0 0.0 126-127 3.7375 0.0 0.0 0.0 0.0 128-129 4.0375 0.0 0.0 0.0 0.0 130-131 4.6125 0.0 0.0 0.0 0.0 132-133 4.987500000000001 0.0 0.0 0.0 0.0 134-135 5.5875 0.0 0.0 0.0 0.0 136-137 6.0875 0.0 0.0 0.0 0.0 138-139 6.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGACAAC 10 0.006830828 145.0 1 >>END_MODULE Read 736829 spots for SRR7166160.sra Written 736829 spots for SRR7166160.sra Read 736829 spots for SRR7166160.sra Written 736829 spots for SRR7166160.sra Read 736829 spots for SRR7166160.sra Written 736829 spots for SRR7166160.sra Read 736829 spots for SRR7166160.sra Written 736829 spots for SRR7166160.sra Read 736829 spots for SRR7166160.sra Written 736829 spots for SRR7166160.sra Read 736829 spots for SRR7166160.sra Written 736829 spots for SRR7166160.sra Read 736829 spots for SRR7166160.sra Written 736829 spots for SRR7166160.sra Read 736829 spots for SRR7166160.sra Written 736829 spots for SRR7166160.sra Read 736829 spots for SRR7166160.sra Written 736829 spots for SRR7166160.sra Read 736829 spots for SRR7166160.sra Written 736829 spots for SRR7166160.sra Read 736829 spots for SRR7166160.sra Written 736829 spots for SRR7166160.sra Read 736829 spots for SRR7166160.sra Written 736829 spots for SRR7166160.sra Read 736832 spots for SRR7166160.sra Written 736832 spots for SRR7166160.sra Read 736829 spots for SRR7166160.sra Written 736829 spots for SRR7166160.sra Read 736829 spots for SRR7166160.sra Written 736829 spots for SRR7166160.sra Read 736829 spots for SRR7166160.sra Written 736829 spots for SRR7166160.sra Read 736829 spots for SRR7166160.sra Written 736829 spots for SRR7166160.sra Read 736829 spots for SRR7166160.sra Written 736829 spots for SRR7166160.sra Read 736829 spots for SRR7166160.sra Written 736829 spots for SRR7166160.sra Read 736829 spots for SRR7166160.sra Written 736829 spots for SRR7166160.sra SRR ids: ['SRR7166160.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gapzr2w2 SRR7166160.sra spots: 14736583 blocks: [[1, 736829], [736830, 1473658], [1473659, 2210487], [2210488, 2947316], [2947317, 3684145], [3684146, 4420974], [4420975, 5157803], [5157804, 5894632], [5894633, 6631461], [6631462, 7368290], [7368291, 8105119], [8105120, 8841948], [8841949, 9578777], [9578778, 10315606], [10315607, 11052435], [11052436, 11789264], [11789265, 12526093], [12526094, 13262922], [13262923, 13999751], [13999752, 14736583]] SRR7166160 file size 4972044 SRR7166160 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166160 SRR7166160_1.fastq SRR7166160_2.fastq Input file: SRR7166160_1.fastq Paired file: SRR7166160_2.fastq trimmed: SRR7166160-trimmed-pair1.fastq, SRR7166160-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 17:19:05 2025 >> started Fri Feb 14 17:19:34 2025 >> done (28.555s) 14736583 read pairs processed; of these: 14241 ( 0.10%) short read pairs filtered out after trimming by size control 11530 ( 0.08%) empty read pairs filtered out after trimming by size control 14710812 (99.83%) read pairs available; of these: 10269734 (69.81%) trimmed read pairs available after processing 4441078 (30.19%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 4 0.00% 21 3 0.00% 22 3 0.00% 23 3 0.00% 24 5 0.00% 25 3 0.00% 26 9 0.00% 27 6 0.00% 28 4 0.00% 29 6 0.00% 30 7 0.00% 31 9 0.00% 32 7 0.00% 33 9 0.00% 34 8 0.00% 35 12 0.00% 36 7 0.00% 37 12 0.00% 38 14 0.00% 39 17 0.00% 40 24 0.00% 41 27 0.00% 42 24 0.00% 43 17 0.00% 44 28 0.00% 45 34 0.00% 46 30 0.00% 47 35 0.00% 48 51 0.00% 49 57 0.00% 50 70 0.00% 51 61 0.00% 52 75 0.00% 53 94 0.00% 54 80 0.00% 55 100 0.00% 56 113 0.00% 57 121 0.00% 58 164 0.00% 59 153 0.00% 60 212 0.00% 61 232 0.00% 62 252 0.00% 63 281 0.00% 64 318 0.00% 65 340 0.00% 66 403 0.00% 67 472 0.00% 68 552 0.00% 69 605 0.00% 70 721 0.00% 71 800 0.01% 72 892 0.01% 73 1074 0.01% 74 1180 0.01% 75 1293 0.01% 76 1426 0.01% 77 1645 0.01% 78 1861 0.01% 79 2008 0.01% 80 2337 0.02% 81 2635 0.02% 82 3015 0.02% 83 3445 0.02% 84 4117 0.03% 85 4781 0.03% 86 4979 0.03% 87 5495 0.04% 88 5931 0.04% 89 6335 0.04% 90 7017 0.05% 91 7561 0.05% 92 8187 0.06% 93 8874 0.06% 94 9434 0.06% 95 10090 0.07% 96 10779 0.07% 97 11640 0.08% 98 12316 0.08% 99 13111 0.09% 100 14211 0.10% 101 15278 0.10% 102 16127 0.11% 103 17183 0.12% 104 17938 0.12% 105 19606 0.13% 106 20715 0.14% 107 21395 0.15% 108 22485 0.15% 109 23740 0.16% 110 25134 0.17% 111 26712 0.18% 112 28639 0.19% 113 30469 0.21% 114 32474 0.22% 115 34381 0.23% 116 35552 0.24% 117 38045 0.26% 118 39720 0.27% 119 41863 0.28% 120 44360 0.30% 121 46272 0.31% 122 49185 0.33% 123 52964 0.36% 124 56034 0.38% 125 60119 0.41% 126 63972 0.43% 127 67593 0.46% 128 71315 0.48% 129 76415 0.52% 130 82138 0.56% 131 87688 0.60% 132 94962 0.65% 133 102537 0.70% 134 112782 0.77% 135 123333 0.84% 136 130125 0.88% 137 136499 0.93% 138 147578 1.00% 139 162643 1.11% 140 182285 1.24% 141 185263 1.26% 142 204025 1.39% 143 228710 1.55% 144 264189 1.80% 145 316894 2.15% 146 392723 2.67% 147 515427 3.50% 148 719776 4.89% 149 1247070 8.48% 150 3563035 24.22% 151 4441078 30.19% 14710812 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=3.73 fanout-score-rank=24 prefix-density=0.35 prefix-fanout=3.2 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.07 sequence-density-rank=28 fanout-score=48.63 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=13.1 sequence=TTCTTGATAAATTTCTTAATCTGTGTAAGAAACTGCTTCTTGTCAAATGGAGGTTGCTCCTGGAGCCTAAATGTGTCAACGATGTCAACAACCTTGGCAGCTTGGTCATCAACACCCTCATCCTCATCA criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=33 prefix-density=0.49 prefix-fanout=2.1 sequence=GGCAGTGGCTGCAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=36.64 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=2.7 sequence=CTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAG SRR7166160 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 17:20:42 Started mapping on | Feb 14 17:20:42 Finished on | Feb 14 17:23:34 Mapping speed, Million of reads per hour | 307.90 Number of input reads | 14710812 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 13557755 Uniquely mapped reads % | 92.16% Average mapped length | 289.63 Number of splices: Total | 13025217 Number of splices: Annotated (sjdb) | 12772423 Number of splices: GT/AG | 12807376 Number of splices: GC/AG | 171601 Number of splices: AT/AC | 10258 Number of splices: Non-canonical | 35982 Mismatch rate per base, % | 0.49% Deletion rate per base | 0.04% Deletion average length | 2.21 Insertion rate per base | 0.02% Insertion average length | 2.22 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 329699 % of reads mapped to multiple loci | 2.24% Number of reads mapped to too many loci | 27906 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.30% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 837270 837270 837270 N_multimapping 329699 329699 329699 N_noFeature 511331 13396367 607509 N_ambiguous 133989 895 68297 UnstrandedReadsAssigned:12912435 PositiveStrandReadsAssigned:160493 NegativeStrandReadsAssigned:12881949 Dataset is classified negative stranded MeadianReadLen=149 20thPercentileLength=139 echo kmer=135 SRR7166160 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166160-trimmed-pair1.fastq SRR7166160-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,710,812 reads, 12,809,681 reads pseudoaligned [quant] estimated average fragment length: 234.321 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,037 rounds 52401 SRR7166160.ke.tsv 34699 SRR7166160.se.tsv 87100 total ==> SRR7166160.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1784.68 947 42.1587 Potri.005G024800.1.v4.1 1035 801.679 140 13.8748 Potri.004G059700.1.v4.1 961 727.689 7 0.764275 Potri.007G009000.2.v4.1 1416 1182.68 0 0 Potri.003G141000.2.v4.1 2943 2709.68 476.515 13.9719 Potri.016G087400.1.v4.1 270 82.6003 1001 962.831 Potri.015G069301.1.v4.1 564 333.837 0 0 Potri.010G195200.1.v4.1 1773 1539.68 475 24.511 Potri.012G127500.1.v4.1 977 743.684 10223 1092.16 ==> SRR7166160.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 20 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 407 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 522 SRR7166160 completed mapping pipeline successfully