Starting /dee2/code/volunteer_pipeline.sh SRR7166161 current disk space = 3110698049536 free memory = 1485516696 SRR7166161 SRAfilesize f0d17259a0ff8bb295d3577365db68a8 SRR7166161.sra SRR7166161.sra file validated SRR7166161 is paired end SRR7166161 is conventional basespace SRR7166161 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166161_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.1695 34.0 33.0 34.0 32.0 34.0 2 33.10575 34.0 33.0 34.0 32.0 34.0 3 32.94925 34.0 33.0 34.0 32.0 34.0 4 33.337 34.0 33.0 34.0 33.0 34.0 5 33.30025 34.0 33.0 34.0 33.0 34.0 6 37.183 38.0 37.0 38.0 36.0 38.0 7 37.468 38.0 38.0 38.0 37.0 38.0 8 37.59675 38.0 38.0 38.0 37.0 38.0 9 37.55125 38.0 38.0 38.0 38.0 38.0 10-14 37.57575 38.0 38.0 38.0 38.0 38.0 15-19 37.58725 38.0 38.0 38.0 38.0 38.0 20-24 37.535000000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.5606 38.0 38.0 38.0 38.0 38.0 30-34 37.5507 38.0 38.0 38.0 38.0 38.0 35-39 37.4952 38.0 38.0 38.0 37.6 38.0 40-44 37.489999999999995 38.0 38.0 38.0 37.2 38.0 45-49 37.42295 38.0 38.0 38.0 37.0 38.0 50-54 37.2654 38.0 38.0 38.0 37.0 38.0 55-59 36.750150000000005 38.0 38.0 38.0 36.4 38.0 60-64 37.042899999999996 38.0 38.0 38.0 36.2 38.0 65-69 37.2884 38.0 38.0 38.0 37.0 38.0 70-74 37.16224999999999 38.0 38.0 38.0 36.4 38.0 75-79 37.1012 38.0 38.0 38.0 36.0 38.0 80-84 37.03385000000001 38.0 38.0 38.0 36.0 38.0 85-89 36.9674 38.0 38.0 38.0 36.0 38.0 90-94 36.80835 38.0 38.0 38.0 35.2 38.0 95-99 36.7573 38.0 38.0 38.0 35.0 38.0 100-104 36.62115000000001 38.0 38.0 38.0 34.4 38.0 105-109 36.439 38.0 38.0 38.0 34.0 38.0 110-114 36.4402 38.0 38.0 38.0 34.0 38.0 115-119 36.28025 38.0 37.8 38.0 33.8 38.0 120-124 36.035000000000004 38.0 37.0 38.0 33.2 38.0 125-129 36.013600000000004 38.0 37.0 38.0 33.2 38.0 130-134 35.7725 38.0 36.6 38.0 32.4 38.0 135-139 35.58125 38.0 36.0 38.0 31.2 38.0 140-144 35.220600000000005 38.0 36.0 38.0 29.8 38.0 145-149 34.766949999999994 38.0 35.4 38.0 28.0 38.0 150-151 31.89725 36.5 31.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 1.0 16 1.0 17 2.0 18 1.0 19 1.0 20 3.0 21 5.0 22 2.0 23 6.0 24 6.0 25 10.0 26 18.0 27 15.0 28 12.0 29 29.0 30 42.0 31 43.0 32 46.0 33 82.0 34 126.0 35 271.0 36 568.0 37 2708.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.174954908528726 18.78381860345272 9.482092244266942 30.55913424375161 2 18.825 25.025 38.65 17.5 3 16.35 31.2 27.975 24.474999999999998 4 19.825 38.1 22.725 19.35 5 20.195195195195197 37.43743743743744 23.173173173173172 19.194194194194196 6 16.2 37.4 23.974999999999998 22.425 7 13.225000000000001 19.075 46.875 20.825 8 16.875 19.925 29.675 33.525 9 17.525 21.925 31.1 29.45 10-14 19.375 29.895 26.755000000000003 23.974999999999998 15-19 19.93 28.67 27.88 23.52 20-24 19.68 29.65 27.49 23.18 25-29 19.73 29.005 28.32 22.945 30-34 19.75 29.28 27.785 23.185 35-39 20.064999999999998 29.13 27.334999999999997 23.47 40-44 20.265 28.725 27.625 23.385 45-49 20.21 28.999999999999996 27.24 23.549999999999997 50-54 20.011041959445894 28.61373218229271 27.785585223850635 23.58964063441076 55-59 20.006090133982948 28.709906617945595 28.131343889565567 23.152659358505886 60-64 19.7059413890004 29.02950622240064 27.49397832195905 23.770574066639906 65-69 19.72 28.915000000000003 27.975 23.39 70-74 19.939999999999998 28.725 27.455000000000002 23.880000000000003 75-79 19.885 28.925 27.650000000000002 23.54 80-84 19.78 28.84 27.560000000000002 23.82 85-89 19.96 29.020000000000003 27.6 23.419999999999998 90-94 20.11 28.494999999999997 27.675 23.72 95-99 19.975 28.65 28.16 23.215 100-104 20.36 28.565 27.445000000000004 23.630000000000003 105-109 20.620209408346273 28.961474876008214 27.438505084915587 22.979810630729926 110-114 20.990000000000002 28.555000000000003 27.279999999999998 23.175 115-119 20.825 28.48 27.505000000000003 23.189999999999998 120-124 20.880000000000003 29.110000000000003 27.02 22.99 125-129 20.580000000000002 28.46 27.725 23.235 130-134 21.099999999999998 29.104999999999997 26.845000000000002 22.95 135-139 20.73 28.294999999999998 27.089999999999996 23.885 140-144 20.66 28.505000000000003 26.924999999999997 23.91 145-149 20.965 28.455000000000002 26.865 23.715 150-151 20.658982711099974 27.72488098220997 27.399148083187168 24.21698822350288 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 1.0 22 0.5 23 4.0 24 5.0 25 3.5 26 6.0 27 11.5 28 15.0 29 13.5 30 25.0 31 38.5 32 40.5 33 49.0 34 64.5 35 79.0 36 93.0 37 124.5 38 148.5 39 155.0 40 186.5 41 234.5 42 261.5 43 268.0 44 285.0 45 276.5 46 267.0 47 259.5 48 227.5 49 192.0 50 159.5 51 131.5 52 92.0 53 71.0 54 52.0 55 40.0 56 36.5 57 20.5 58 12.5 59 9.0 60 6.0 61 6.0 62 4.5 63 4.5 64 5.0 65 4.0 66 2.5 67 1.5 68 1.0 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.9749999999999996 2 0.0 3 0.0 4 0.0 5 0.1 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.38 55-59 1.48 60-64 0.36 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.19499999999999998 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.22499999999999998 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74931060416145 99.47500000000001 2 0.22562045625470042 0.44999999999999996 3 0.0250689395838556 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.7875 0.0 0.0 0.0 0.0 96-97 0.9625 0.0 0.0 0.0 0.0 98-99 1.1375 0.0 0.0 0.0 0.0 100-101 1.325 0.0 0.0 0.0 0.0 102-103 1.4625 0.0 0.0 0.0 0.0 104-105 1.675 0.0 0.0 0.0 0.0 106-107 1.875 0.0 0.0 0.0 0.0 108-109 2.0625 0.0 0.0 0.0 0.0 110-111 2.325 0.0 0.0 0.0 0.0 112-113 2.6375 0.0 0.0 0.0 0.0 114-115 2.975 0.0 0.0 0.0 0.0 116-117 3.2375 0.0 0.0 0.0 0.0 118-119 3.5250000000000004 0.0 0.0 0.0 0.0 120-121 3.8125 0.0 0.0 0.0 0.0 122-123 4.1125 0.0 0.0 0.0 0.0 124-125 4.625 0.0 0.0 0.0 0.0 126-127 5.1375 0.0 0.0 0.0 0.0 128-129 5.4875 0.0 0.0 0.0 0.0 130-131 5.9625 0.0 0.0 0.0 0.0 132-133 6.575 0.0 0.0 0.0 0.0 134-135 7.375 0.0 0.0 0.0 0.0 136-137 8.075 0.0 0.0 0.0 0.0 138-139 8.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGGTGC 10 0.006407227 148.08975 1 AAAAAAA 160 0.004227067 8.121797 30-34 >>END_MODULE SRR7166161 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166161_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0835 33.0 33.0 34.0 32.0 34.0 2 33.16025 34.0 33.0 34.0 32.0 34.0 3 33.2365 34.0 33.0 34.0 33.0 34.0 4 33.15975 34.0 33.0 34.0 33.0 34.0 5 33.1095 34.0 33.0 34.0 33.0 34.0 6 37.33675 38.0 38.0 38.0 37.0 38.0 7 37.4785 38.0 38.0 38.0 37.0 38.0 8 37.46375 38.0 38.0 38.0 38.0 38.0 9 37.37625 38.0 38.0 38.0 37.0 38.0 10-14 37.3278 38.0 38.0 38.0 37.0 38.0 15-19 37.335249999999995 38.0 38.0 38.0 37.0 38.0 20-24 37.303549999999994 38.0 38.0 38.0 37.0 38.0 25-29 37.23565 38.0 38.0 38.0 37.0 38.0 30-34 37.2034 38.0 38.0 38.0 37.0 38.0 35-39 37.14195 38.0 38.0 38.0 37.0 38.0 40-44 37.1586 38.0 38.0 38.0 37.0 38.0 45-49 37.0601 38.0 38.0 38.0 36.2 38.0 50-54 36.96905 38.0 38.0 38.0 36.0 38.0 55-59 36.9024 38.0 38.0 38.0 36.0 38.0 60-64 36.89585 38.0 38.0 38.0 36.0 38.0 65-69 36.8281 38.0 38.0 38.0 35.8 38.0 70-74 36.69825 38.0 38.0 38.0 35.0 38.0 75-79 36.67975 38.0 38.0 38.0 35.2 38.0 80-84 36.546350000000004 38.0 38.0 38.0 34.8 38.0 85-89 36.47285 38.0 38.0 38.0 34.2 38.0 90-94 36.35555 38.0 38.0 38.0 34.0 38.0 95-99 36.213 38.0 38.0 38.0 34.0 38.0 100-104 36.06675 38.0 37.8 38.0 33.4 38.0 105-109 35.96085 38.0 37.2 38.0 32.8 38.0 110-114 35.84375 38.0 37.0 38.0 32.2 38.0 115-119 35.558 38.0 37.0 38.0 31.2 38.0 120-124 35.34035 38.0 36.2 38.0 30.0 38.0 125-129 34.995000000000005 38.0 36.0 38.0 27.8 38.0 130-134 34.745099999999994 38.0 35.4 38.0 27.2 38.0 135-139 34.506550000000004 38.0 35.0 38.0 26.2 38.0 140-144 33.8914 38.0 35.0 38.0 23.0 38.0 145-149 32.911100000000005 38.0 34.0 38.0 15.2 38.0 150-151 28.919875 36.0 24.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 3.0 4 2.0 5 0.0 6 1.0 7 1.0 8 1.0 9 2.0 10 4.0 11 1.0 12 0.0 13 3.0 14 2.0 15 3.0 16 5.0 17 3.0 18 3.0 19 8.0 20 4.0 21 10.0 22 5.0 23 11.0 24 16.0 25 13.0 26 20.0 27 28.0 28 22.0 29 20.0 30 47.0 31 56.0 32 74.0 33 103.0 34 147.0 35 288.0 36 668.0 37 2422.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.15 16.625 10.9 28.325 2 23.400000000000002 24.875 34.1 17.625 3 20.849999999999998 26.224999999999998 30.975 21.95 4 24.0 35.55 21.925 18.525 5 23.275000000000002 39.025 21.325 16.375 6 18.099999999999998 38.35 23.5 20.05 7 16.35 15.625 47.175 20.849999999999998 8 20.175 21.25 28.050000000000004 30.525000000000002 9 22.425 23.474999999999998 28.449999999999996 25.650000000000002 10-14 23.169999999999998 28.48 26.640000000000004 21.709999999999997 15-19 22.715 27.705000000000002 28.294999999999998 21.285 20-24 22.475 28.92 28.02 20.585 25-29 23.369999999999997 28.060000000000002 28.29 20.28 30-34 22.375 27.634999999999998 28.77 21.22 35-39 23.3 27.975 28.18 20.544999999999998 40-44 22.435 28.275 28.365000000000002 20.925 45-49 23.35 27.29 28.83 20.53 50-54 23.205000000000002 27.900000000000002 28.105000000000004 20.79 55-59 23.165 27.900000000000002 28.349999999999998 20.585 60-64 23.445 28.199999999999996 27.73 20.625 65-69 23.625 27.175 28.62 20.580000000000002 70-74 23.46 27.66 28.585 20.294999999999998 75-79 23.165 27.950000000000003 28.03 20.855 80-84 23.175 27.57 28.7 20.555 85-89 23.669999999999998 27.955000000000002 28.025 20.349999999999998 90-94 23.849999999999998 28.395 28.035 19.72 95-99 23.485 27.860000000000003 28.475 20.18 100-104 23.365 27.985 28.249999999999996 20.4 105-109 24.185000000000002 28.33 27.93 19.555 110-114 23.5 27.855 28.725 19.919999999999998 115-119 23.669999999999998 28.439999999999998 27.589999999999996 20.3 120-124 24.345 28.199999999999996 27.22 20.235 125-129 24.08 27.985 28.165000000000003 19.77 130-134 24.685000000000002 28.065 27.24 20.01 135-139 24.62 28.9 26.965 19.515 140-144 25.480000000000004 28.065 27.450000000000003 19.005 145-149 25.82 27.98 27.05 19.15 150-151 25.753595997498437 28.330206378986865 26.841776110068793 19.074421513445905 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.5 22 2.0 23 1.0 24 1.0 25 3.5 26 6.0 27 8.5 28 8.0 29 9.5 30 13.5 31 14.0 32 23.5 33 39.0 34 45.5 35 58.5 36 87.5 37 114.5 38 136.0 39 163.0 40 184.5 41 209.0 42 266.5 43 288.0 44 286.0 45 287.5 46 277.0 47 265.0 48 246.0 49 205.5 50 170.0 51 150.0 52 114.5 53 81.0 54 57.5 55 49.5 56 37.0 57 25.0 58 20.0 59 12.5 60 6.5 61 5.5 62 4.5 63 3.5 64 2.0 65 1.0 66 1.5 67 1.5 68 0.5 69 0.0 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54785229841748 99.075 2 0.42702838482793265 0.8500000000000001 3 0.025119316754584273 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.7875 0.0 0.0 0.0 0.0 96-97 0.9625 0.0 0.0 0.0 0.0 98-99 1.1375 0.0 0.0 0.0 0.0 100-101 1.325 0.0 0.0 0.0 0.0 102-103 1.4625 0.0 0.0 0.0 0.0 104-105 1.675 0.0 0.0 0.0 0.0 106-107 1.8875 0.0 0.0 0.0 0.0 108-109 2.0625 0.0 0.0 0.0 0.0 110-111 2.3375 0.0 0.0 0.0 0.0 112-113 2.6875 0.0 0.0 0.0 0.0 114-115 3.05 0.0 0.0 0.0 0.0 116-117 3.3 0.0 0.0 0.0 0.0 118-119 3.5999999999999996 0.0 0.0 0.0 0.0 120-121 3.9125 0.0 0.0 0.0 0.0 122-123 4.2375 0.0 0.0 0.0 0.0 124-125 4.75 0.0 0.0 0.0 0.0 126-127 5.2625 0.0 0.0 0.0 0.0 128-129 5.6125 0.0 0.0 0.0 0.0 130-131 6.0625 0.0 0.0 0.0 0.0 132-133 6.6875 0.0 0.0 0.0 0.0 134-135 7.475 0.0 0.0 0.0 0.0 136-137 8.175 0.0 0.0 0.0 0.0 138-139 8.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAATCA 10 0.006830828 145.0 3 >>END_MODULE Read 871369 spots for SRR7166161.sra Written 871369 spots for SRR7166161.sra Read 871369 spots for SRR7166161.sra Written 871369 spots for SRR7166161.sra Read 871369 spots for SRR7166161.sra Written 871369 spots for SRR7166161.sra Read 871369 spots for SRR7166161.sra Written 871369 spots for SRR7166161.sra Read 871369 spots for SRR7166161.sra Written 871369 spots for SRR7166161.sra Read 871369 spots for SRR7166161.sra Written 871369 spots for SRR7166161.sra Read 871369 spots for SRR7166161.sra Written 871369 spots for SRR7166161.sra Read 871369 spots for SRR7166161.sra Written 871369 spots for SRR7166161.sra Read 871369 spots for SRR7166161.sra Written 871369 spots for SRR7166161.sra Read 871369 spots for SRR7166161.sra Written 871369 spots for SRR7166161.sra Read 871369 spots for SRR7166161.sra Written 871369 spots for SRR7166161.sra Read 871369 spots for SRR7166161.sra Written 871369 spots for SRR7166161.sra Read 871369 spots for SRR7166161.sra Written 871369 spots for SRR7166161.sra Read 871369 spots for SRR7166161.sra Written 871369 spots for SRR7166161.sra Read 871386 spots for SRR7166161.sra Written 871386 spots for SRR7166161.sra Read 871369 spots for SRR7166161.sra Written 871369 spots for SRR7166161.sra Read 871369 spots for SRR7166161.sra Written 871369 spots for SRR7166161.sra Read 871369 spots for SRR7166161.sra Written 871369 spots for SRR7166161.sra Read 871369 spots for SRR7166161.sra Written 871369 spots for SRR7166161.sra Read 871369 spots for SRR7166161.sra Written 871369 spots for SRR7166161.sra SRR ids: ['SRR7166161.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fw_sun7e SRR7166161.sra spots: 17427397 blocks: [[1, 871369], [871370, 1742738], [1742739, 2614107], [2614108, 3485476], [3485477, 4356845], [4356846, 5228214], [5228215, 6099583], [6099584, 6970952], [6970953, 7842321], [7842322, 8713690], [8713691, 9585059], [9585060, 10456428], [10456429, 11327797], [11327798, 12199166], [12199167, 13070535], [13070536, 13941904], [13941905, 14813273], [14813274, 15684642], [15684643, 16556011], [16556012, 17427397]] SRR7166161 file size 5883872 SRR7166161 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166161 SRR7166161_1.fastq SRR7166161_2.fastq Input file: SRR7166161_1.fastq Paired file: SRR7166161_2.fastq trimmed: SRR7166161-trimmed-pair1.fastq, SRR7166161-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 18:05:47 2025 >> started Fri Feb 14 18:06:08 2025 >> done (21.194s) 17427397 read pairs processed; of these: 10301 ( 0.06%) short read pairs filtered out after trimming by size control 7405 ( 0.04%) empty read pairs filtered out after trimming by size control 17409691 (99.90%) read pairs available; of these: 7600313 (43.66%) trimmed read pairs available after processing 9809378 (56.34%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 8 0.00% 20 5 0.00% 21 7 0.00% 22 8 0.00% 23 8 0.00% 24 8 0.00% 25 5 0.00% 26 5 0.00% 27 10 0.00% 28 3 0.00% 29 8 0.00% 30 11 0.00% 31 6 0.00% 32 9 0.00% 33 12 0.00% 34 10 0.00% 35 10 0.00% 36 10 0.00% 37 13 0.00% 38 7 0.00% 39 16 0.00% 40 14 0.00% 41 15 0.00% 42 18 0.00% 43 24 0.00% 44 15 0.00% 45 34 0.00% 46 34 0.00% 47 42 0.00% 48 38 0.00% 49 34 0.00% 50 43 0.00% 51 69 0.00% 52 56 0.00% 53 60 0.00% 54 78 0.00% 55 92 0.00% 56 96 0.00% 57 99 0.00% 58 143 0.00% 59 168 0.00% 60 167 0.00% 61 193 0.00% 62 225 0.00% 63 256 0.00% 64 296 0.00% 65 312 0.00% 66 384 0.00% 67 409 0.00% 68 480 0.00% 69 573 0.00% 70 653 0.00% 71 735 0.00% 72 951 0.01% 73 1012 0.01% 74 1134 0.01% 75 1303 0.01% 76 1452 0.01% 77 1694 0.01% 78 1760 0.01% 79 2063 0.01% 80 2420 0.01% 81 2731 0.02% 82 3132 0.02% 83 3648 0.02% 84 4454 0.03% 85 5221 0.03% 86 5646 0.03% 87 6152 0.04% 88 6533 0.04% 89 7064 0.04% 90 7827 0.04% 91 8629 0.05% 92 9416 0.05% 93 10421 0.06% 94 11389 0.07% 95 12298 0.07% 96 12890 0.07% 97 13553 0.08% 98 14564 0.08% 99 16092 0.09% 100 16248 0.09% 101 17736 0.10% 102 19059 0.11% 103 20563 0.12% 104 22042 0.13% 105 23141 0.13% 106 23752 0.14% 107 24988 0.14% 108 25926 0.15% 109 26937 0.15% 110 28564 0.16% 111 30297 0.17% 112 31603 0.18% 113 33289 0.19% 114 35713 0.21% 115 38004 0.22% 116 38808 0.22% 117 40044 0.23% 118 41176 0.24% 119 42602 0.24% 120 42971 0.25% 121 45527 0.26% 122 47630 0.27% 123 50164 0.29% 124 53124 0.31% 125 54682 0.31% 126 56561 0.32% 127 57239 0.33% 128 58412 0.34% 129 60705 0.35% 130 62558 0.36% 131 64826 0.37% 132 67873 0.39% 133 71425 0.41% 134 75054 0.43% 135 78504 0.45% 136 81565 0.47% 137 85336 0.49% 138 88372 0.51% 139 91950 0.53% 140 96482 0.55% 141 103986 0.60% 142 112044 0.64% 143 121956 0.70% 144 138767 0.80% 145 160893 0.92% 146 191678 1.10% 147 243874 1.40% 148 349870 2.01% 149 657916 3.78% 150 3366388 19.34% 151 9809378 56.34% 17409691 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=3.37 fanout-score-rank=28 prefix-density=0.42 prefix-fanout=2.9 sequence=CCACACTTGCAG criterion=fanout-score sequence-density=0.06 sequence-density-rank=36 fanout-score=51.90 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=9.3 sequence=ATCTCCTTCCAAACCATTAAGAGTTATGATCTTGTTCTCATCATCGAAGGAAACCTCCTCTTTAAAGACCCCGGCTTTCCCTCCGATTGTGTACTGCCAAATCCTGATAGAGCC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=4.38 fanout-score-rank=18 prefix-density=0.45 prefix-fanout=3.4 sequence=TGCAAGTGCGGCAGTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=31.56 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=5.4 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTC SRR7166161 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 18:07:30 Started mapping on | Feb 14 18:07:30 Finished on | Feb 14 18:09:35 Mapping speed, Million of reads per hour | 501.40 Number of input reads | 17409691 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 16561604 Uniquely mapped reads % | 95.13% Average mapped length | 292.81 Number of splices: Total | 16001920 Number of splices: Annotated (sjdb) | 15703648 Number of splices: GT/AG | 15740391 Number of splices: GC/AG | 202722 Number of splices: AT/AC | 12780 Number of splices: Non-canonical | 46027 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.22 Insertion rate per base | 0.02% Insertion average length | 2.17 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 431417 % of reads mapped to multiple loci | 2.48% Number of reads mapped to too many loci | 40869 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.09% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 427873 427873 427873 N_multimapping 431417 431417 431417 N_noFeature 545749 16379244 646743 N_ambiguous 174259 912 92325 UnstrandedReadsAssigned:15841596 PositiveStrandReadsAssigned:181448 NegativeStrandReadsAssigned:15822536 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7166161 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166161-trimmed-pair1.fastq SRR7166161-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,409,691 reads, 15,672,297 reads pseudoaligned [quant] estimated average fragment length: 226.096 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,055 rounds 52401 SRR7166161.ke.tsv 34699 SRR7166161.se.tsv 87100 total ==> SRR7166161.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1792.9 1109 37.6579 Potri.005G024800.1.v4.1 1035 809.904 369 27.738 Potri.004G059700.1.v4.1 961 735.919 15 1.24092 Potri.007G009000.2.v4.1 1416 1190.9 0 0 Potri.003G141000.2.v4.1 2943 2717.9 619.64 13.8799 Potri.016G087400.1.v4.1 270 87.8596 1015 703.33 Potri.015G069301.1.v4.1 564 342.844 0 0 Potri.010G195200.1.v4.1 1773 1547.9 364 14.3166 Potri.012G127500.1.v4.1 977 751.909 7512 608.236 ==> SRR7166161.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 155 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 454 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 298 SRR7166161 completed mapping pipeline successfully